Accepted Manuscript Title: Rh genotypes among malaysian blood donors Author: Rozi Hanisa Musa, Afifah Hassan, Yasmin Ayob, Narazah Mohd Yusoff PII: DOI: Reference:

S1473-0502(14)00239-0 http://dx.doi.org/doi: 10.1016/j.transci.2014.12.001 TRASCI 1769

To appear in:

Transfusion and Apheresis Science

Received date: Accepted date:

30-8-2013 6-12-2014

Please cite this article as: Rozi Hanisa Musa, Afifah Hassan, Yasmin Ayob, Narazah Mohd Yusoff, Rh genotypes among malaysian blood donors, Transfusion and Apheresis Science (2014), http://dx.doi.org/doi: 10.1016/j.transci.2014.12.001. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Rh GENOTYPES AMONG MALAYSIAN BLOOD DONORS Rozi Hanisa Musa1, Afifah Hassan2, Yasmin Ayob2, Narazah Mohd Yusoff1 1

Advanced Medical and Dental Institute (AMDI), Universiti Sains Malaysia (USM),

Bertam, Penang, 2National Blood Center (NBC), Kuala Lumpur.

ABSTRACT BACKGROUND: Rh genotyping studies are mainly conducted in Caucasians and African population. There is limited data on information of molecular basis for Rh genotypes in Malaysia. OBJECTIVES: This study was aimed to investigate the prevalence and characteristics of RHCE genotyping among different ethnic groups in Malaysia. MATERIALS AND METHODS: A total of 1014 blood samples were obtained from blood donors from 4 different ethnic groups (360 Malays, 434 Chinese, 164 Indians and 56 others). All samples were phenotyped for C, c, D, E and e by standard serologic method and genotyped with Polymerase Chain Reaction (PCR) techniques. RESULTS: In the 1014 blood donor samples that we analyzed, the distribution of Rh genotype antigens is significantly different among the various ethnic groups. Our findings showed that genotyped CCDee is the most common in Malaysian blood donors; (18.4%) 187/1014 compared to others genotypes. The genotype ccDEE is more prevalent in the Chinese; 65.6% (82/125) and genotype ccee is more prevalent in the Indians 47.1% (65/138). In the PCR analysis, there were discrepancies between phenotyped and genotyped samples. There were 17 (1.7%) discrepancy in

1 Page 1 of 19

the RHC/c genotyping results and of these 47% (8/17) occured among the Malays. Discrepancies in the RHE/e genotyping results ocurred in three (0.3%) cases. This study also discovered that 47% (8/17) discrepancies in RHC/c genotyping were in Malays compared to other ethnic groups. CONCLUSION: Our study provide a database for the distribution of Rh genotypes of donors from the major ethnic groups in Malaysia. Methods used in this study are useful for comparing the phenotype and genotype results. Further investigation should be done to investigate causes of these discrepancies by other molecular based techniques. Key words: Rh genotypes, Malays, Chinese, Indians, Malaysia,

2 Page 2 of 19

INTRODUCTION

The Rh blood group is the most complex and polymorphic of all human blood group systems, consisting of at least 45 different antigens and it can be further subdivided into various genotypes. The Rh antigens are also the most clinical significant in transfusion medicine. The Rh antigens are located on two proteins, RhD and RhCE: the former carries the D antigen whilst the latter carries C, c, E and e antigens. The two highly homologous genes encoding these antigens are located on the short arm of chromosome 1 (1p36.13-p34.3) and are inherited together. [1]

Previously, it was only possible to determine the Rh phenotype by serologic typing of red blood cells. This serologic approach can be inconclusive e.g. in Rh phenotyping of fetuses, in patients who have recently been transfused and those harbouring large quantity of donor red blood cells. In all these cases, Rh genotyping is an option. Serologic detection of polymorphic blood group antigens and phenotypes provide valuable sources of appropriate blood samples for molecular studies. Wide racial differences are recognized not only in frequency of Rh phenotypes but also at the molecular level. Several RHD, RHC/c and RHE/e genotyping assays have been developed. A number of studies have been carried out to assess the frequency of these three molecular backgrounds in Africans and Caucasians. [2]

3 Page 3 of 19

Previously, Hyland et al applied restriction fragment length polymorphism (RFLP) patterns on Southern blots for Rh genotypes. However, they found a 100% correlation for 102 randomly selected blood donors for the Rh C, Rh e and Rh D phenotypes, but only 94.8% for the Rh c and 94.3% for the Rh E phenotypes.

