G Model

ARTICLE IN PRESS

EJCB 50788 1–11

European Journal of Cell Biology xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

European Journal of Cell Biology journal homepage: www.elsevier.com/locate/ejcb

WIP is necessary for matrix invasion by breast cancer cells

1

2 3 4 5

Q1

Esther García a , Laura M. Machesky b , Gareth E. Jones c,∗,1 , Inés M. Antón a,∗,1 a

Department of Cellular and Molecular Biology, Centro Nacional de Biotecnología (CNB-CSIC), Campus UAM Cantoblanco, Darwin 3, 28049 Madrid, Spain The Beatson Institute for Cancer Research, Bearsden, Glasgow G61 1BD, Scotland, UK c Randall Division of Cell & Molecular Biophysics, King’s College London, London SE1 1UL, UK b

6

7 21

a r t i c l e

i n f o

a b s t r a c t

8 9 10 11 12

Article history: Received 27 March 2014 Received in revised form 28 July 2014 Accepted 30 July 2014

13

20

Keywords: Invadopodia Actin cytoskeleton Metastasis Matrix degradation 3D invasion Epithelial–mesenchymal transition

22

Introduction

14 15 16 17 18 19

23 24 25 26 27 28 29 30 31 32 33

Actin filament assembly and reorganisation during cell migration and invasion into extracellular matrices is a well-documented phenomenon. Among actin-binding proteins regulating its polymerisation, the members of the WASP (Wiskott Aldrich Syndrome Protein) family are generally thought to play the most significant role in supporting cell invasiveness. In situ, cytosolic N-WASP (neural WASP) is associated with a partner protein termed WIP (WASP Interacting Protein) that is bound to the N-terminal domain of N-WASP. Despite much effort, rather little is known about the role of WIP in regulating N-WASP and consequent actin-filament assembly. Even less is known about the function of WIP within the specialised cell adhesion and attachment structures known as podosomes and invadopodia. In particular, whilst the interaction of WIP with known participants in the development and maturation of invadopodia such as N-WASP, the Arp2/3 complex and cortactin has been described, little is known concerning the direct contribution of WIP to invadopodia and its potential role as a regulator of cancer cell invasion. In this report, we use 2D and 3D culture systems to describe the role played by WIP in modulating the morphology and invasiveness of metastatic breast cancer cells in vitro, as well as its effect on the process of mesenchymal–epithelial transition (MET) seen in these cells. We demonstrate that WIP is necessary for invadopodium formation and matrix degradation by basal breast cancer cells, but not sufficient to induce invasiveness in luminal cells. © 2014 Published by Elsevier GmbH.

When a cancer is localised it can be cured with radical surgery or radiotherapy, but once it has spread it is almost impossible to fully eradicate. In this simple statement lies the basis of a huge effort to discover efficient inhibitors of cancer cell spread from the original site of a tumour. Epithelial cells may undergo malignant transformation due to DNA damage and abnormal cell proliferation that leads to hyperplasia and loss of tissue architecture, originating a carcinoma in situ (Beckmann et al., 1997). A variable number of these carcinoma cells often lose cell-cell contacts and acquire migratory and invasive characteristics, detaching from the neighbouring epithelia and

Q2 ∗ Corresponding authors at: CNB-CSIC, Darwin 3, Campus Cantoblanco, 28049 Madrid, Spain. Tel.: +34 915855312/+44 0 20 7848 6466; fax: +34 915854506/+44 0 20 7848 6435. E-mail addresses: [email protected] (E. García), [email protected] (L.M. Machesky), [email protected] (G.E. Jones), [email protected] (I.M. Antón). 1 These authors contributed equally to the work reported here.

