Accepted Manuscript Schisandrin B suppresses NLRP3 inflammasome activation to alleviate myocardial ischemia reperfusion injury via maintaining mitochondrial autophagy Peiyong Zhang, Xiaochen Liu, Guotao Huang, Caiyan Bai, Zhenling Zhang, Hongjun Li PII:
S0006-291X(17)31638-8
DOI:
10.1016/j.bbrc.2017.08.079
Reference:
YBBRC 38354
To appear in:
Biochemical and Biophysical Research Communications
Received Date: 10 August 2017 Revised Date:
0006-291X June 0006-291X
Accepted Date: 21 August 2017
Please cite this article as: P. Zhang, X. Liu, G. Huang, C. Bai, Z. Zhang, H. Li, Schisandrin B suppresses NLRP3 inflammasome activation to alleviate myocardial ischemia reperfusion injury via maintaining mitochondrial autophagy, Biochemical and Biophysical Research Communications (2017), doi: 10.1016/ j.bbrc.2017.08.079. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT Schisandrin B suppresses NLRP3 inflammasome activation to alleviate myocardial ischemia reperfusion injury via maintaining mitochondrial autophagy Peiyong Zhang1, Xiaochen Liu1, Guotao Huang1, Caiyan Bai1, Zhenling Zhang1, Hongjun Li1#
1 Department of Cardiology, The First Affiliated Hospital of Xinxiang Medical University,
RI PT
Xinxiang 453100, China #Corresponding author: Hongjun Li. No. 88 Health Street, 453100, Xinxiang, Henan, PR China E-mail: [email protected]
SC
Tel: 0373-4402425
Key words: Schisandrin B, NLRP3 inflammasome, MI/R injury, mitophagy
M AN U
Abbreviations: MI/R, Myocardial ischemia reperfusion; Sch B, Schisandrin B; Mitophagy, mitochondrial autophagy; qRT-PCR, Quantitative real-time PCR; Elisa, Enzyme linked
AC C
EP
TE D
immunosorbent assay
ACCEPTED MANUSCRIPT Abstract Myocardial ischemia reperfusion (MI/R) injury is reported to induce apoptosis of myocardial cells and contribute to adverse cardiovascular outcomes. Accumulating evidence suggests that
Schisandrin B (Sch B) has cardioprotective effect on MI/R injury, however, the mechanism is
RI PT
still unclear. The aim of this present study was to investigate the potential mechanism of Sch B on MI/R treatment. Mice models of MI/R injury were established by coronary artery ligation method. In our study, Sch B treatment decreased the high myocardial damage indicators (serum CK, LDH level and the myocardial infarct area) and counteracted the
SC
irregular pathological changes induced by MI/R injury in myocardial tissues. In addition, the high expression of inflammasome related proteins (NLRP3, ASC, Caspase-1) and pro-inflammatory
M AN U
cytokines (IL-1β, IL-18) induced by MI/R injury were down-regulated by Sch B treatment,
indicating that Sch B suppressed the activation of NLRP3 inflammasome to alleviate MI/R injury. We also found that Sch B treatment maintained mitophagy by increasing the expression of mitophagy related proteins (COX I, COX IV, HIF-1α and Beclin1). Moreover, Sch B treatment activated AMPK/mTOR/ULK1 pathway by increasing the low expression of AMPK and ULK1
TE D
and decreasing the high expression of mTOR induced by MI/R injury. Besides that, AMPK-β1
knockout mice reduced its ability to maintain mitophagy, thus resulted in the activation of inflammasome. Taken together, our results demonstrated that Sch B treatment suppressed NLRP3
EP
inflammasome activation via maintaining mitophagy mediated by AMPK/mTOR/ULK1 pathway to alleviate MI/R injury. Our results represented a potential novel therapeutic approach for
AC C
treatment of MI/R injury.
