Fish Physiol Biochem (2015) 41:745–759 DOI 10.1007/s10695-015-0043-z

Zebrafish vitamin K epoxide reductases: expression in vivo, along extracellular matrix mineralization and under phylloquinone and warfarin in vitro exposure Ignacio Ferna´ndez • Parameswaran Vijayakumar • Carlos Marques • M. Leonor Cancela • Paulo J. Gavaia Vincent Laize´

•

Received: 4 September 2014 / Accepted: 12 March 2015 / Published online: 20 March 2015 Ó Springer Science+Business Media Dordrecht 2015

Abstract Vitamin K (VK) acts as a cofactor driving the biological activation of VK-dependent proteins and conferring calcium-binding properties to them. As a result, VK is converted into VK epoxide, which must be recycled by VK epoxide reductases (Vkors) before it can be reused. Although VK has been shown to play a central role in fish development, particularly during skeletogenesis, pathways underlying VK actions are poorly understood, while good and reliable molecular markers for VK cycle/homeostasis are still lacking in fish. In the present work, expression of 2 zebrafish vkor genes was characterized along larval development and in adult tissues through qPCR analysis. Zebrafish cell line ZFB1 was used to evaluate in vitro regulation of vkors and other VK cycle-related genes during mineralization and upon 24 h exposure to 0.16 and 0.8 lM phylloquinone (VK1), 0.032 lM warfarin, or a combination of both molecules. Results showed that I. Ferna´ndez (&)  P. Vijayakumar  C. Marques  M. L. Cancela  P. J. Gavaia  V. Laize´ Centre of Marine Sciences (CCMAR), University of Algarve, Campus of Gambelas, 8005-139 Faro, Portugal e-mail: [email protected]; [email protected] P. Vijayakumar Centre for Ocean Research, Sathyabama University, Chennai, Tamilnadu, India M. L. Cancela Department of Biomedical Sciences and Medicine (DCBM), University of Algarve, Campus of Gambelas, 8005-139 Faro, Portugal

zebrafish vkors are differentially expressed during larval development, in adult tissues, and during cell differentiation/mineralization processes. Further, several VK cycle intermediates were differentially expressed in ZFB1 cells exposed to VK1 and/or warfarin. Present work provides data identifying different developmental stages and adult tissues where VK recycling is probably highly required, and shows how genes involved in VK cycle respond to VK nutritional status in skeletal cells. Expression of vkor genes can represent a reliable indicator to infer VK nutritional status in fish, while ZFB1 cells could represent a suitable in vitro tool to get insights into the mechanisms underlying VK action on fish bone. Keywords Vitamin K epoxide reductase  In vitro cell systems  Gene expression  Warfarin  Vitamin K  Danio rerio

Introduction Vitamin K (VK) is a fat-soluble vitamin acting as a cofactor for the c-glutamyl carboxylase (Ggcx). Ggcx catalyzes the post-translational carboxylation of glutamate (Glu) into c-carboxyglutamate (Gla), which is essential to the biological activity of VK-dependent proteins (VKDPs) in regulating Ca2? homeostasis (Oldenburg et al. 2008). During the course of ccarboxylation, VK is converted into VK epoxide,

123

746

which must be recycled to VK by the VK epoxide reductases (Vkors) before it can be reused (Stafford 2005). Up to date, two different proteins have been identified in mammals: Vitamin K epoxide reductase complex subunit 1 (Vkorc1; Rishavy et al. 2013) and Vkorc1-like 1 (Vkorc1l1; Hammed et al. 2013). While Vkorc1 may be more related to VK recycling for VKDP c-carboxylation in particular tissues, Vkorc1l1 was suggested as more efficient in VK recycling toward antioxidant role (Westhofen et al. 2011), but also with a VK recycling action of VKDP c-carboxylation in specific tissues (Hammed et al. 2013). This differential pattern of expression of both vkors in adult tissues remains to be uncovered in fish species. VK is also a ligand for the pregnane X receptor (Pxr, also known as steroid and xenobiotic receptor or Sxr; Tabb et al. 2003), a master regulator of xenobiotic metabolism (Chen et al. 2012) but also a factor involved in osteoblastic cell differentiation (Tabb et al. 2003; Ichikawa et al. 2006) and bone mineral density (Azuma et al. 2010), among other processes. Skeletal deformities are still one of the major bottlenecks in aquaculture (Boglione et al. 2013a, b), and several studies evidenced the potential role of VK in fish skeletal development (reviewed in Krossøy et al. 2011). Recently, zebrafish (Danio rerio) exposed to warfarin (a blocker of Vkor activity) during early development showed an impaired larval development (Weigt et al. 2012), while zebrafish larvae chronically exposed to warfarin showed an increased occurrence of skeletal deformities and calcification in soft tissues (Ferna´ndez et al. 2014a). On the contrary, VK dietary supplementation improves larval skeletal development in Senegalese sole (Solea senegalensis; Richard et al. 2014). In those studies, we confirmed that opposite VK status (induced VK deficiency by warfarin exposure and VK supplementation) was correlated with the altered expression of some of the molecular players of the VK cycle. Interestingly, ggcx and pxr were found to be expressed in fish species at different developmental stages and in different adult tissues (Hanumanthaiah et al. 2001; Krossøy et al. 2010; Ferna´ndez et al. 2014a); however, little is known about the expression patterns of fish vkor genes, the key enzymes of VK recycling. In mammals, different indicators have been used to evaluate VK status (reviewed in Shearer 2009). Krossøy et al. (2009) proposed the liver Ggcx activity in Atlantic salmon (Salmo salar) as a good marker of VK status since its activity showed a dose-dependent

123

Fish Physiol Biochem (2015) 41:745–759

response to the level of menadione nicotinamide bisulfite (MNB; one of the most used sources of VK in fish feeds). However, ggcx gene expression was not altered by different MNB dietary supplementations. Furthermore, menadione was found to not act as a cofactor of Ggcx in Atlantic salmon liver (Krossøy et al. 2010). Since good indicators of nutritional status will be those given a differential response to different dietary intake or metabolism of a nutrient in question (Potischman and Freudenheim 2003), activity and gene expression of Ggcx in Atlantic salmon liver might not be suitable. Since Pxr is ligand activated by a wide set of molecules, not only by VK (Ekins et al. 2008), it seems that this molecular player might also not be a good biomaker for VK nutritional status. VK deficiency (by warfarin exposure, ggcx gene mutation or low dietary intake) induces death by bleeding (Menger et al. 1997; Hanumanthaiah et al. 2001; Zhu et al. 2007; Spohn et al. 2009; Weigt et al. 2012; Ferna´ndez et al. 2014a) and thus, an in vitro approach will permit to study how a VK imbalance affects early osteogenesis independent of the effects on blood coagulation. Thus, the present study aimed at (1) describing the gene expression patterns for vkors along larval development and in adult tissues to get insights into the biological process requiring VK recycling; (2) testing the suitability of zebrafish ZFB1 cell line, capable of in vitro mineralization (Vijayakumar et al. 2013), to study how cellular mechanisms are regulated by VK nutritional status in skeletal tissue mineralization; and (3) evaluating the suitability of vkor gene expression as a good indicator of VK nutritional status in bone tissues.