crossing the underlying basement membrane (BM). Entry into the stroma gives such cells access to the vasculature, thus enabling them to reach the blood or lymph vessels. Many studies over the past decade have indicated that tissue invasion and migration requires cancer cells to adhere to as well as degrade the surrounding extracellular matrix. Cancer cells use a plethora of cell: substratum adhesions to interact with the extracellular matrix (ECM) ranging from peripheral focal complexes and larger focal adhesions to protrusive adhesions called invadopodia, that are also capable of matrix degradation. Invadopodia are almost by definition exclusive to cancer cells of epithelial origin and are constructed on an actin core surrounded by scaffolding proteins, metalloproteinases (MMP) and kinases (Gimona et al., 2008; Linder et al., 2011). Proteins such as the Q3 Actin-related protein (Arp2/3) complex, neural Wiskott-Aldrich Syndrome protein (N-WASP), fascin and cortactin are essential for invadopodium formation, stability and function (Calle et al., 2008; Clark et al., 2007; Yamaguchi et al., 2005; Li et al., 2010) and together with F-actin, serve as markers to identify these structures. There are numerous excellent reviews on the structure and function of invadopodia (Linder et al., 2011; Yamaguchi and Oikawa,

http://dx.doi.org/10.1016/j.ejcb.2014.07.008 0171-9335/© 2014 Published by Elsevier GmbH.

Please cite this article in press as: García, E., et al., WIP is necessary for matrix invasion by breast cancer cells. Eur. J. Cell Biol. (2014), http://dx.doi.org/10.1016/j.ejcb.2014.07.008

34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54

G Model EJCB 50788 1–11

E. García et al. / European Journal of Cell Biology xxx (2014) xxx–xxx

2 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88

89

90

91 92 93 94 95 96 97 98 99 100

101

102 103 104 105 106 107 108 109 110 111 112 113 114

ARTICLE IN PRESS

2010). Here, we implicate the actin binding and proline-rich protein WIP in invadopodium formation and function and we present evidence that WIP function may be important for the aggressiveness of invasive breast cancers. N-WASP and WIP (WASP Interacting Protein) form a complex (de la Fuente et al., 2007; Sasahara et al., 2002), in which WIP is thought to preserve N-WASP in an auto-inhibited conformation (Kim et al., 2000; Miki et al., 1998). By promoting the inactive form, WIP regulates N-WASP activation by Cdc42 and PIP2 (phosphatidylinositol 4,5-bisphosphate) (Martinez-Quiles et al., 2001; Prehoda et al., 2000). Of the three major isoforms of the family (Anton et al., 2007) WIP itself is generally expressed in nonerythroid haematopoietic cells where it is critical for immune cell proliferation, activation and migration (Anton et al., 2002; BanonRodriguez et al., 2013; Gallego et al., 2006; Le Bras et al., 2009). In non-immune cells, WIP also has numerous functions contributing to cell adhesion, spreading, chemotaxis and neuritogenesis (BanonRodriguez et al., 2013; Franco et al., 2012; Lanzardo et al., 2007). Recent publications have demonstrated direct and indirect connexions between endogenous WIP location at invadopodia (Garcia et al., 2012). Additional data supporting a role for WIP at invadopodia and cancer cell spread is sparse although the expression of the WIP gene WIPF1 appears to be directly related to poor prognosis in colorectal cancer, breast cancer and glioma patients (Staub et al., 2009). WIP is also found to be upregulated after EMT induction of prostate cancer cells, which increases cell migration and invasiveness (Gu et al., 2007). Although the interaction of WIP with known contributors to the development and maturation of invadopodia such as N-WASP and cortactin (Kinley et al., 2003) has been described, little else is known concerning the direct contribution of WIP to invasive protrusions and its potential role as a regulator of cancer cell invasion. In this paper we describe the effects of WIP on key parameters of breast cancer cell morphology and invasive phenotype. Materials and methods Breast cancer cell lines The following breast cancer cell lines (BCC) from American Type Culture Collection were used: MDA-MB-231, MDA-MB-157, Hs578T, MCF-7, T47D and BT474. This collection is representative of a range of cell lines of diverse tumour origin, gene expression and invasive behaviour. Some clinical and pathological features as well as culture conditions of these cell lines have been described (Neve et al., 2006). Cells were cultured at 37 ◦ C and 5% CO2 . All culture media were supplemented with 2 mM l-glutamine and antibiotics (1000 U/ml penicillin and 0.1 mg/ml streptomycin) (all from Sigma).