[3]

However, the sequence of RH genes may vary with different ethnic group. It is important to be aware of the differences in genetic sequences in order to develop genotyping methods that are reliable in a multiracial population.

Malaysia has a multiracial population comprising of Malays, Chinese, Indians who are the major races in Peninsular Malaysia with other ethnic groups especially in East Malaysia in the north of Borneo island. In an effort to gain more insight into the molecular background and frequency of Rh genotypes, we have undertaken a comprehensive study to determine Rh genotypes distribution among the ethnic groups in the Malaysian population.

Thus, the main objective was to determine the prevalence of Rh genotypes in blood donors from the major ethnic groups in Malaysia and to correlate Rh phenotypes with genotypes results for the Rh C/c, Rh E/e and Rh D. Published Rh genotyping assays were tested on DNA of phenotyped donors from different ethnic groups in Malaysia.

4 Page 4 of 19

MATERIALS AND METHODS

Samples This study was approved by the Research and Ethics Committee (Human), Universiti Sains Malaysia (USM) and Medical Research and Ethics Committee Ministry of Health (MOH), Malaysia. A total of 1014 EDTA blood samples was obtained from randomly selected voluntary donors who donated at National Blood Center (NBC) or its mobile blood donation sessions between May 2011 and February 2012 who fulfilled the inclusion criteria. Informed consent was obtained from the eligible donors. There were 360 Malays, 434 Chinese, 164 Indians and 56 from other minority ethnic groups.

Serology Red Blood Cell (RBCs) of all donor’s samples were phenotyped for C, c, D, E and e by standard serologic methods using the automated machine Olympus PK7200 in accordance with validated protocols and manufacturer’s instructions. The commercial monoclonal antibody reagents used were from CSL (Australia), Millipore (United Kingdom) and Bio-Rad (Switzerland). CSL reagents were used to test the following specificities: monoclonal Epiclone-2 anti-D (RUM 1 and MCAD6), monoclonal Epiclone Anti-c (MS33) and monoclonal anti-E (MS30 and MS258). Bio-Rad reagents were used to test the following specificities: monoclonal DiaClon anti-C (MS24) and monoclonal DiaClon anti-e (MS16, MS21 and MS63). Millipore reagent was used to test monoclonal anti-D (TH28 and MS26). 5 Page 5 of 19

Genomic DNA extraction Genomic DNA was isolated from 200 µl of whole blood using a DNA isolation kit (NucleoSpin Blood, Macherey-Nagel GmbH & Co. KG, Germany). Oligonucleotide sequences of all primers used in this study are listed in Table 1. All primer used were those published and synthesized by Sigma-Proligo (Singapore).

RHC and RHc multiplex PCR The RHC and RHc multiplex assays have been previously described and optimized and modified to suit local condition

[4]

. A total of 8 primers multiplex PCR based

method have been used for detecting the presence of RHD exon 7 and intron 4, and the RHCE C and c alleles. The list of the primers are shown in Table 1. Amplification was carried out in a final volume of 25 µl, containing 5 µl of template DNA, 4.0µl (1.25mM) dNTP mix, 2.5 µl multiprimer mix, 3.0 (50 mM) MgCl2, 2.5 µl (10X) Buffer, 0.125 (5U) Taq Polymerase (Bio-Rad, CA). Thirty two cycles of PCR were performed at 94°C for 1 minute, 64°C for 1 minute, and 72°C for 1 minute 30 seconds. PCR were performed in a thermal cycler (Veriti, Applied Biosystem, Netherlands).

RHE and Rhe allele-specific primer amplification (ASPA) assays Similarly, the RHE and RHe specific ASPA have also been previously described and been optimized and modified to suit local condition [5]. Three sets of primers were used and shown in Table 1. For RHE, a combination of primers from Set A and Set B and RHe from Set B and Set C were used. ASPA reactions were performed with 1.5 µl of template DNA, 3.2 µl primer mix and 10µl 2X Exprime Taq Premix (Genet Bio, 6 Page 6 of 19

Korea). PCR were performed in a thermal cycler (Veriti, Applied Biosystem, Netherlands). The conditions for RHE were 94°C for 30 seconds, 63°C for 30 seconds, and 72°C for 12 seconds while for RHe the conditions were 94°C for 30 seconds, 54°C for 30 seconds, and 72°C for 18 seconds. Both conditions were performed for 35 cycles.