ACCEPTED MANUSCRIPT Introduction
Heart disease is one of the most common diseases which cause high mortality in many countries, and myocardial infarction contributes the most morbidity and mortality among them[1].Treatment with myocardial infarction is mainly through opening the infarct-related
RI PT
coronary artery and leading to the reperfusion of coronary artery. However, this treatment may cause myocardial ischemia reperfusion (MI/R) injury, which increases heart dysfunction and structural damage instead of restoring normal heart function. MI/R was firstly described to accelerate the development of necrosis by Jennings et al at 1960[2]. This observation has
SC
caused attention of researchers in the mechanism of MI/R for decades. Autophagy is a mechanism of cellular degradation through lysosomes and mitochondria autophagy
M AN U
(mitophagy) is one of the subtypes of autophagy, which is found to play a crucial role in MI/R injury[3]. Mitophagy forms autophagosomes to deliver cargo into vacuoles, and the dysfunction of mitophagy contributes to some kinds of diseases including MI/R injury[4,5]. Mitophagy is regulated by multiple signaling pathways including AMPK/mTOR/ULK1 pathway. It is reported that HIF-1α-induced mitophagy was accompanied by the inhibition of
TE D
the mTOR pathway[6]. Therefore, MI/R injury may be mediated by mitophagy. Moreover, besides mitophagy, NLRP3 inflammasomes have also been found to activate and mediate in the MI/R injury progression[7]. Increasing evidence indicated that inflammasomes
EP
played an important role in sterile inflammation[8]. Caspase-1 in inflammasome was reported to promote generation of IL-1β, which was highly expressed in MI/R injury[9,10]. These
AC C
results support the importance of inflammasomes in the pathophysiology of MI/R injury. Moreover, evidence from previous studies suggested that elimination of damaged mitochondria by autophagy was important to prevent excessive NLRP3 inflammasome activation[11].However, the studies which elucidated the relationship between mitophagy and inflammasomes in MI/R injury were few. Thus, we focused on the functions of mitophagy and NLRP3 inflammasomes on MI/R injury in this study. Schisandrin B(Sch B), extracted from Schisandrachinensis, is commonly used for hepatitis treatment in China[12]. Previous studies had elucidated that Sch B exerted various effects including antiinflammatory, antioxidant and anticancereffects[13,14]. Nowadays, SchB is reported to have beneficial effect on ischemic diseases including cerebral ischemia and MI/R
ACCEPTED MANUSCRIPT injury[15,16]. The mechanism of cardioprotective effects of SchBhad been considered as the alleviation of oxidative stress[17,18]. However, whether Sch B can alleviate MI/R injury through mitophagy mediated pathway still remains unclear and needs further studies. Hence in our study, mice models of MI/R injury were constructed to investigate the effect
RI PT
of Sch B treatment on MI/R injury and the related functionary mechanism. Our results indicated that Sch B treatment suppressed inflammasome activation via maintaining mitophagy mediated by AMPK/mTOR/ULK1 pathway. This study may shed light on
AC C
EP
TE D
M AN U
SC
therapeutic strategy for MI/R injury.
ACCEPTED MANUSCRIPT Material and methods Construction of animal model and grouping C57BL/6J mice (aged 6-8 weeks) were purchased from Experimental Animal Center of The First Affiliated Hospital of Xinxiang Medical University. All animal experiments complied
RI PT
with the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978). All animal studies were approved by Medical Ethics Committee of The First Affiliated Hospital of Xinxiang Medical University.