removed and the PEI-DNA mixture added to the cells (4 h, 37 ◦ C). The transfection mixture was replaced with fresh culture medium and incubated (48–72 h, 37 ◦ C), after which the supernatant containing lentiviral particles was collected and centrifuged (1000 g, 5 min) to remove remaining cells, filtered (0.45 ␮m), aliquoted and stored at -80 ◦ C. Generation of stable WIP “knock-down” cells MDA-MB-231 cells were infected with lentiviral particles containing shRNA (small hairpin RNA)-encoding plasmids pLKO.1puro (Sigma MISSION® ) against various target sequences of WIPF1 gene (WIP, NCBI Reference Sequence NM 003387) to silence WIP expression via RNA interference. Sequence (5 –3 ): shWIP-1: CCGGCCAATACTGGACAAACCTAAACTCGAGTTTAGGTTTGTCCAGTATTGGTTTTT shWIP-2: CCGGCCTCCACCATCAACATCTATTCTCGAGAATAGATGTTGATGGTGGAGGTTTT MDA-MB-231 cells at 50% confluence were infected using pLKO.1-puro-control (empty vector) or pLKO.1-puro-shWIP lentiviral stocks in the presence of 5 ␮g/ml polybrene (Sigma) to increase viral infection efficiency (24 h, 37 ◦ C); the viruscontaining medium was then replaced with fresh medium. At 48 h post-infection, 1 ␮g/ml puromycin (Sigma) was added to select efficiently infected cells. Cells were stably maintained in 1 ␮g/ml puromycin, with serial passages every 2–3 days. Plasmid DNA amplification and transfection For XL2-Blue bacterial transformation, 20 ␮l of XL2-Blue ultracompetent cells were thawed on ice and mixed with 50 ng DNA (20 min, 4 ◦ C), then heat-shocked (2 min, 37 ◦ C), followed by 1 min incubation on ice. Luria broth medium (LB, 50 ␮l) was added to the mixture and incubated (30 min, 37 ◦ C). Cells were seeded onto LB-agar containing plates with the appropriate selective antibiotic. For plasmid DNA purification, the bacterial culture (200 ml) was grown in LB containing the selective antibiotic and processed for DNA purification using the PureLink HiPure Plasmid Filter Maxiprep Kit (Invitrogen) according to manufacture’s instructions. Generation of WIP overexpressing cells MCF-7 and T47D cell lines were transduced with lentiviral particles (pLNT/Sffv-eGFP, pLNT/Sffv-WIP-eGFP, pLNT/Sffv-mCherry or pLNT/Sffv-WIP-mCherry). Briefly, 60% confluent cells were infected for 24 h at 37 ◦ C and the medium replaced. Cells were used for labelling or gelatin degradation assay 48 h after infection.

Generation of lentiviral particles

Inverse invasion assay

Lentiviral particle stocks were produced in human 293T cells by co-transfecting the envelope plasmid pMD.2G, the packaging plasmid pCMVR8.91 (Zufferey et al., 1997), and one of the following transfer vectors: pLKO.1-puro (Sigma MISSION® ), pLNT/Sffv-eGFP or pLNT/Sffv-mCherry (Banon-Rodriguez et al., 2013). The 293T cells were cultured in complete DMEM and, after reaching 80% confluence, transfected with polyethylenimine (PEI, Sigma). For each vector, OptiMEM (serum-free medium, Gibco) was used to dilute PEI (25 ␮g/ml) and DNA, and the mixtures were incubated (5 min, room temperature (RT)). Final concentrations of DNA plasmids were 7.5 ␮g/ml of pCMVR8.91, 2.5 ␮g/ml pMD2G and 10 ␮g/ml transfer vector. PEI and DNA were mixed and incubated (15 min, RT). After gently washing cells in OptiMEM, growth medium was