Gel Electrophoresis PCR products were separated by size in a 2% agarose gel containing 0.1 µg per ml of SybrSafe DNA gel stain (Invintrogen, U.S.A.) was used for all electrophoresis procedures. The results were visualised using the Gel Documentation System (U:Genius, Syngene, U.S.A). Low Range DNA ladder (Jena Bioscience, Germany) was used to determine level of PCR product present.

7 Page 7 of 19

RESULTS

Serology and genotyping findings DNA from 1014 blood donors from 4 major different ethnic groups with various Rh phenotypes and genotypes were tested. Of these donors, 434 (42.8%) were Chinese, 360 (35.5%) were Malays, 164 (16.2%) were Indians and the remaining 56 (5.5%) were from minor ethnic groups, grouped together as ‘others’. It was also found that Rh genotype had significantly different distribution among the ethnic groups based on Rh genotypes. However, no significant association were noted between discrepancies results in allele C/c and E/e and the ethnic groups (p = 0.05). A total of 187 blood donors were found to be CCDee which is common in Malaysia and 827 blood donors have rare and very rare phenotypes. The results showed that ccDEE was more prevalent in Chinese (8.1%) as compared to Malays, Indian and others (3.4%, 0.5% and 0.4% respectively). The ccee was very low in all ethnic groups but was relatively high in Indian donors. The distributions of Rh genotypes among the 4 major ethnic groups in Malaysia are shown in Table 2. There were discrepancies found in serological and genotyping results as shown in Table 3.

RHC and RHc multiplex PCR analysis We performed RHC and RHc multiplex PCR analysis for all blood samples. Discrepancies were occasionally observed between phenotyping and genotyping. This is mainly because of phenotype results failed to detect the heterozygous genes. We found that 10 samples (8 Malays, 1 Chinese and I Others) phenotyped as RHCC 8 Page 8 of 19

were shown to be of genotype RhCc by multiplex PCR analysis. Seven donor samples (3 Chinese, 3 Indians and I Others) were phenotyped as RHcc but genotyped as RHCc. From the outcome of this study, RHC+ showed false positive, mainly in Malay (47%) which were 8 out from 10 donors. From this study, it showed no significant association was noted between discrepancies results in allele C/c with the ethnic groups.

RHE and Rhe allele-specific primer amplification assays A total of 1014 blood donor samples were performed RHE and Rhe allele-specific primer amplification assays. We found that only 2 Malay donor samples were phenotyped as Rhee but showed as RHEe by genotyped and also only 1 Indian donor sample was phenotyped as RHEe but genotyped as Rhee. Those discrepancies were observed in heterozygous genes. However, no significant association was noted between discrepancies results in E/e with the ethnic groups.

9 Page 9 of 19

DISCUSSION

While the molecular background of blood groups are well characterised in Caucasian population and the differences between Caucasians and African population are well established, there is limited data on Asian population. In Malaysia little is known of the molecular basis of the Rh and other blood group system among the various ethnic groups.

Previously, it was only possible to determine the Rh phenotype by serologic typing of red blood cells. This serologic approach can be inconclusive e.g. in Rh phenotyping of fetuses, in patients who have recently been transfused and those harboring large quantity of donor red blood cells. In all these cases, Rh genotyping is an option. Serologic detection of polymorphic blood group antigens and phenotypes provide valuable sources of appropriate blood samples for molecular studies. As Haemolytic Disease of the Fetus and Newborn (HDFN), Autoimmune Haemolytic Anemia (AIHA) and transfusion reactions are not only due to anti Rh-D antibodies but also sometimes to anti-Rh E/e or anti-RH C/c genotype in such cases.

We have previously reported that, the Rh blood group system had significantly different distribution among the ethnic groups. [6] In this study, Rh phenotypes and RH genotypes showed heterogeneity and significant association between all the ethnic groups in blood donor’s respondents (p < 0.05). We also compared the phenotypes with some of the Asia population and it showed some similarity. As an example, the 10 Page 10 of 19

cDE/cDE(R2R2) was more prevalent in the Chinese donors than in other ethnic groups, with a distribution similar to the Chinese population in Hong Kong.