Coronary artery ligation method was used to establish MI/R injury model. Mice received
SC
endotracheal intubation and artificial ventilation after anesthetizing with sodium pentobarbital intraperitoneal injection (30mg/kg).Thread was passed through the left coronary artery after
M AN U
exposure of heart. Another two threads were drawn from the knot to loosen the ligation. Left coronary artery was ligated to produce ischemia, and electrocardiogram showed ST-segment elevation and local myocardium appeared cyanosis after ligation. Then after 1h of ischemia, the ligation was loosen to restore blood flow, leading to reperfusion which lasted 1 h in this study. Mice were randomly divided into 4 groups as follows: (1) Sham group which operated
TE D
with no ischemia was given 5% Tween 20. (2) Sham + Sch B group was given Sch B at 80 mg/kg/day. (3) MI/R model group which operated with ischemia and reperfusion was given 5% Tween 20. (4) MI/R model + Sch B group was given Sch B at 80 mg/kg/day. ScB was
EP
dissolved in 5% Tween 20 and given daily by oral gavage for a month before the surgery. The generation and characterization of the AMPK-β1−/− and wild-type (WT) control mice
AC C
has been previously described[19,20]. Mice were randomly divided into 4 groups as follows:(1) WT Sham group: WT mice received sham operation and were given 5% Tween 20. (2) AMPK-β1−/−Sham group: AMPK-β1−/− mice received sham operation and were given 5% Tween 20. (3) AMPK-β1−/−MI/R model group: AMPK-β1−/− mice received MI/R operation and were given 5% Tween 20. (4) AMPK-β1−/−MI/R model + Sch B group: AMPK-β1−/− mice received MI/R operation and were given Sch B at 80 mg/kg/day.
Myocardial damage indicators detection Serum creatine kinase (CK) and lactic dehydrogenase (LDH) contents were tested by colorimetry assay on JH-752 ultraviolet and visible spectrophotometer. Heart rates (HR) were
ACCEPTED MANUSCRIPT recorded by electrocardiogram. The myocardial infarct area was measured by Evans blue and tetrazoliumchloride (TTC) staining (Shanghai Chemical Reagent Co., China) as described previously[21].
RI PT
Hematoxylin and eosin (HE) staining After reperfusion, the myocardial samples of each rat were fixed in a 4% buffered paraformaldehyde solution for 24 h. Then, tissues were dehydrated, embedded in paraffin and cut into 4µm-thick sections for HE staining according to immunohistochemical
SC
examination described in previous study and then examined under light microscopy (Olympus,
M AN U
Japan)[22].
Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was extracted from Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions and quantified by D260 nm/D280 nm. Reverse transcription was carried out using MMLV Platinum RT-qPCR kit (Life Technologies). Real-time qPCR was
TE D
performed using the One Step SYBR PrimeScript PLUS RT-RNA PCR Kit (TaKaRa Biotechnology, Dalian, China). The primers used were as follows: COX I: Forward: CACATGAGCAAAAGCCCACT, Reverse: ACGGCCGTAAGTGAGATGAA; COX IV: GACTACCCCTTGCCTGATGT,
Reverse:
ACACGTAGCTCTTCTCCCAG.
EP
Forward:
Results were normalized to GAPDH mRNA and the relative level was calculated by relative
AC C
quantification (2−∆∆Ct) method.
Western-blot
Proteins were extracted using RIPA lysis buffer (Beyotime Institute of Biotechnology, Shanghai, China) and the concentration was measured using the Bio-Rad protein assay kit (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) according to the manufacturer's instructions. A total of 40 µg protein was separated by 10% SDS-PAGE and then transferred onto polyvinylidene difluoride membranes. The membranes were incubated with primary antibodies (Cell Signaling, SanJose, CA, USA) at 4℃ overnight after blocking at room temperature for 1 h. After a secondary antibody (Cell Signaling, SanJose, CA, USA)
ACCEPTED MANUSCRIPT was added for incubation of 1 h, the members were detected using a ChemiDoc XRS imaging system.
Enzyme linked immunosorbent assay (Elisa)
RI PT
Elisa measurement for IL-1βand IL-18 (Bio-Swamp, Shanghai, China) was conducted on myocardial tissue lysates. Samples were homogenized in PBS and stored overnight at -20℃.
The homogenates were centrifuged at 5000 g for 10 minutes after two freeze-thaw cycles to break the cell membranes. Then samples were assayed immediately following the
SC
manufacturer’s instructions.