Materials and methods Zebrafish vitamin K epoxide reductase protein sequences Zebrafish Vkor protein sequences were retrieved from GenBank database (www.ncbi.nih.gov), using PSI– BLAST (Altschul et al. 1997) and the human Vkorc1l1 amino acid sequence as query. Zebrafish protein sequences were aligned with orthologs of Homo sapiens, Mus musculus, Xenopus tropicalis and Ciona intestinalis. The multiple-sequence alignment was performed using T-Coffee facilities at tcoffee.org (Di Tommaso et al. 2011).

Fish Physiol Biochem (2015) 41:745–759

Ethics statement All experiments were performed according to directives PORT 1005/92 of the Portuguese veterinary services and 2010/63/EU of the European parliament and council, and to the guideline 86/609/EU of the European Union council. Zebrafish rearing A wild-type zebrafish broodstock was maintained in a water recirculation unit (20 % daily renewal) and mated at regular intervals. Water parameters were as follows: 28.5 ± 0.5 °C, pH 7.6 ± 0.2, 760 mS conductivity, 7.8 mg L-1 dissolved oxygen; 14:10 h light/dark photoperiod. Expression of zebrafish vkor genes throughout larval development was determined from developmental stages collected during a standard rearing procedure. Hundred fertilized eggs per 1-L tank were incubated until hatching, and larvae were raised until 17 days post fertilization (dpf) with 90 % water renewal every 2 days and then transferred to 3-L tanks connected to the abovementioned recirculation unit, at a density of 25 fish L-1. Larvae were fed three times per day with Artemia nauplii (5 nauplii mL-1; AF strain; INVE) from 5 to 10 dpf and with Artemia metanauplii (10 metanauplii mL-1; EG strain; INVE) enriched with Red Pepper (Bernaqua) from 8 to 32 dpf. Juveniles (32 dpf), adults and broodstock were fed twice a day with commercial dry feeds and once a day with Artemia nauplii (EG strain). Fish sampling Fish were euthanized with a lethal dose of tricaine methanesulfonate (MS-222, Sigma-Aldrich), washed with sterile distilled water and preserved in 1 ml of TRIzol reagent (QIAGEN) at -80 °C until RNA extraction. Embryos were sampled at cleavage (4 cells—0.75 h post fertilization; hpf), tailbud (10 hpf) and prim-5 (24 hpf) stages. Larvae were sampled at hatching (48 hpf), 3, 5, 7, 9, 12, 15, 21, 24 and 28 dpf. The amount of material sampled was adapted to specimen size and ranged between 100 eggs and five early juveniles (28 dpf). Adult zebrafish tissues (eyes, operculum, vertebra, gills, skin, muscle, brain, liver, kidney, spleen, ovary, stomach and intestine) were

747

sampled from three males and two females and pooled. Cell maintenance and ECM mineralization Zebrafish ZFB1 cell line was established in our laboratory from a pool of zebrafish-calcified tissues (vertebra, upper and lower jaws, and branchial arches; Vijayakumar et al. 2013). Cells are capable of differentiating toward osteoblastic or chondroblastic lineages upon exposure to mineralogenic or chondrogenic cocktail, respectively; and can mineralize their extracellular matrix. ZFB1 cells have been maintained in culture for more than 70 passages without noticeable phenotype changes. ZFB1 cells were routinely cultured at 28 °C in L-15 medium supplemented with 1 % penicillin–streptomycin, 0.2 % fungizone and 15 % fetal bovine serum. When induced for mineralization, cell cultures were seeded at 105 cells/well in six-well plates and grown to confluence. Extracellular matrix (ECM) mineralization was induced in confluent cell cultures by supplementing regular culture medium with mineralization cocktail: 10 mM bglycerophosphate, 4 mM calcium chloride and 50 lg mL-1 of L-ascorbic acid. Culture medium was renewed twice a week. RNA was prepared from triplicate cultures grown for 1 and 3 weeks under normal and mineralizing conditions. Exposure to warfarin and vitamin K Stock solutions of warfarin (3-(a-acetonylbenzyl)-4hydroxycoumarin sodium salt; Sigma-Aldrich) and phylloquinone (VK1; Sigma-Aldrich) were dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich) at 1 mM (warfarin) and 1 and 10 mM (VK1) and added to culture media in order to reach final concentrations of 0.16 lM VK1 (VK1-A group); 0.8 lM VK1 (VK1-B group); 0.032 lM warfarin (W group); 0.032 lM warfarin and 0.8 lM VK1 (W ? VK1 group). These concentrations were non-toxic in a 15-day trial using confluent cell cultures and cell viability assay (Cell Titer 96 AQueous Non–Radioactive Cell Proliferation assay, Promega; results not shown). Cells were seeded at 3 9 105 cells/well in six-well plates, cultured for 24 h and then exposed to warfarin and/or VK1, or left untreated. Exposure to DMSO, VK1 and warfarin were done in triplicate. When treated with warfarin and/or

123

748

Fish Physiol Biochem (2015) 41:745–759

VK1, cell cultures were maintained under dim light to prevent photodegradation of the molecules. RNA extraction and qPCR amplification Total RNA was purified from eggs, larvae, tissues and cell cultures using TRIzol reagent, and quantity and integrity were determined using a NanoDrop 1000 spectrophotometer (Thermo Scientific) and an Experion automated electrophoresis system (Bio-Rad). RNA samples (1 lg) were submitted to RQ1 RNaseFree DNase (Promega) then reverse-transcribed with M-MLV reverse transcriptase (Invitrogen). Quantitative PCR (qPCR) was performed on a StepOnePlus Real-Time PCR system (Applied Biosystems) using gene-specific forward and reverse primers (Table 1). qPCR efficiency was close to 100 % for all genes. All reactions were performed in triplicates in 96-well plates and contained the following: 10 ll of SsoFast EVAgreen Supermix (Bio-Rad), 0.5 ll of forward and reverse primers, 7 ll of molecular biology grade water and 2 ll of a 1:10 dilution of the cDNA solution. Amplification parameters were as follows: 95 °C for 1 min, followed by 40 amplification cycles at 95 °C for 5 s and 65 °C for 10 s. A final dissociation reaction (melting curve) was performed with the following steps: 95 8C for 15 s, 70 °C for 1 min, and 15 s at incremental temperatures of 0.5 °C until 95 °C. Relative gene expression was determined according

to Pfaffl et al. (2004) using as reference samples: (1) 12 and 21 dpf larvae along larval development for vkorc1l1 and vkorc1 genes, respectively; (2) operculum and stomach in adult tissues for vkorc1l1 and vkorc1 genes, respectively; (3) ZFB1 cells cultured for 1 week in regular medium (T1C) in ECM mineralization trial; and (4) ZFB1 control cells (without DMSO, VK1 and W) in 24-h exposure experiment. Gene expression of reference samples was set to 1. Relative gene expression in control cells was not significantly different (Student’s t test, P [ 0.05) from that of vehicle-treated cells (DMSO) and is therefore not presented. The suitability of three housekeeping genes, b1-actin (actb1; NM_131031), eukaryotic translation elongation factor 1 alpha 1, like 1 (eef1a1l1; NM_131263) and 18S small subunit ribosomal RNA (18S; FJ915075), was evaluated using NormFinder (Andersen et al. 2004) and BestKeeper (Pfaffl et al. 2004) algorithms, and 18S was selected as the best housekeeping gene. Statistical analysis Results are given as mean ± standard deviation. Significance of the differences in gene expression during mineralization was tested by Student’s t test. Significance of the differences in gene expression upon exposure to VK1 and/or warfarin was tested by one-way ANOVA or t test. When significant