Inverted invasion assays were performed as described (Hennigan et al., 1994). Briefly, 4–5 mg/ml Matrigel (BD BioScience) was allowed to polymerise in transwell inserts (Corning) for at least 1 h (37 ◦ C). Inserts were then inverted, and 5 × 105 cells seeded directly onto the outer filter surface and allowed to adhere (5 h). After serial washing by dipping inserts in serum-free DMEM to remove unattached cells, inserts were placed in 500 ␮l serum-free medium and, to create a chemotactic gradient, 100 ␮l of 10% FBS-supplemented medium were added to the Matrigelcontaining chamber. Some experiments were performed with DMSO or the MMP inhibitor GM6001 (25 ␮M, Santa Cruz). At 72 to 96 h after seeding, cells were stained with the Calcein-AM viability marker (4 ␮M, Invitrogen) in DMEM (1 h, 37 ◦ C). Cells that did not

Please cite this article in press as: García, E., et al., WIP is necessary for matrix invasion by breast cancer cells. Eur. J. Cell Biol. (2014), http://dx.doi.org/10.1016/j.ejcb.2014.07.008

115 116 117 118 119 120

121

122 123 124 125 126 127

128 129 130 131

132 133 134 135 136 137 138 139

140

141 142 143 144 145 146 147 148 149 150

151

152 153 154 155 156

157

158 159 160 161 162 163 164 165 166 167 168 169 170

G Model EJCB 50788 1–11

ARTICLE IN PRESS E. García et al. / European Journal of Cell Biology xxx (2014) xxx–xxx

180

cross the transfilter were removed with a tissue and the invading cells were visualised by confocal microscopy (Bio-Rad) using a 40× objective. Serial optical sections were captured at 10-␮m intervals. The area covered by cells was measured in each section using the ImageJ software (US National Institutes of Health) plugin “Area Calculator” in 8-bit images (threshold 30–50/255). Relative invasion was calculated as the area covered by cells that invaded 20 ␮m or higher relative to total cell area of the Z-stack. At least three independent experiments in duplicate were performed for each sample.

181

Fluorescent gelatin degradation assay

171 172 173 174 175 176 177 178 179

204

The ability of cells to form invadopodia and degrade the matrix was analysed using fluorescent matrix-coated dishes prepared as described (Bowden et al., 2001). Gelatin type A from porcine skin (2 mg/ml, Sigma) was diluted at 37 ◦ C in a buffer containing 50 mM Na2 B4 O7 and 61 mM NaCl, pH 9.3, and subsequently labelled with rhodamine B isothiocyanate (final concentration 36 ␮g/ml; Sigma) by mixing (2 h, in the dark). Unbound dye was removed by extensive dialysis against PBS in the dark (2–3 days, RT). Acid-washed coverslips (1 M HCl) were coated with 80 ␮l pre-warmed rhodamine-gelatin and crosslinked with 0.5% glutaraldehyde (TAAB) in PBS (15 min). After washing with PBS, coverslips were quenched with 5 mg/ml sodium borohydride (3 min), followed by extensive washing with PBS. The coverslips were then sterilised with 70% ethanol (5 min) and incubated in serum-free medium (1–24 h) before use. Cells (2.5 × 104 ) were cultured on gelatin for 5-48 h (depending on the cell line used), fixed and processed by immunofluorescence (IF) as described below. Invadopodium-forming cells were considered to be those that showed F-actin- and cortactin-positive dots ≤0.25 ␮m2 at the ventral surface of the cells. Number of invadopodia-forming cells and degrading cells were calculated by examining 25 random fields imaged with a wide field microscope Leica DMI6000B fitted with a Leica HCX PL Apo CS 63x/1.4NA oil objective.