M AN U
Statistical analysis
All results were presented as mean ± SD. The statistical significance of the studies was analyzed through Student’s t test. The difference was considered statistically significant at P
S0006-291X(17)31638-8
DOI:
10.1016/j.bbrc.2017.08.079
Reference:
YBBRC 38354
To appear in:
Biochemical and Biophysical Research Communications
Received Date: 10 August 2017 Revised Date:
0006-291X June 0006-291X
Accepted Date: 21 August 2017
Please cite this article as: P. Zhang, X. Liu, G. Huang, C. Bai, Z. Zhang, H. Li, Schisandrin B suppresses NLRP3 inflammasome activation to alleviate myocardial ischemia reperfusion injury via maintaining mitochondrial autophagy, Biochemical and Biophysical Research Communications (2017), doi: 10.1016/ j.bbrc.2017.08.079. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT Schisandrin B suppresses NLRP3 inflammasome activation to alleviate myocardial ischemia reperfusion injury via maintaining mitochondrial autophagy Peiyong Zhang1, Xiaochen Liu1, Guotao Huang1, Caiyan Bai1, Zhenling Zhang1, Hongjun Li1#
1 Department of Cardiology, The First Affiliated Hospital of Xinxiang Medical University,
RI PT
Xinxiang 453100, China #Corresponding author: Hongjun Li. No. 88 Health Street, 453100, Xinxiang, Henan, PR China E-mail: [email protected]
SC
Tel: 0373-4402425
Key words: Schisandrin B, NLRP3 inflammasome, MI/R injury, mitophagy
M AN U
Abbreviations: MI/R, Myocardial ischemia reperfusion; Sch B, Schisandrin B; Mitophagy, mitochondrial autophagy; qRT-PCR, Quantitative real-time PCR; Elisa, Enzyme linked
AC C
EP
TE D
immunosorbent assay
ACCEPTED MANUSCRIPT Abstract Myocardial ischemia reperfusion (MI/R) injury is reported to induce apoptosis of myocardial cells and contribute to adverse cardiovascular outcomes. Accumulating evidence suggests that
Schisandrin B (Sch B) has cardioprotective effect on MI/R injury, however, the mechanism is
RI PT
still unclear. The aim of this present study was to investigate the potential mechanism of Sch B on MI/R treatment. Mice models of MI/R injury were established by coronary artery ligation method. In our study, Sch B treatment decreased the high myocardial damage indicators (serum CK, LDH level and the myocardial infarct area) and counteracted the
SC
irregular pathological changes induced by MI/R injury in myocardial tissues. In addition, the high expression of inflammasome related proteins (NLRP3, ASC, Caspase-1) and pro-inflammatory
M AN U
cytokines (IL-1β, IL-18) induced by MI/R injury were down-regulated by Sch B treatment,
indicating that Sch B suppressed the activation of NLRP3 inflammasome to alleviate MI/R injury. We also found that Sch B treatment maintained mitophagy by increasing the expression of mitophagy related proteins (COX I, COX IV, HIF-1α and Beclin1). Moreover, Sch B treatment activated AMPK/mTOR/ULK1 pathway by increasing the low expression of AMPK and ULK1
TE D
and decreasing the high expression of mTOR induced by MI/R injury. Besides that, AMPK-β1
knockout mice reduced its ability to maintain mitophagy, thus resulted in the activation of inflammasome. Taken together, our results demonstrated that Sch B treatment suppressed NLRP3
EP
inflammasome activation via maintaining mitophagy mediated by AMPK/mTOR/ULK1 pathway to alleviate MI/R injury. Our results represented a potential novel therapeutic approach for
AC C
treatment of MI/R injury.