Table 1 Primers used to quantify gene expression along larval development, in adult tissues and ZFB1 cell line Gene symbol

GenBank accession no.

pxr

NM_001098617

50 –30 primer sequences Forward

ATGAAGTGACGGGAATTTGGG

Reverse

GATGGTGCTGAAAACCAGCTC

vkorc1l1

NM_001020688

Forward Reverse

CGGCTGCTCGTGTGTCTCTCAGG GCGGTAGTTGGCGTCTCGGGT

vkorc1

XM_001336424 and

Forward

GTCCTCTTGGGTGTCCGTGGC

KP798451

Reverse

TGGCTCTTCCCTTTCTTCAGGCG

ggcx

XM_003199291

Forward

GTGATGTTCCTTGGTGCTGTTGGT

Reverse

AGCGTTCCTCTTCCTCGGGT

calu-a

NM_001002151

Forward

TGTGTCTGGGATTCTCGGC

Reverse

TGGTTTGCTGGTGGCGT

calu-b 18S

123

NM_201082 NM_001098396

Forward

ACAGCAGCGACTCCATCAAA

Reverse

ACTCTTGGCTGGGTTGGTTT

Forward

ACCACCCACAGAATCGAGAAA

Reverse

GCCTGCGGCTTAATTTGACT

Amplicon size (bp) 81 87 174 219 124 212 98

Fish Physiol Biochem (2015) 41:745–759

differences were detected, Tukey’s multiple-comparison test was used to determine differences among experimental groups. Correlation between different variables was also evaluated with the Pearson product moment correlation test. In all cases, differences were considered to be significant when P \ 0.05. All statistic analyses were done using GraphPad Prism 5.0 (GraphPad Software, Inc.).

Results Zebrafish Vkor protein sequences and its conservation through evolution Three different protein sequences have been identified in zebrafish with vitamin K epoxide reductase activity through genomic inference: Vitamin K epoxide reductase complex subunit 1-like 1 (Vkorc1l1; NP_001018524), Vitamin K epoxide reductase complex subunit 1 (Vkorc1; XP_001336460) and its variant R58 K (Vkorc1-varR58 K; KP798451) comprising 175, 171 and 171 amino acids, respectively. While vkorc1l1 gene is located on zebrafish chromosome 5, vkorc1 gene is on chromosome 12. Homology analysis of zebrafish Vkorc1l1 and Vkorc1 shows a consistent degree of identity with mammalian Vkorc1l1 (71 and 54 % with human (NP_775788) and 70 and 55 % with mouse (NP_081397), respectively) and Vkorc1 (47 and 53 % with human (NP_076869) and 52 and 58 % with mouse (NP_848715), respectively) proteins. Multiple alignment of Vkor protein sequences from C. intestinalis, X. tropicalis, D. rerio, M. musculus and H. sapiens is presented in Fig. 1. A high degree of conservation was found at positions known to be involved in Vkor functions. All sequences presented the known hydrophobic environment of the thiol redox (CXXC) site of the enzyme and the characteristic active sites (four cysteines and one serine/threonine). Similarly, the valine (Val-29), arginine (Arg-58) and leucine (Leu-128) residues associated with resistance to warfarin-type anticoagulants in human Vkorc1 protein were fully conserved in zebrafish Vkorc1l1 and Vkorc1. However, a zebrafish Vkorc1 protein variant was cloned in our laboratory (KP798451) showing a substitution of Arg by a lysine at position 58. Interestingly, while four transmembrane domains are predicted for mammalian Vkors, only three are

749

predicted in zebrafish. Finally, the warfarin binding motif (TYX), showed a lower degree of conservation along evolution, only found to be present in its fully conserved form (TYA) in human, mouse and xenopus Vkorc1 and zebrafish Vkorc1l1. Spatiotemporal expression patterns of vkor genes during larval development and in adult tissues Expression of zebrafish vkor genes was evaluated by means of qPCR from egg fertilization to juvenile stage (Fig. 2). Level of vkorc1l1 expression was the highest (up to 26.6-folds) at 4-cell stage, diminishing at Prim5 stage and remaining stable afterward (ranging from 1.0- to 5.9-folds). Vkorc1 was also detected at 4-cell stage but showed an expression peak (9.2- to 9.8-folds) at 72–96 hpf, and a lower and stable gene expression value afterward (1.1- to 4.6-folds). Gene expression of vkorc1l1 and vkorc1 was different depending on the tissue considered (Fig. 3). Both exhibited highest expression in muscle (52.7- to 48.4-folds) and brain (23.8- to 19.9-folds), respectively. While ubiquitously expressed, vkorc1l1 was also highly expressed in ovary (43.3-folds) and at intermediate levels in spleen, vertebra and eyes, while the lowest levels were detected in stomach. In contrast, tissue distribution of vkorc1 expression was more restricted, being also expressed in eye, vertebra and liver with intermediate values (2.6- to 5.4-folds) and in gills, skin and operculum with low expression values. VK-related gene expression during ECM mineralization of ZFB1 cell line and its regulation by VK nutritional status The expression of pxr, ggcx, vkorc1l1, vkorc1 and calumenin (calu-a and calu-b) genes were determined in cultures of ZFB1 cells undergoing ECM mineralization and under different VK nutritional conditions. All those genes were found to be differentially expressed during ECM mineralization (Fig. 4). At cell differentiation and ECM mineralization of ZFB1 cells, pxr gene expression was low (Ct values[30). It was significantly increased after 1 week of mineralization (T1M; t test, P \ 0.05), but not after 3 weeks. In general, and similarly to pxr, most of the analyzed genes (ggcx, vkorc1l1, vkorc1 and calumenins) were found to be significantly overexpressed in differentiating (T1M) but not in mineralizating (T3M) cells

123

750

Fig. 1 Multiple-sequence alignment of Vkor proteins from sea squirt (C. intestinalis), Western clawed frog (X. tropicalis), zebrafish (D. rerio), rat (M. musculus) and human (H. sapiens). Hash at the top of the alignment indicates Vkor active sites (the four cysteines and the serine); the symbols dot, colon and asterisk at the bottom of the alignment reflect increasing conservation per residue in the aligned sequences; yellow box, warfarin binding motif (TYX) being letters in bold and underlined when it is fully conserved (TYA); gray box, the known hydrophobic environment of the thiol redox site of the

Fig. 2 Relative expression of zebrafish vitamin K epoxide reductase complex subunit 1-like 1 (vkorc1l1) and vitamin K epoxide reductase complex subunit 1 (vkorc1) throughout development. Transcript levels were determined by qPCR from three technical replicates and normalized using 18S housekeeping gene. Levels at 12 and 21 dpf were used as reference and set to 1 for vkorc1l1 and vkorc1, respectively. hpf and dpf, hours and days post fertilization. Letters (a, b, c, d, f) on the top of the bars indicate significant differences in gene expression among developmental stages (ANOVA, P \ 0.05)

123

Fish Physiol Biochem (2015) 41:745–759

enzyme; green boxes, predicted transmembrane domains; blue boxes, amino acids which mutation has been described to reduce human/mouse Vkorc1 activity; red boxes, amino acids which mutation has been described to reduce activity and increase warfarin resistance in human/mouse Vkorc1 proteins (data from Pelz et al. 2005; Rost et al. 2005, 2009; Rishavy et al. 2011; Watzka et al. 2010; Mu¨ller et al. 2014; Czogalla et al. 2015). Cioint, C. intestinalis; Danrer, D. rerio; Homsap, H. sapiens; Musmus, M. musculus; Xentro, X. tropicalis