205

Immunofluorescence

182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203

217

For IF analysis, fixed cells from glass coverslips were permeabilised using 0.05% Triton X-100 (Panreac) in PBS. After washing in PBS, cells were incubated with Antibody Diluent blocking solution (DAKO) for at least 30 min, followed by primary antibody (overnight, 4 ◦ C): anti-cortactin (clone 4F11, Millipore), -vimentin (clone V9, Thermo), -WIP (H-224, Santa Cruz) or -Tyr-tubulin (clone TUB-1A2 Sigma). After extensive washing in PBS, cells were incubated with secondary antibodies (Invitrogen: Alexa fluor 405 or 488 anti-mouse and Alexa 647 anti-rabbit) or fluorescent phalloidin (Sigma: Alexa 488 phalloidin) in DAKO Antibody Diluent (45 min, RT) and samples were mounted using Fluoromount-G (Southern Biotech).

218

Western blot

206 207 208 209 210 211 212 213 214 215 216

219 220 221 222 223 224 225 226 227 228 229 230

For Western blot (WB) analysis, cells were scraped into icecold lysis buffer (150 mM NaCl, 50 mM Tris–HCl pH 7.4, 1 mM EDTA, 1 mM EGTA, 0.1% Triton X-100), complete protease inhibitor cocktail and PhosSTOP phosphatase inhibitor cocktail (both from Roche). After 15 min incubation on ice, lysates were clarified by centrifugation (13,600 g, 5 min, 4 ◦ C). Protein concentration was determined using a Bradford protein-assay (Bio-Rad) according to manufacturer’s instructions. Soluble lysates were diluted in 5× loading buffer (325 mM Tris–HCl pH 6.8, 10% SDS, 25% glycerol, 5% ␤-mercaptoethanol, 0.5% bromophenol blue) and boiled (5 min). Proteins were resolved by 8–10% SDS-PAGE (sodium dodecyl sulphate-polyacrylamide

3

gel electrophoresis) in electrophoresis buffer (25 mM Tris pH 8.3, 192 mM glycine, 0.1% SDS) using Precision Plus Dual Color Standards molecular weight markers (Bio Rad). Proteins were transferred to a 0.2 ␮m nitrocellulose membrane (Bio-Rad), previously equilibrated in transfer buffer (25 mM Tris pH 8.3, 192 mM glycine, 20% methanol), using a humid system (Mini Trans-Blot, Bio-Rad) at 120–140 V (constant) for 90 min. To avoid non-specific signal, membranes were incubated in blocking solution (5% dehydrated skim milk in PBS-T (PBS-0.05% Tween 20) or TBS-T (10 mM Tris–HCl pH 8, 150 mM NaCl, 0.05% Tween 20)). After overnight incubation with primary antibodies (in blocking solution: anti-WIP, -GAPDH (clone 4G5, AbD Serotech), E-cadherin and ␤-catenin (Santa Cruz); membranes were washed in PBS-T or TBS-T and incubated 1 h at RT with HRP (horseradish peroxidase)-conjugated secondary anti-mouse or anti-rabbit antibodies (Santa Cruz). After extensive washing, the membrane was developed by a chemiluminiscence reaction using as substrates Western Lightning-ECL (Perkin Elmer) or Luminata Crescendo Western HRP Substrate (Millipore). Densitometry analyses were performed using ImageJ. Data were normalised to GAPDH and to experimental control sample (shControl). Confocal microscopy and image processing Confocal images were collected using the following inverted confocal microscopes: Bio-Rad Radiance 2100 confocal system in a Zeiss Axiovert 200 microscope equipped with a Zeiss PlanNeoFluar 20x/0.5NA and Zeiss Plan-Apochromat 63x/1.4NA oil objective lens. Images were collected with LaserSharp 2000 v. 5.2 acquisition software. Leica SP5 TCS confocal system equipped with a Leica HCX PL Apo CS 40x/1.25NA oil objective lens and a Leica HCX PL Apo CS lambda blue 63x/1.4NA oil objective lens. Images were collected and processed with LAS AF v. 2.6.0 software. Images were subsequently processed using the free-source imaging package ImageJ (http://rsbweb.nih.gov/ij/). Z-projections were generated from 2.0–6.0 ␮m Z-series with a 0.5 ␮m step size for cells cultured on gelatin. Cell fluorescence intensity was quantified using the ImageJ Freehand Selection tool and measuring the parameters “Area”, “Mean Grey Value” (the sum of grey values of all pixels in the selection divided by the number of pixels) and “Integrated Density” (defined as the product of “Area” and “Mean Grey Value”) for at least 15 cells per condition. Corrected total cell fluorescence (CTCF) was calculated as: CTCF = integrated density − (area of selected cell × mean fluorescence of background readings)