[5]

We have conducted molecular analysis for Rh genotypes in 1014 blood donors from 360 Malays, 434 Chinese, 164 Indians and 56 from other minority ethnic groups in Malaysia Using PCR assays for RH C/c and RH E/e genotyping that has been described before.

[4,7]

We observed discrepancies in both RH C/c and RH E/e

on phenotypes and genotypes. The RHC and RHc alleles have been reported to differ by a single nucleotide substitution in exon 1 and five base changes in exon 2. [8]

Here, we used RHC and RHc multiplex PCR analysis for RHC/c genotyping in which the primers to detect RHC allele was from Intron 2 and RHc allele was from exon 2. We used this method to examine 1014 donor samples and found that there was a correlation between RHC/c genotype and phenotype in 997 samples, whereas there was discrepancy in 10 cases (8 Malays, 1 Chinese and 1 Others) who had CC phenotype but Cc by genotype and 7 cases (3 Chinese, 3 Indians and 1 Others) who had cc phenotype but Cc genotype. All donors were RHD positive. This was also reported by M. Tanaka et al., also showed discrepancy in 17 cases out 656 samples who among those who were phenotyped as cc but but were actually of Cc genotype. [9]

Hyland et al.

[3]

, used Msp I RFLP digestion patterns of the 3’ noncoding

regions of the genes to determine Rh E/e genotypes. For e they showed a 100% concordance between the results of phenotyping and genotyping based on RFLP 11 Page 11 of 19

patterns, but for E the concordance was only 94.3%. The discrepancies they found between the results of phenotyping and genotyping appeared to be associated with the cE allele in D-negative subjects. The cE alleles in D-negative donors whose DNA was tested were all genotyped as ce. In this study, we used RHE and Rhe allelespecific primer amplification assays to determine the RH E/e genotype. We performed this method to the same 1014 blood donors as Rh C/c genotype. The results showed that there was a correlation between RHE/e genotype and phenotype in 1011 samples, whereas there was discrepancy in 2 cases from Malay donors who had ee phenotype but Ee by genotype and 1case from Indian donors who had Ee by phenotype and ee by genotype. All cases were from RhD positive donors.

From both study of RH C/c and RH E/e genotyping, it showed that the discrepancy only occur in RHD positive donors and samples with heterozygous alleles that by phenotype method cannot be detected. This is may be due to the transmission of silent alleles at the Rh locus.

[5]

Beside this, the different methods

used in various laboratories, the different monoclonal antibodies in FDA-licensed reagents that can react differently in our populations. The large number of different RHD and RHCE genes, which can affect both the level of expression and, potentially, the structure of the molecule and D-epitopes.

In conclusion, we performed PCR-based method to determine the RH C/c and RH E/e genotype in Malaysian population which provided the basic database for the distribution of Rh genotypes of donors from major ethnic groups in Malaysia. It also demonstrated that there may be discrepency of Rh phenotyping and genotyping that can occur. The method used has been shown to be useful to determine Rh genotype 12 Page 12 of 19

in recently transfused patients with large amount of circulating donor cells and identify compatible donor for patients with antibody to high incidence Rh antigen. The understanding of the molecular bases associated with Rh blood group antigens and phenotypes enables to consider the identification of blood group antigens and antibodies using molecular approaches. Screening donors DNA testing would conserve antibodies for confirmation by hemagglutination of predicted antigen negativity. Our findings also can be used appropraitely to devise future molecular analysis for mutation determination of Rh genotypes in the Malaysian population.