Fish Physiol Biochem (2015) 41:745–759

751

Fig. 3 Relative expression of zebrafish vitamin K epoxide reductase complex subunit 1-like 1 (vkorc1l1) and vitamin K epoxide reductase complex subunit 1 (vkorc1) in adult tissues. Transcript levels were determined by qPCR from three technical replicates and normalized using 18S housekeeping gene. Levels in operculum and stomach were used as reference and set to 1 for vkorc1l1 and vkorc1, respectively. Letters (a, b, c, d, f) on the top of the bars indicate significant differences in gene expression among tissues (ANOVA, P \ 0.05); hash indicates samples where no gene expression was detected

compared with non-mineralizing conditions (T1C and T3C), with the exception of calu-b that still remained up-regulated during ECM mineralization (t test, P \ 0.05). When ZFB1 cells were cultured during 24 h with medium supplemented with low levels of phylloquinone (VK1; 0.16 and 0.8 lM), a slight effect on the expression of VK-related genes was observed (Fig. 5). All genes tended to be down-regulated in a concentration-dependent manner upon cell exposure to VK1, although it was only significantly for calu-b, showing a negative correlation with VK supplementation (Pearson Product Moment Correlation test; R2 = 0.644; P \ 0.05). Nevertheless, the effect of VK nutritional status on the expression of VK-related genes was clearly demonstrated when cells were exposed to warfarin or to the combination of warfarin and VK1. All genes showed a clear up-regulation when cells were under a VK-induced deficiency (warfarin treatment), comparing with the expression levels under VK1 supplementation (Fig. 5; ANOVA and t test, P \ 0.05). When cells were exposed simultaneously to warfarin and VK1, expression values reached the levels of a VK supplementation condition (downregulated relatively to warfarin treatment) as it is the case of pxr, vkorc1l1 and vkorc1 (ANOVA, P \ 0.05),

meanwhile others exhibited intermediate values (ggcx and calumenins).

Discussion Zebrafish Vkor protein sequences and its conservation through evolution It was proposed that in contrast to genomes of archaea, eubacteria, plants, protists, and lower animals that include a single Vkor protein ortholog, vertebrate genomes include two paralogous enzymes, Vkorc1 and Vkorc1l1, likely resulting from the duplication of a common ancestor gene (Westhofen et al. 2011). Mammalian Vkorc1 has evolved a greater efficiency for Vkor enzymatic activity (de-epoxidation), while Vkorc1l1 is responsible for driving VK-mediated intracellular antioxidation pathways critical to cell survival, in addition to the Vkor activity in extrahepatic tissues (Westhofen et al. 2011; Hammed et al. 2013; Rishavy et al. 2013). Two different Vkor proteins have been identified in zebrafish with a high degree of amino acid sequence identity with Vkorc1l1 and Vkorc1.

123

752

Fig. 4 Relative expression of VK cycle marker genes and calumenin genes during ECM mineralization of ZBF1 cells. Expression of pregnane X receptor (pxr), c-glutamyl carboxylase (ggcx), vitamin K epoxide reductase complex subunit 1 like 1 (vkorc1l1), vitamin K epoxide reductase complex subunit 1 (vkorc1), calumenin-a (calu-a) and calumenin-b (calu-b) genes was determined in ZFB1 cells cultured for 1 (T1) or 3 (T3)

123

Fish Physiol Biochem (2015) 41:745–759

weeks in regular medium (C) or in medium supplemented with mineralogenic cocktail (M). Gene expression at T1C was set to 1 and used as reference sample to determine relative expression during ECM mineralization. 18S ribosomal RNA was used to normalize levels of gene expression. Asterisk indicates significant differences between cells with or without mineralization induction at each sampling time (Student’s t test, P \ 0.05)

Fish Physiol Biochem (2015) 41:745–759

Multiple alignment of Vkors protein sequences from C. intestinalis, X. tropicalis, D. rerio, M. musculus and H. sapiens showed the conservation of important amino acids related to Vkor protein function such as the characteristic active sites (Goodstadt and Posting 2004), and the known hydrophobic environment of the thiol redox (CXXC) site (Wallin et al. 2002), consistent with the lipophilicity of VK and warfarin (Goodstadt and Posting 2004). The zebrafish Vkorc1l1 and Vkorc1 sequences, conserved the valine (Val-29), arginine (Arg-58) and leucine (Leu-128) amino acids known to be associated with resistance to warfarin-type anticoagulants in human Vkorc1 protein (Rost et al. 2004). In this sense, a zebrafish Vkorc1 variant has been recently cloned in our laboratory, showing a substitution of Arg by a lysine at position 58. Up to date, we do not know whether this mutation also confers warfarin resistance to zebrafish Vkorc1, but other amino acid residues responsible of lower Vkorc1 activity and/or warfarin resistance in human and mouse Vkorc1 proteins (Pelz et al. 2005; Rost et al. 2005, 2009; Rishavy et al. 2011; Watzka et al. 2010; Mu¨ller et al. 2014; Czogalla et al. 2015) have been also indentified to not be conserved in zebrafish Vkorc1 proteins. In contrast, the presence of particular number of transmembrane domains and the warfarin binding motif (TYX; Stafford 2005; Oldenburg et al. 2008) showed a lower degree of conservation. The presence of four or three transmembrane domains in Vkors has been the focus of controversy. Tie et al. (2012, 2014) proposed that Vkorc1 has three transmembrane domains, while Vkorc1l1 has four transmembrane domains. In contrast, other works suggested the presence of four transmembrane domains in Vkorc1 (Schulman et al. 2010; Rishavy et al. 2011). Nevertheless, three transmembrane domains are predicted for zebrafish Vkorc1 and Vkorc1l1. Since the different membrane topologies and reaction mechanisms between Vkorc1l1 and Vkorc1 suggested that these two proteins might have different physiological functions (Tie et al. 2014), different physiological roles or at least efficiencies for zebrafish Vkors might be expected. Regarding the warfarin binding motif on its fully conserved form (TYA), the presence of such fully conserved warfarin motif in zebrafish Vkorc1l1 protein, but not in zebrafish Vkorc1, might explain why the first exhibit a higher response at gene expression level in vivo (Ferna´ndez et al. 2014a)

753

and in vitro (present study), as a compensatory feedback mechanism against VK recycling impairment. Furthermore, a similar although to a lesser extent response of zebrafish Vkorc1 upon warfarin exposure is in agreement with the reported higher resistance of the human Vkorc1l1 (without the fully conserved TYA motif) to warfarin (Hammed et al. 2013).