231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251

252

253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275

Statistical analysis Statistical analysis was performed using Prism 5.0b for Mac OS X software (GraphPad Software, Inc.). Data were represented as mean ± standard deviation (SD). Student’s t-test was used to compare mean values, one-way ANOVA to compare measures of multiple observations and the Chi square test to compare distribution of nominal variables. Results WIP deficiency decreases invadopodium formation and ECM degradation by breast cancer cells (BCCs) Basal B cell lines show a strong invasive phenotype in vitro and/or in vivo, a significant behavioural difference from that

Please cite this article in press as: García, E., et al., WIP is necessary for matrix invasion by breast cancer cells. Eur. J. Cell Biol. (2014), http://dx.doi.org/10.1016/j.ejcb.2014.07.008

276

277 278 279 280 281 282

283

284 285

286 287

G Model EJCB 50788 1–11 4

ARTICLE IN PRESS E. García et al. / European Journal of Cell Biology xxx (2014) xxx–xxx

Fig. 1. BCC invasiveness on gelatin assay. Basal B (MDA-MB-231, MDA-MB-157 and Hs578T) and luminal cell lines (MCF-7, T47D and BT474) were plated on rhodaminegelatin (red) and incubated (16 h). After fixation in 4% PFA and IF staining with the invadopodium markers F-actin (green) and cortactin (not shown), cells were visualised by confocal microscopy. (A) The images show representative Z-projections in which invadopodia localise at areas of active degradation (dark areas in the gelatin). Bars: 10 ␮m (insets, 5 ␮m). (B) Quantification of invadopodium-forming cells and degrading cells. Data show mean ± SD of two (Hs578T) and three independent experiments. * P < 0.05; *** P < 0.001 by the Chi square test.

288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312

observed for luminal cells which are poorly invasive (Blick et al., 2008; Charafe-Jauffret et al., 2006; Kenny et al., 2007). To confirm the invasive behaviour of these cell lines, we plated basal B (MDA-MB-231, MDA-MB-157 and Hs578T) and luminal cells (MCF-7, T47D and BT474) on fluorescent gelatin for 16, 24 or 48 h, and analysed invadopodium formation (Fig. 1). After IF staining for the invadopodium markers F-actin and cortactin, we observed that only basal B cells were able to degrade the gelatin after invadopodium formation, showing these cell lines have similar invasive capacities (Fig. 1A and B). In contrast, luminal cells were neither able to form invadopodia nor degrade the matrix at any incubation time (Fig. 1A; no quantification possible for Fig. 1B). Thus we confirm that basal invasive BCCs form functional invadopodia and luminal non-invasive cells do not. The MDA-MB-231 cell line is an established model for the study of tumour cell invasion (Lacroix and Leclercq, 2004; Neve et al., 2006). Since earlier studies demonstrated that WIP is located at invadopodia and in invasive protrusions in this cell line (Garcia et al., 2012), we hypothesised that WIP depletion may affect the degradative capability of this cell line. We generated stable MDAMB-231 WIP-deficient cells by expressing shRNA via lentiviral infection. After testing up to five independent shRNAs, we selected for subsequent experiments two sequences that depleted WIP by 85% (Fig. 2A). For the sake of brevity, data for only one or two specific shRNAs are presented in subsequent figures although both