13 Page 13 of 19

REFERENCES 1. Luyi Y, Dangi Y, Dele w, Xiyu D, shuangmei G, Qin L, Zhonghui G, Ziyan Z: Molecular bases of unexpressed RHD alleles in Chinese D- persons. Transfusion 2009; 49:1655-1660. 2. Mette C, Betina S, Niels G: RHD positive among C/E+ and D- blood donors in Denmark. Transfusion 2010; 50:1460-1464 3. Hiroshi O, Masaki K, Sadahiko I, Mitsunobu T, Taiko S, Yasuto O,Eiji K: The RHD Gene is highly detectable in RhD-negative Japanese Donors. J. Clinical Invest. 1997; 100(2): 373-379. 4. Belinda KS, Carole AG, Neil FA, Peter GM, Elizabeth S, Abigail D, Edwin GN, Linda MH, Geoff D: The presence of an RHD pseudogene containing a 37 base pair duplication and a nonsense mutation in Africans with the Rh Dnegative blood group phenotype. Blood 2000; 95:12-18. 5. Daniels G,Browmilow I: Essential Guide to Blood Groups. Balackwell Publishing Ltd, Uk. 2007. 6. Rozi HM, suhair AA, Hasna H, Yasmin A, Norhanim A, Poh YC, Fawwaz AA: Red cell phenotyping of blood donors at the National Blood Center of Malaysia. Asian Journal of Transfusion Science 2012; 6:3-9. 7. Faas BHW, Simsek S, Bleeker PMM: Rh E/e Genotyping by Allele-Specific Primer Amplification. Blood 1995; 85(3): 829-832. 8. France NP, Pierre-Yves LP, Isabelle M, Anne-Marie R, Genevieve J, Michele R, Pierre L, Claire K, Philippe R, Jean-Pierre C, Helene AP: Molecular background of D (C) (e) haplotypes within the white population. Transfusion 2002; 42:627-633.

14 Page 14 of 19

9. Mhammed T, Sylvie C-F, Thomas G, Amelia B, Pascal B, Jacques C: Molecular analysis of inactive and active RHD alleles in active Congolese cohorts. Transfusion 2009; 49:1353-1360. 10. Ekman GC, Billingsly R, Hessner MJ: Rh Genotyping: Avoiding FalseNegative and False-Positive Results Among Individuals of African Ancestry. American Journal of Hematology 2002; 69:34-40. 11. Gassner C, Schmarda A, Kilga-Nogler S, Jenny-Feldkircher B, Rainer E, Muller TH, Wagner FF, Flegel WA, Schonitzer D: RHD/CE typing by polymerase chain reaction using sequence-specific primers. Transfusion 1997; 37:1020-1026. 12. Hyland CA, Wolter LC, Liew Y-W, Saul A: A Southern analysis of Rh blood group genes: Association between restriction fragment length polymorphism patterns and Rh serotypes. Blood 1994; 83:566-571. 13. Lixing Y, Junjie W, Faming Z, Xiaozhen H, Xianguo X: Molecular basis of D varians in Chinese persons. Transfusion 2007; 47:471-477. 14. Marie L: Taiwan experience suggest that RHD typing for blood transfusion in unnecessary in southeast Asian populations. Transfusion 2006; 46:95-98. 15. Martine GHM, Tax C, Ellen VDS, Rene VD, Lotte DB, Dick JVR, Petra A: RHC and Rhc genotyping in different ethnic groups. Transfusion 2002; 42:634-644. 16. Masja DH, Ellen C, Sigrid HW, Marianne F, Goedele C, Petra A: Red Blood Cell and Platelet Genotyping: from current practice to future high-throughput donor typing. Transfusion Medicine and Hemotherapy 2006; 33: 260-266. 17. Mitsunobu T, Taiko S, Hirotoshi S, Yasuto O, Hiroshi O, Eiji K, Ryutaro U: Japanese Journal of Legal Medicine 1997; 51:32-36.

15 Page 15 of 19

18. Mitsunobu T, Naoko Y, Junko T, Fumiya H, Eiji K, Yoshihiko T: RhC/c genotyping based on polymorphism in the promoter region of the RHCE gene. Japanese Journal of Legal Medicine 2001; 3:205-212. 19. Mouro IY, Colin B, Cherif Z, Cartron JP, Le van Kim C: Molecular genetic basis of the human Rhesus blood group system. Nat Genet.1993; 5:62-65. 20. Neil DA, Marion ER: The Rh blood group system: a review. Blood. 2000; 95:375-388. 21. Tay ZK, Jayaranee ASM, Verrasekaran N, Hemalatha S: Asian Biomedicine 2012; 6:27-33. 22. Timo AL, Duck C, Dong WR, Willy AF: An easy RHD genotyping strategy for D- East Asian persons applied to Korean blood donors. Transfusion 2006; 46:2128-2137. 23. Willy A, Franz F: Molecular Biology of partial D and Weak D: Implications for Blood Bank Practice. Clinical Laboratory 2002; 48: 53-59. 24. Yves C, Baya C, Caroline L, Virginie R, Veronique V, Jean Pierre C : Genetic Basis of the RhD-Positive and RhD-Negative Blood Group Polymorphism as determined by Southern Analysis. Blood 1991; 78(10): 2747-2752.