Differential expression of vkor genes throughout zebrafish development and in adult tissues In contrast to ggcx (Hanumanthaiah et al. 2001; Krossøy et al. 2010) and pxr (Tabb et al. 2003; Bresolin et al. 2005; Bertrand et al. 2007; Bainy et al. 2013; Ferna´ndez et al. 2014a), little is known about when and where vkor genes are expressed during early development and in adult tissues. In this regard, only partial information about vkor spatiotemporal expression in C. intestinalis (Kulman et al. 2006) and Rattus norvegicus (Hammed et al. 2013) is available. This is the first study reporting expression patterns of vkor genes throughout larval development and in adult tissues in fish. These patterns are in agreement with the sub- or neofunctionalization processes that occurred after gene duplication (Force et al. 1999) of each Vkor enzyme in zebrafish. Nevertheless, high expression of zebrafish vkor genes during early development (from 4 hpf to mouth opening) is in agreement with the suggested critical requirements of VK for early fish development (reviewed in Krossøy et al. 2011). In accordance with the neofunctionalization or specialization of Vkor proteins in zebrafish, vkorc1l1 and vkorc1 expression was differentially distributed in adult tissues. Both exhibited their highest levels of expression in muscle and brain tissues. On the one hand, high expression of both vkor genes in muscle is in line with the proteomic regulation of myosins and creatine kinase in Senegalese sole larvae fed with VK supplemented diets (Richard et al. 2014). On the other hand, high expression in brain is in concordance with the new roles of VK in brain development and homeostasis (reviewed in Ferland 2012) and the expression of both genes in rat brain (Hammed et al. 2013). In addition, the ubiquitous expression of vkorc1l1 gene and the restricted expression of vkorc1 gene in zebrafish tissues have been also observed in

123

754

mammals (Westhofen et al. 2011), suggesting that neofunctionalization of Vkor proteins was conserved throughout the evolution of vertebrates. High

123

Fish Physiol Biochem (2015) 41:745–759

vkorc1l1 gene expression in ovary evidence a possible important and new role of VK in reproduction, in agreement with reported VK nutritional requirement

Fish Physiol Biochem (2015) 41:745–759 b Fig. 5 Relative expression of VK cycle marker genes and

calumenin genes in ZFB1 cells exposed to increased levels of phylloquinone and/or warfarin. Expression of pregnane X receptor (pxr), c-glutamyl carboxylase (ggcx), vitamin K epoxide reductase complex subunit 1 like 1 (vkorc1l1), vitamin K epoxide reductase complex subunit 1 (vkorc1), calumenina (calu-a) and calumenin-b (calu-b) genes was determined in ZFB1 cells exposed for 24 h to vehicle (DMSO), 0.16 lM of phylloquinone (VK1-A), 0.8 lM of phylloquinone (VK1-B), 0.032 lM of warfarin (W) and 0.032 lM of warfarin plus 0.8 lM of phylloquinone (W ? VK1). Gene expression in control cells (without DMSO, VK1 and W) was set to 1 (not shown) and used as reference sample to determine relative expression in treated cells. 18S ribosomal RNA was used to normalize levels of gene expression. Asterisk indicates significant differences in gene expression between two treatments (t test, P \ 0.05). Letters (a, b, c) on the top of the bars indicate significant differences in gene expression among treatments (ANOVA, P \ 0.05). A negative correlation between concentration of VK1 in cell culture medium and calu-b gene expression was found (Pearson Product Moment Correlation test; R2 = 0.644; P \ 0.05)

for offspring development (Udagawa 2004). Furthermore, expression levels of vkorc1l1 and vkorc1 genes in vertebra and operculum are in agreement with the reported role of VK in skeletal tissues (Tabb et al. 2003; Atkins et al. 2009; Azuma et al. 2010; Krossøy et al. 2011; Ferna´ndez et al. 2014a), while the low expression of vkorc1l1 and vkorc1 genes in skin might confirm the role of VK in skin development/ homeostasis previously suggested (Richard et al. 2014). VK-related genes are differentially expressed in bone tissue development Even though recent in vivo studies have focused on the role of VK in fish physiology (reviewed in Krossøy et al. 2011; Ferna´ndez et al. 2014a; Richard et al. 2014), the cellular and molecular mechanisms regulated by VK are still not fully understood, in particular those involved in bone development and homeostasis. To get insights into bone-specific signaling pathways, cell systems capable of in vitro mineralization have been established and their suitability to study the mineralogenic effect of different molecules and transcription factors is well documented (reviewed by Rafael et al. 2010 and Laize´ et al. 2015). The present work is the first in vitro study investigating the effects of VK at gene level using zebrafish skeletal cells. An effect of VK on bone homeostasis has already been demonstrated in mammals (Atkins et al. 2009;

755

Jeong et al. 2011), although the role of each molecular player related with its metabolic cycle or cellular function remains poorly understood. The nuclear receptor pxr, activated by VK, has been reported to be expressed in bony tissues and to regulate osteoblastic differentiation, function and homeostasis in different species (Tabb et al. 2003; Ichikawa et al. 2006; Azuma et al. 2010; Ferna´ndez et al. 2014a). Expression of pxr gene during differentiation and ECM mineralization of ZFB1 cells was low, consistent with the low expression previously reported in calcified tissues (Ferna´ndez et al. 2014a). The increased expression of pxr after 1 week of mineralization (T1M) is concomitant with the higher expression of alkaline phosphatase gene (as well as other osteogenic factors, Vijayakumar et al. 2013) and the osteogenic differentiation of ZFB1 cells; consistent with its reported role in mammalian bone tissue (Ichikawa et al. 2006; Azuma et al. 2010). Similarly, ggcx transcript was also detected in ZFB1 cells, in agreement with its presence in fish-calcified tissues such as vertebrae, scales, operculum and fin (Krossøy et al. 2010). Gene expression of vkorc1l1 and vkorc1 in ZFB1 cells is in agreement with reports demonstrating their expression in ROS 17/2.8 osteoblast-like cells (Hammed et al. 2013) and in zebrafish vertebra (present study). The up-regulation of these genes upon cell differentiation, but not at ECM mineralization, may indicate that osteoblastic differentiation might require an increase in VK recycling capacity, possibly for calcium homeostasis or for the reported VK-mediated intracellular anti-oxidation pathways (Westhofen et al. 2011). Although this should be further demonstrated, up-regulation of vkorc1l1 gene expression was apparently higher than that of vkorc1 gene, in agreement with its higher expression in zebrafish-calcified tissues (operculum and vertebra) and with the fact that 68 % of Vkor activity would be supported by Vkorc1l1 in other osteoblast-like cells (Hammed et al. 2013). Calumenin (Calu) is a Ca2?-binding protein located in the lumen of the sarcoplasmatic reticulum (Sahoo and Kim 2010). Ubiquitous expression of calu gene has been documented (Sahoo et al. 2009) and associated with the inhibition of Ggcx activity and shown to play a role in regulation and performance of the ccarboxylation system and thus, the biosynthesis of functional VKDPs (Wajih et al. 2004). Calu has also

123

756

been involved in the alleviation of endoplasmatic reticulum (ER) stress, similarly to other ER-resident chaperones (Lee et al. 2013). In ZFB1 cells, calu-a and calu-b genes were both up-regulated during cell differentiation, but only calu-b gene remained upregulated during ECM mineralization. These results suggest (1) a higher stress condition in early bone tissue/organ development than in maintenance of tissue homeostasis, in accordance with the reported higher gene expression of calu in embryonic rather than in adult heart (Sahoo et al. 2009) and (2) a tight control of VKDP c-carboxylation during cell differentiation. Altogether, our data demonstrate that expression of molecular players involved in VK cycle is differentially expressed during differentiation and mineralization of skeletal ZFB1 cells, supporting the hypothesis of a direct and key role of VK in fish bone homeostasis. Phylloquinone and warfarin regulate the expression of VK cycle-related genes in a fish skeletal cell line Jeong et al. (2011) recently reported that warfarin inhibits the differentiation of the mammalian C2C12 osteoblastic cell line. In addition, a net positive effect of VK on bone formation by osteoblasts and osteocytes has been reported (Atkins et al. 2009). Although all VK forms effectively promoted in vitro mineralization, VK1-induced mineralization was more sensitive to warfarin than that induced by VK2 and VK3 (Atkins et al. 2009), with the c-carboxylation of VKDPs and the activation of Pxr signaling pathway involved in the effect of VK on bone formation and homeostasis (Tabb et al. 2003; Ichikawa et al. 2006; Ferna´ndez et al. 2014a). Exposure of ZFB1 cells to low levels of phylloquinone had limited effects on the expression of genes involved in transcriptional regulation (pxr), VK cycle (ggcx, vkorc1l1 and vkorc1) and calcium-binding chaperones (calu-a and calu-b), in agreement with previous reports in mammals (Atkins et al. 2009). All genes tend to be down-regulated in a concentration-dependent manner upon cell exposure to VK1. The limited effect of VK1 on gene expression could be related (1) to the small amounts of VK1 supplemented in cell culture medium and/or (2) to the fact that VK1 content in commercial cell culture medium [information not available from the supplier; but reported in other commercial cell culture media to