sequences were similar in their effects. In contrast to control cells which were able to form invadopodia (F-actin- and cortactinpositive dots) and generate dark areas in the gelatin that indicated matrix degradation, WIP-deficient cells had reduced ability to form invadopodia and subsequently degrade gelatin (Fig. 2B and C). Furthermore, the percentage of invadopodium-forming cells declined with time as did matrix degradation in WIP-depleted cells (Fig. 2C). Although F-actin dots were found in the absence of WIP, these were smaller than that found in invadopodia and significantly, did not contain cortactin. These results indicate that WIP deficiency reduces both the number of invadopodium-forming cells and their degradative capability, suggesting that WIP participates in invadopodium formation and function. WIP overexpression is not sufficient to induce invasiveness in luminal BCCs Luminal cells were not able to degrade gelatin (Fig. 1); given our finding that WIP greatly influenced the ability of cells to form functional invadopodia (Fig. 2) we tested whether an increase in WIP expression was sufficient to induce invasive behaviour in luminal cells. We overexpressed WIP-eGFP or WIP-mCherry by transducing MCF-7 and T47D cells with the appropriate lentiviral particles: yielding a high frequency (approximately 90%) of WIP-XFP expressing cells. We first examined the cellular distribution of exogenously

Please cite this article in press as: García, E., et al., WIP is necessary for matrix invasion by breast cancer cells. Eur. J. Cell Biol. (2014), http://dx.doi.org/10.1016/j.ejcb.2014.07.008

313 314 315 316 317 318 319 320 321 322 323 324 325

326 327

328 329 330 331 332 333 334 335

G Model EJCB 50788 1–11

ARTICLE IN PRESS E. García et al. / European Journal of Cell Biology xxx (2014) xxx–xxx

5

Fig. 2. WIP is necessary for invadopodium-mediated degradation. (A) Western blot analysis and quantification of the relative expression of WIP after lentiviral shRNA interference in MDA-MB-231 cells. (B) Stably infected MDA-MB-231 cells (shControl or shWIP) were plated on rhodamine–gelatin-coated glass coverslips (red, 5 h), fixed and stained for F-actin (green) and cortactin (cyan). Bars: 10 ␮m (insets, 5 ␮m). (C) Quantification of invadopodium-forming cells and degrading cells at early (1 week) or late (4 weeks) time in culture were normalised to control values. Data show mean ± SD of at least three independent experiments (70–110 cells analysed for each condition). * P < 0.05; *** P < 0.001 by the Chi square test.

336 337 338 339 340 341 342 343 344 345 346

expressed WIP by IF, and whether its overexpression induced morphological change in the cells. Although WIP levels were variable, we found that exogenous WIP induced formation of actin-rich peripheral protrusions in MCF-7 cells, which formed larger lamellipodia than controls; in T47D cells, we observed the formation of diverse types of protrusive structures (Fig. 3). When these cells were plated on rhodamine-gelatin however, we observed no changes in their invasive ability, with no invadopodium formation nor matrix degradation (Fig. 4). Exogenous WIP expression thus induced aberrant actin-rich protrusions, but did not promote invadopodium formation in luminal BCC.