ACCEPTED MANUSCRIPT Introduction
Heart disease is one of the most common diseases which cause high mortality in many countries, and myocardial infarction contributes the most morbidity and mortality among them[1].Treatment with myocardial infarction is mainly through opening the infarct-related
RI PT
coronary artery and leading to the reperfusion of coronary artery. However, this treatment may cause myocardial ischemia reperfusion (MI/R) injury, which increases heart dysfunction and structural damage instead of restoring normal heart function. MI/R was firstly described to accelerate the development of necrosis by Jennings et al at 1960[2]. This observation has
SC
caused attention of researchers in the mechanism of MI/R for decades. Autophagy is a mechanism of cellular degradation through lysosomes and mitochondria autophagy
M AN U
(mitophagy) is one of the subtypes of autophagy, which is found to play a crucial role in MI/R injury[3]. Mitophagy forms autophagosomes to deliver cargo into vacuoles, and the dysfunction of mitophagy contributes to some kinds of diseases including MI/R injury[4,5]. Mitophagy is regulated by multiple signaling pathways including AMPK/mTOR/ULK1 pathway. It is reported that HIF-1α-induced mitophagy was accompanied by the inhibition of
TE D
the mTOR pathway[6]. Therefore, MI/R injury may be mediated by mitophagy. Moreover, besides mitophagy, NLRP3 inflammasomes have also been found to activate and mediate in the MI/R injury progression[7]. Increasing evidence indicated that inflammasomes
EP
played an important role in sterile inflammation[8]. Caspase-1 in inflammasome was reported to promote generation of IL-1β, which was highly expressed in MI/R injury[9,10]. These
AC C
results support the importance of inflammasomes in the pathophysiology of MI/R injury. Moreover, evidence from previous studies suggested that elimination of damaged mitochondria by autophagy was important to prevent excessive NLRP3 inflammasome activation[11].However, the studies which elucidated the relationship between mitophagy and inflammasomes in MI/R injury were few. Thus, we focused on the functions of mitophagy and NLRP3 inflammasomes on MI/R injury in this study. Schisandrin B(Sch B), extracted from Schisandrachinensis, is commonly used for hepatitis treatment in China[12]. Previous studies had elucidated that Sch B exerted various effects including antiinflammatory, antioxidant and anticancereffects[13,14]. Nowadays, SchB is reported to have beneficial effect on ischemic diseases including cerebral ischemia and MI/R
ACCEPTED MANUSCRIPT injury[15,16]. The mechanism of cardioprotective effects of SchBhad been considered as the alleviation of oxidative stress[17,18]. However, whether Sch B can alleviate MI/R injury through mitophagy mediated pathway still remains unclear and needs further studies. Hence in our study, mice models of MI/R injury were constructed to investigate the effect
RI PT
of Sch B treatment on MI/R injury and the related functionary mechanism. Our results indicated that Sch B treatment suppressed inflammasome activation via maintaining mitophagy mediated by AMPK/mTOR/ULK1 pathway. This study may shed light on
AC C
EP
TE D
M AN U
SC
therapeutic strategy for MI/R injury.
ACCEPTED MANUSCRIPT Material and methods Construction of animal model and grouping C57BL/6J mice (aged 6-8 weeks) were purchased from Experimental Animal Center of The First Affiliated Hospital of Xinxiang Medical University. All animal experiments complied
RI PT
with the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978). All animal studies were approved by Medical Ethics Committee of The First Affiliated Hospital of Xinxiang Medical University.