123

Fish Physiol Biochem (2015) 41:745–759

be around 24 pM (Westhofen et al. 2011)] is already enough to fulfill VK requirements of ZFB1 cells. In this sense, a cytotoxic effect of VK1 at concentrations higher than 0.8 lM for an extended period (15 days) was observed (results not shown). However, since VK1 (0.8 lM) was able to rescue almost completely the effect of the induced VK deficiency with warfarin treatment (0.032 lM) on gene expression, the second hypothesis seems more plausible. Although not statistically significant, the trend to decrease pxr gene expression under increased VK1 levels is in agreement with the in vivo down-regulation of pxr in Senegalese sole fed increased dietary levels of VK1 (Richard et al. 2014). The regulation of pxr gene expression by VK nutritional status, specifically in skeletal tissues, was confirmed here. Regulation by warfarin is in accordance with the upregulation of pxr gene in zebrafish larvae exposed to warfarin (Ferna´ndez et al. 2014a). The fact that pxr gene up-regulation by warfarin in ZFB1 cells was fully restored to normal levels by the addition of VK1 in culture medium suggests that pxr gene expression depends more on the VK status than on an effect derived from warfarin metabolism through the reported transcriptional effect of Pxr on cyp2c9 gene expression (Chen et al. 2004), responsible for warfarin metabolism (Goldstein and de Morais 1994). Therefore, present results suggest that the reported mineralogenic effect of VK (Atkins et al. 2009) might be due not only to its role on c-carboxylation but also to Pxr signaling, as already suggested in mammals (Azuma et al. 2010) and in fish (Ferna´ndez et al. 2014a). Expression of ggcx gene was also down-regulated upon exposure of ZFB1 cells to increased levels of VK1 and up-regulated with warfarin treatment. However, the warfarin effect was not fully rescued by co-addition of VK1, showing intermediate levels depending on whether cells were treated with VK1 or warfarin. A dose-dependent inhibition of Ggcx protein activity by warfarin has been shown in whole zebrafish larvae (Hanumanthaiah et al. 2001) as well as an up-regulation of its gene expression (Ferna´ndez et al. 2014a). Since levels of ggcx gene expression under warfarin treatment were only partially rescued by the supplementation of VK1, it seems that ggcx expression is not a good biomarker that responds to small alterations on the VK nutritional status, although even very low tissue levels of VK1 were demonstrated to be sufficient to sustain Ggcx activity (Krossøy et al. 2009).

Fish Physiol Biochem (2015) 41:745–759

Genes coding for Vkor proteins (vkorc1l1 and vkorc1) showed similar gene expression patterns in response to increasing levels of VK1 in culture medium, exposure to warfarin and combined treatment with both molecules. Warfarin exposure significantly increased vkorc1l1 and vkorc1 gene expression ratios, consistent with in vivo results (Ferna´ndez et al. 2014a). Co-supplementation with VK1 fully rescued warfarin effects on vkor gene expression, in contrast to the partial rescue of ggcx gene expression values. Warfarin is known to block Vkor protein activity (VK recycling) through binding to the TYX motif (Oldenburg et al. 2008). Although fully conserved in zebrafish Vkorc1l1 protein, this motif is truncated in Vkorc1. Nevertheless, reduced Vkor activity of both proteins (Vkorc1l1 and Vkorc1) in microsomes from recombinant yeast expressing human or rat Vkorc1l1 or Vkorc1 proteins following warfarin exposure has been reported (Hammed et al. 2013). In this sense, since a significantly different gene expression level was reached for vkorc1l1 between DMSO-treated and warfarin-treated cells, as well as between those exposed to warfarin and to warfarin plus VK1, but not in vkorc1, present results suggest that vkorc1l1 gene expression seems to be the most accurate and effective assessment of fish VK1 status. Zebrafish calu-a and calu-b were slightly downregulated by increasing levels of VK1 in ZFB1 cells, while they were up-regulated upon cell exposure to warfarin, and showing intermediate expression levels when cells were treated with a combination of VK1 and warfarin. Those results suggest that VK cycle impairment in skeletal cells through warfarin exposure might induce ER stress due to the amount of intracellular calcium in ER lumen, since non-functional VKDPs are being produced to perform Ca2? homeostasis, and in agreement with the overexpression of calumenin-enhancing cell survival during ER stress (Lee et al. 2013). It has been shown that Ca2? regulates the interactions of chaperones with their substrate proteins or with other chaperones (Lee et al. 2013), e.g. at low luminal Ca2? concentrations calreticulin and protein disulfide isomerase (Pdi) interaction is promoted, and the activity of Pdi is reduced (Corbett et al. 1999). Interestingly, Pdi protein in the ER provides electrons for reduction of the thioredoxin-like CXXC center in Vkor proteins (Wajih et al. 2007). Therefore, control of Ca2? concentrations by ER-residing chaperones (high-capacity and

757

low-affinity Ca2?-binding proteins), might have a key role in VKDP c-carboxylation and VK homeostasis.

Conclusions In conclusion, the present work described the protein sequence of two zebrafish Vkor enzymes, its degree of conservation through evolution and reported a zebrafish Vkorc1 variant Arg-58-Lys. In addition, a differential gene expression along larval development and in adult tissues of these Vkor enzymes gave new insights on potential diverse biological roles (homeostasis of CNS and reproduction, for instance) and requirements of VK. Further, our study evidenced a differential expression of several VK cycle actors during in vitro mineralization of ZFB1 extracellular matrix and upon cell exposure to VK and warfarin. Since pxr was differentially expressed under exposure to VK and warfarin, we demonstrated that Pxr may be a new target of warfarin in bone development. Finally, we evidenced that VK-related genes are differentially expressed in fish skeletal cells at specific cell stages (differentiation/mineralization). Thus, ZFB1 cells appear to be a suitable in vitro model to get new insights into VK/warfarin effects on bone development and metabolism and to study their underlying molecular regulatory pathways, as we recently did with other fish bone-derived cells to get insights on vitamin A bonerelated pathways (Ferna´ndez et al. 2014b). Finally, vkor gene expression seems to be an accurate assessment of VK status and thus a reliable biomarker of VK nutritional status in fish. Acknowledgments IF and PV acknowledge financial support through post-doctoral Grants SFRH/BDP/82049/2011 and SFRH/BPD/39189/2007 from the Portuguese Foundation for Science and Technology (FCT). This work was partly funded by FCT through PDTC/MAR/105152/2008 (SPECIAL_K) and PTDC/MAR/105313/2008 (FISHCELL) projects and by the European Commission (ERDF-COMPETE) through PEst-C/ MAR/LA0015/2011 project.