16 Page 16 of 19

TABLE 1: Summary of primers used RH C/c and RH E/e genotype

Primer Name

Direction

Sequence (5’ to 3’)

Exon 7

Forward

AGCTCCATCATGGGCTACAA

Exon 7

Reverse

ATTGCCGGCTCCGACGGTATC

Intron 3

Forward

GGGTTGGGCTGGGTAAGCTCT

Intron 4

Reverse

GAACCTGCTCTGTGAAGTGCT

RHC

Forward

CAGGGCCACCACCATTTGAA

RHC

Reverse

GAACATGCCACTTCACTCCAG

RHc

Forward

TCGGCCAAGATCTGACCG

RHc

Reverse

TGATGACCACCTTCCCAGG

Forward

CCAAGTGTCAACTCTC

Reverse

TGACCCTGAGATGGCTGT

Forward

ACAGACTACCACATGAAC

Product Size (bp)

RH C/c 95

498 or 535

320

177

RH E/e RHE RHE RHD RHD RHe RHe

Set A

Set B

Set C

Reverse

GCTTTGGCAGGCACCAGGCCAC

Forward

CCAAGTGTCAACTCTG

Reverse

CATGCTGATCTTCCT

108

94

141

17 Page 17 of 19

TABLE 2: Distribution of the RH genotype among 1014 blood donors at NBC, Kuala Lumpur, Malaysia. Race Malay

Chinese

Indian

Others

Total

CCDee

92 (25.6%)

80 (18.4%)

4 (2.4%)

4 (7.1%)

180

ccDEE

34 (9.4%)

82 (18.9%)

5 (3.1%)

4 (7.1%)

125

CcDeE

41 (11.4%)

62 (14.3%)

16 (9.8%)

2 (3.6%)

121

CCDeE

45 (12.5%)

32 (7.4%)

3 (1.8%)

5 (9.0%)

85

cCDEE

2 (0.5%)

9 (2.1%)

0 (0%)

0 (0%)

11

CcDweakee

54 (15.0%)

66 (15.2%)

27 (16.5%)

10 (17.9%)

157

ccDEe

25 (6.9%)

61 (14.1%)

20 (12.2%)

4 (7.1%)

110

ccDee

8 (2.2%)

17 (3.9%)

13 (7.9%)

4 (7.1%)

42

ccee

38 (10.6%)

14 (3.2%)

65 (39.6%)

21 (37.5%)

138

Ccee

16 (4.4%)

8 (1.8%)

8 (4.9%)

1 (1.8%)

33

ccEe

1 (0.3%)

1 (0.2%)

3 (1.8%)

0 (0%)

5

CceE

2 (0.6%)

0 (0%)

0 (0%)

1 (1.8%)

3

Ccee

2 (0.6%)

2 (0.5%)

0 (0%)

0 (0%)

4

TOTAL

360 (100%)

434 (100%)

164 (100%)

56 (100%)

1014

Rh Genotype

18 Page 18 of 19

TABLE 3: Discrepancies of serological phenotype and genotype results Bil Race

Serology Phenotype Result

Genotype Results

1. 2. 3. 4. 5. 6. 7. 8.

Chinese Malay Malay Malay Malay Malay Malay Malay

CCDee CCDee CCDee CCDee CCDee CCDee CCDee CCDee

CcDee CcDee CcDee CcDee CcDee CcDee CcDee CcDee

9.

Malay

CCDee

CcDEe

10. Chinese

ccDEE

CcDEE

11. Malay

CcDee

CCDEe

12. Chinese

ccDEe

CcDEe

13. Indian

ccDEe

CcDee

14. Chinese 15. Indian

ccDee ccDee

CcDee CcDee

16. Indian

ccee

Ccee

17. Others

Ccee

ccee

18. Others

ccEe

CcEe

*Discrepancy showed in bold which the change of single allele

19 Page 19 of 19