Coronary artery ligation method was used to establish MI/R injury model. Mice received
SC
endotracheal intubation and artificial ventilation after anesthetizing with sodium pentobarbital intraperitoneal injection (30mg/kg).Thread was passed through the left coronary artery after
M AN U
exposure of heart. Another two threads were drawn from the knot to loosen the ligation. Left coronary artery was ligated to produce ischemia, and electrocardiogram showed ST-segment elevation and local myocardium appeared cyanosis after ligation. Then after 1h of ischemia, the ligation was loosen to restore blood flow, leading to reperfusion which lasted 1 h in this study. Mice were randomly divided into 4 groups as follows: (1) Sham group which operated
TE D
with no ischemia was given 5% Tween 20. (2) Sham + Sch B group was given Sch B at 80 mg/kg/day. (3) MI/R model group which operated with ischemia and reperfusion was given 5% Tween 20. (4) MI/R model + Sch B group was given Sch B at 80 mg/kg/day. ScB was
EP
dissolved in 5% Tween 20 and given daily by oral gavage for a month before the surgery. The generation and characterization of the AMPK-β1−/− and wild-type (WT) control mice
AC C
has been previously described[19,20]. Mice were randomly divided into 4 groups as follows:(1) WT Sham group: WT mice received sham operation and were given 5% Tween 20. (2) AMPK-β1−/−Sham group: AMPK-β1−/− mice received sham operation and were given 5% Tween 20. (3) AMPK-β1−/−MI/R model group: AMPK-β1−/− mice received MI/R operation and were given 5% Tween 20. (4) AMPK-β1−/−MI/R model + Sch B group: AMPK-β1−/− mice received MI/R operation and were given Sch B at 80 mg/kg/day.
Myocardial damage indicators detection Serum creatine kinase (CK) and lactic dehydrogenase (LDH) contents were tested by colorimetry assay on JH-752 ultraviolet and visible spectrophotometer. Heart rates (HR) were
ACCEPTED MANUSCRIPT recorded by electrocardiogram. The myocardial infarct area was measured by Evans blue and tetrazoliumchloride (TTC) staining (Shanghai Chemical Reagent Co., China) as described previously[21].
RI PT
Hematoxylin and eosin (HE) staining After reperfusion, the myocardial samples of each rat were fixed in a 4% buffered paraformaldehyde solution for 24 h. Then, tissues were dehydrated, embedded in paraffin and cut into 4µm-thick sections for HE staining according to immunohistochemical
SC
examination described in previous study and then examined under light microscopy (Olympus,
M AN U
Japan)[22].
Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was extracted from Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions and quantified by D260 nm/D280 nm. Reverse transcription was carried out using MMLV Platinum RT-qPCR kit (Life Technologies). Real-time qPCR was
TE D
performed using the One Step SYBR PrimeScript PLUS RT-RNA PCR Kit (TaKaRa Biotechnology, Dalian, China). The primers used were as follows: COX I: Forward: CACATGAGCAAAAGCCCACT, Reverse: ACGGCCGTAAGTGAGATGAA; COX IV: GACTACCCCTTGCCTGATGT,
Reverse:
ACACGTAGCTCTTCTCCCAG.
EP
Forward:
Results were normalized to GAPDH mRNA and the relative level was calculated by relative
AC C
quantification (2−∆∆Ct) method.
Western-blot
Proteins were extracted using RIPA lysis buffer (Beyotime Institute of Biotechnology, Shanghai, China) and the concentration was measured using the Bio-Rad protein assay kit (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) according to the manufacturer's instructions. A total of 40 µg protein was separated by 10% SDS-PAGE and then transferred onto polyvinylidene difluoride membranes. The membranes were incubated with primary antibodies (Cell Signaling, SanJose, CA, USA) at 4℃ overnight after blocking at room temperature for 1 h. After a secondary antibody (Cell Signaling, SanJose, CA, USA)
ACCEPTED MANUSCRIPT was added for incubation of 1 h, the members were detected using a ChemiDoc XRS imaging system.
Enzyme linked immunosorbent assay (Elisa)
RI PT
Elisa measurement for IL-1βand IL-18 (Bio-Swamp, Shanghai, China) was conducted on myocardial tissue lysates. Samples were homogenized in PBS and stored overnight at -20℃.
The homogenates were centrifuged at 5000 g for 10 minutes after two freeze-thaw cycles to break the cell membranes. Then samples were assayed immediately following the
SC
manufacturer’s instructions.
M AN U
Statistical analysis
All results were presented as mean ± SD. The statistical significance of the studies was analyzed through Student’s t test. The difference was considered statistically significant at P