References Altschul SF, Madden TL, Schaffer AA, Zhang JH, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI– BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402

123

758 Andersen CL, Jensen JL, Ørntoft TF (2004) Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 64:5245–5250 Atkins GJ, Welldon KJ, Wijenayaka AR, Bonewald LF, Findlay DM (2009) Vitamin K promotes mineralization, osteoblastto-osteocyte transition, and an anticatabolic phenotype by c-carboxylation-dependent and -independent mechanisms. Am J Physiol Cell Physiol 297:C1358–C1367 Azuma K, Casey SC, Ito M, Urano T, Horie K, Ouchi Y, Kirchner S, Blumberg B, Inoue S (2010) Pregnane X receptor knockout mice display osteopenia with reduced bone formation and enhanced bone resorption. J Endocrinol 207:257–263 Bainy ACD, Kubota A, Goldstone JV, Lille-Langøy R, Karchner SI, Celander MC, Hahn ME, Goksøyr A, Stegeman JJ (2013) Functional characterization of a full length pregnane X receptor, expression in vivo, and identification of PXR alleles, in zebrafish (Danio rerio). Aquat Toxicol 142–143:447–457 Bertrand S, Thisse B, Tavares R, Sachs L, Chaumot A, Bardet PL, Escriva` H, Duffraisse M, Marchand O, Safi R, Thisse C, Laudet V (2007) Unexpected novel relational links uncovered by extensive developmental profiling of nuclear receptor expression. PLoS Genet 3:e188 Boglione C, Gavaia P, Koumoundouros G, Gisbert E, Moren M, Fontagne´ S, Witten PE (2013a) A review on skeletal anomalies in reared European larvae and juveniles. Part 1: normal and anomalous skeletogenic processes. Rev Aquac 5:S99–S120 Boglione C, Gisbert E, Gavaia P, Witten PE, Moren M, Fontagne´ S, Koumoundouros G (2013b) A review on skeletal anomalies in reared European larvae and juveniles. Part 2: main typologies, occurrences and causative factors. Rev Aquac 5:S121–S167 Bresolin T, de Freitas Rebelo M, Bainy ACD (2005) Expression of PXR, CYP3A and MDR1 genes in liver of zebrafish. Comp Biochem Phys Part C 140:403–407 Chen Y, Ferguson SS, Negishi M, Goldstein JA (2004) Induction of human CYP2C9 by rifampicin, hyperforin, and phenobarbital is mediated by the pregnane X receptor. J Pharmacol Exp Ther 308:495–501 Chen Y, Tang Y, Guo C, Wang J, Boral D, Nie D (2012) Nuclear receptors in the multidrug resistance through the regulation of drug-metabolizing enzymes and drug transporters. Biochem Pharmacol 83:1112–1126 Corbett EF, Oikawa K, Francois P, Tessier DC, Kay C, Bergeron JJM, Thomas DY, Krause KH, Michalak M (1999) Ca2? regulation of interactions between endoplasmic reticulum chaperones. J Biol Chem 274:6203–6211 Czogalla KJ, Biswas A, Wendeln A-C, Westhofen P, Mu¨ller CR, Watzka M, Oldenburg J (2015) Human VKORC1 mutations cause variable degrees of 4-hydroxycoumarin resistance and affect putative warfarin binding interfaces. Blood 122:2743–2750 Di Tommaso P, Moretti S, Xenarios I, Orobitg M, Montanyola A, Chang JM, Taly JF, Notredame C (2011) T-Coffee: a web server for the multiple sequence alignment of protein and RNA sequences using structural information and homology extension. Nucleic Acids Res 39:W13–W17

123

Fish Physiol Biochem (2015) 41:745–759 Ekins S, Reschly EJ, Hagey LR, Krasowski MD (2008) Evolution of pharmacologic specificity in the pregnane X receptor. BMC Evol Biol 8:103 Ferland G (2012) Vitamin K and the nervous system: an overview of its actions. Adv Nutr 3:204–212 Ferna´ndez I, Santos A, Cancela ML, Laize´ V, Gavaia PJ (2014a) PXR gene expression patterns and warfarin side effects in zebrafish: long-term warfarin exposure affects larval development and expression of PXR, vitamin K cycle- and vitamin K dependent protein genes. Environ Pollut 194:86–95 Ferna´ndez I, Tiago DM, Laize´ V, Cancela LM, Gisbert E (2014b) Retinoic acid differentially affects in vitro proliferation, differentiation and mineralization of two fish bone-derived cell lines: different gene expression of nuclear receptors and ECM proteins. J Steroid Biochem Mol Biol 140:34–43 Force A, Lynch M, Pickett FB, Amores A, Yan YL, Postlethwait J (1999) Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151:1531–1545 Goldstein JA, de Morais SM (1994) Biochemistry and molecular biology of the human CYP2C subfamily. Pharmacogenetics 4:285–299 Goodstadt L, Posting CP (2004) Vitamin K epoxide reductase: homology, active site and catalytic mechanism. Trends Biochem Sci 29:289–292 Hammed A, Matagrin B, Spohn G, Prouillac C, Benoit E, Lattard V (2013) VKORC1L1, an enzyme rescuing the VKOR activity in some extrahepatic tissues during anticoagulation therapy. J Biol Chem 288:28733–28742 Hanumanthaiah R, Thankavel B, Day K, Gregory M, Jagadeeswaran P (2001) Developmental expression of vitamin K-dependent c-carboxylase activity in zebrafish embryos: effect of warfarin. Blood Cell Mol Dis 27:992–999 Ichikawa T, Horie-Inoue K, Ikeda K, Blumberg B, Inoue S (2006) Steroid and xenobiotic receptor SXR mediates vitamin K2-activated transcription of extracellular matrixrelated genes and collagen accumulation in osteoblastic cells. J Biol Chem 281:16927–16934 Jeong HM, Cho DH, Jin YH, Chung JO, Chung MN, Chung DJ, Lee KY (2011) Inhibition of osteoblastic differentiation by warfarin and 18-a-glycyrrhetinic acid. Arch Pharm Res 34:1381–1387 Krossøy C, Waagbø R, Fjelldal PG, Wargelius A, Lock EJ, Graff IE, Ørnsrund R (2009) Dietary menadione nicotinamide bisulphite (vitamin K3) does not affect growth or bone health in first-feeding fry of Atlantic salmon (Salmo salar L.). Aquac Nutr 15:638–649 Krossøy C, Lock EJ, Ørnsrud R (2010) Vitamin K-dependent cglutamylcarboxylase in Atlantic salmon (Salmon salar L.). Fish Physiol Biochem 36:627–635 Krossøy C, Waagbø R, Ørnsrund R (2011) Vitamin K in fish nutrition. Aquac Nutr 17:585–594 Kulman JD, Harris JF, Nakazawa N, Ogasawara M, Satake M, Davie EW (2006) Vitamin K-dependent proteins in Ciona intestinalis, a basal chordate lacking a blood coagulation cascade. Proc Natl Acad Sci USA 103:15794–15799 Laize´ V, Gavaia PJ, Cancela ML (2015) Fish: a suitable system to model human bone disorders and discover drugs with osteogenic or osteotoxic activities. Drug Discov Today Dis Models (in press). doi:10.1016/j.ddmod.2014.08.001 Lee JH, Kwon EJ, Kim DH (2013) Calumenin has a role in the alleviation of ER stress in neonatal rat cardiomyocytes. Biochem Biophys Res Commun 439:327–332

Fish Physiol Biochem (2015) 41:745–759 Menger H, Lin AE, Toriello HV, Bernert G, Spranger JW (1997) Vitamin K deficiency embryopathy: A phenocopy of the warfarin embryopathy due to a disorder of embryonic vitamin K metabolism. Am J Med Genet 72:129–134 Mu¨ller E, Keller A, Fregin A, Mu¨ller CR, Rost S (2014) Confirmation of warfarin resistance of naturally occurring VKORC1 variants by coexpression with coagulation factor IX and in silico protein modelling. BMC Genet 15:17 Oldenburg J, Marivona M, Mu¨ller-Reible C, Waltzka M (2008) The vitamin K cycle. Vitam Horm 78:35–62 Pelz H-J, Rost S, Hu¨nerberg M, Fregin A, Heiberg A-C, Baert K, MacNicoll AD, Prescott CV, Walker A-S, Oldenburg J, Mu¨ller CR (2005) The genetic basis of resistance to anticoagulants in rodents. Genetics 170:1839–1847 Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP (2004) Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeperExcel-based tool using pairwise correlations. Biotechnol Lett 26:509–515 Potischman N, Freudenheim JL (2003) Biomarkers of nutritional exposure and nutritional status: an overview. J Nutr 133:873S–874S Rafael MS, Marques CL, Parameswaran V, Cancela ML, Laize´ V (2010) Fish bone-derived cell lines: and alternative in vitro cell system to study bone biology. J Appl Ichthyol 26:230–234 Richard N, Ferna´ndez I, Wulff T, Hamre K, Cancela LM, Conceic¸a˜o LEC, Gavaia PJ (2014) Dietary supplementation with vitamin K affects transcriptome and proteome of Senegalese sole, improving larval performance and quality. Mar Biotechnol 16:522–537 Rishavy MA, Usubalieva A, Hallgren KW, Berkner KL (2011) Novel insight into the mechanism of the vitamin K oxidoreductase (VKOR). J Biol Chem 286:7267–7278 Rishavy MA, Hallgren KW, Wilson LA, Usubalieva A, Runge KW, Berkner KL (2013) The vitamin K oxidoreductase is a multimer that efficiently reduces vitamin K epoxide to hydroquinone to allow vitamin K-dependent protein carboxylation. J Biol Chem 288:31556–31566 Rost S, Fregin A, Ivaskevicius V, Conzelmann E, Hortnagel K, Pelz HJ, Lappegard K, Seifried E, Scharrer I, Tuddenham EG, Muller CR, Strom TM, Oldenburg J (2004) Mutations in VKORC1 cause warfarin resistance and multiple coagulation factor deficiency type 2. Nature 427:537–541 Rost S, Fregin A, Hu¨nerberg M, Bevans CG, Mu¨ller CR, Oldenburg J (2005) Site-directed mutagenesis of coumarin-type anticoagulant-sensitive VKORC1: evidence that highly conserved amino acids define structural requirements for enzymatic activity and inhibition by warfarin. J Throm Haemost 94:780–786 Rost S, Pelz H-J, Menzel S, MacNicoll AD, Leo´n V, Song K-J, Ja¨kel T, Oldenburg J, Mu¨ller CR (2009) Novel mutations in the VKORC1 gene of wild rats and mice—a response to 50 years of selection pressure by warfarin? BMC Genet 10:4 Sahoo SK, Kim DH (2010) Characterization of calumenin in mouse heart. BMB Rep 43:158–163 Sahoo SK, Kim T, Kang GB, Lee JG, Eom SH, Kim DH (2009) Characterization of calumenin-SERCA2 interaction in mouse cardiac sarcoplasmic reticulum. J Biol Chem 284:31109–31121

759 Schulman S, Wang B, Li W, Rapoport TA (2010) Vitamin K epoxide reductase prefers ER membrane-anchored thioredoxin-like redox partners. Proc Natl Acad Sci USA 107:15027–15032 Shearer MJ (2009) Vitamin K in parental nutrition. Gastroenterology 137:S105–S118 Spohn G, Kleinridders A, Wunderlich FT, Watzka M, Zaucke F, Blumbach K, Geisen C, Seifried E, Mu¨ller C, Paulsson M, Bru¨ning JC, Oldenburg J (2009) VKORC1 deficiency in mice causes early postnatal lethality due to severe bleeding. Thromb Haemost 101:1044–1050 Stafford DW (2005) The vitamin K cycle. J Thromb Haemost 3:1873–1878 Tabb MM, Sun A, Zhou C, Gru¨n F, Errandi J, Romero K, Pham H, Inoue S, Mallick S, Lin M, Forman BM, Blumberg B (2003) Vitamin K2 regulation of bone homeostasis is mediated by the steroid and xenobiotic receptor SXR. J Biol Chem 278:43919–43927 Tie J-K, Jin D-Y, Stafford DW (2012) Human vitamin K epoxide reductase and its bacterial homologue have different membrane topologies and reaction mechanisms. J Biol Chem 287:33945–33955 Tie J-K, Jin D-Y, Stafford DW (2014) Conserved loop cysteines of vitamin K epoxide reductase complex subunit 1-like 1 (VKORC1L1) are involved in its active site regeneration. J Biol Chem 289:9396–9407 Udagawa M (2004) The effect of parental vitamin K deficiency on bone structure in mummichog Fundulus heteroclitus. J World Aquac Soc 35:366–371 Vijayakumar P, Laize´ V, Cardeira J, Trindade M, Cancela ML (2013) Development of an in vitro cell system from zebrafish suitable to study bone cell differentiation and extracellular matrix mineralization. Zebrafish 10:500–509 Wajih N, Sane DC, Hutson SM, Wallin R (2004) The inhibitory effect of calumenin on the vitamin K-dependent c-carboxylation system. J Biol Chem 279:25276–25283 Wajih N, Hutson SM, Wallin R (2007) Disulfide-dependent protein folding is linked to operation of the vitamin K cycle in the endoplasmic reticulum. J Biol Chem 282:2626–2635 Wallin R, Sane DC, Hutson SM (2002) Vitamin K 2,3-epoxide reductase and the vitamin K-dependent g-carboxylation system. Thromb Res 108:221–226 Watzka M, Geisen C, Bevans C, Sittinger GK, Spohn G, Rost S, Seifried EC, Mu¨ller R, Oldenburg J (2010) Thirteen novel VKORC1 mutations associated with oral anticoagulant resistance: insights into improved patient diagnosis and treatment. J Thromb Haemos 9:109–118 Weigt S, Huebler N, Strecker R, Braunbeck T, Broschard TH (2012) Developmental effects of coumarin and the anticoagulant coumarin derivative warfarin on zebrafish (Danio rerio) embryos. Reprod Toxicol 33:133–141 Westhofen P, Watzka M, Marinova M (2011) Human vitamin K 2,3-epoxide reductase complex subunit 1-like 1 (VKORC1L1) mediates vitamin K-dependent intracellular antioxidant function. J Biol Chem 286:15085–15094 Zhu A, Sun H, Raymond RM, Furie BC, Furie B, Bronstein M, Kaufman RJ, Westrick R, Ginsburg D (2007) Fatal hemorrhage in mice lacking c-glutamyl carboxylase. Blood 109:5270–5275

123