WIP-deficient cells show impaired invasion in 3D matrices In order to test WIP’s contribution to 3D invasion we analysed the ability of WIP-depleted MDA-MB-231 cells to invade thick Matrigel plugs in an inverse invasion assay (Hennigan et al., 1994). Absence of WIP significantly impaired invasion (Fig. 5). Whereas control cells were able to cross the filter barrier and invade deep into the matrix, WIP-depleted cells invaded approximately 30% of control values (Fig. 5B) despite retaining cellular invasive morphology. To clarify whether the reduced invasive capability was due to a decrease in the MMP activity needed for

Please cite this article in press as: García, E., et al., WIP is necessary for matrix invasion by breast cancer cells. Eur. J. Cell Biol. (2014), http://dx.doi.org/10.1016/j.ejcb.2014.07.008

347

348 349 350 351 352 353 354 355 356

G Model EJCB 50788 1–11 6

ARTICLE IN PRESS E. García et al. / European Journal of Cell Biology xxx (2014) xxx–xxx

Fig. 3. Exogenous WIP expression in luminal BCC modifies actin-rich structures. MCF-7 and T47D cells were plated on glass coverslips 24 h after lentiviral infection (pLNT-control or pLNT-WIP) and cultured (24 h). After fixation in 4% PFA, (A) MCF-7 cells were stained by IF for F-actin (red), cortactin (cyan) and WIP (blue) and (B) T47D cells were stained for WIP (green) and visualised by confocal microscopy. Bars: 25 (A) and 10 ␮m (B). Arrows indicate cell protrusions; arrowheads indicate large lamellipodia. 357 358 359 360

Matrigel degradation, we allowed the cells to invade in the presence of the MMP-inhibitor GM6001. This treatment of control and WIP-depleted cells reduced invasion compared to vehicle treatment (Fig. 5A and B). We additionally examined whether WIP

overexpression altered the invasive behaviour of luminal cells in 3D, but neither control nor overexpressing WIP luminal cells crossed the filter, making difficult any accurate quantification of these cells invading the Matrigel (data not shown).

Please cite this article in press as: García, E., et al., WIP is necessary for matrix invasion by breast cancer cells. Eur. J. Cell Biol. (2014), http://dx.doi.org/10.1016/j.ejcb.2014.07.008

361 362 363 364

G Model EJCB 50788 1–11

ARTICLE IN PRESS E. García et al. / European Journal of Cell Biology xxx (2014) xxx–xxx

7

Fig. 4. WIP overexpression in T47D cells is not sufficient to induce invadopodium formation. Cells were infected with lentiviral particles pLNT-eGFP and pLNT-WIP-eGFP (green). At 24 h post-infection, cells were plated on rhodamine–gelatin (red) for analysis of invadopodium formation and gelatin degradation (24 h). Bar = 10 ␮m.

Fig. 5. WIP mediates invasion into 3D Matrigel plugs. (A) Transmigration of MDA-MB-231 cells stably infected with control shRNA (shControl) or WIP shRNA (shWIP) into Matrigel plugs in an inverted invasion assay. Cells were incubated in presence of DMSO (vehicle) or 25 ␮M GM6001. After staining with Calcein-AM (green) living cells were visualised by confocal microscopy. Serial optical sections were acquired at 10 ␮m intervals and are showed alongside one another, with increasing depth from left to right as indicated. Bar: 100 ␮m. (B) Quantification of invasion is expressed as relative invasion above 20 ␮m normalised to shControl samples. Invasion was determined by measuring the area covered by cells (␮m2 ) for each section. Data shown are means ± SD of at least three independent experiments. *** P < 0.001 by 1-way ANOVA and Tukey’s multiple comparison test.

Please cite this article in press as: García, E., et al., WIP is necessary for matrix invasion by breast cancer cells. Eur. J. Cell Biol. (2014), http://dx.doi.org/10.1016/j.ejcb.2014.07.008

G Model EJCB 50788 1–11

E. García et al. / European Journal of Cell Biology xxx (2014) xxx–xxx

8 365 366

367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387

388

389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426

ARTICLE IN PRESS

WIP deficiency provokes an increase in epithelial markers and a decrease in mesenchymal markers WIP is overexpressed in prostate cancer cells after EMT induction (Gu et al., 2007). We hypothesised that in addition to controlling cell invasion, WIP might regulate other components that contribute to the cellular invasive behaviour so we tested whether WIP is involved in EMT regulation. Using WB, we analysed epithelial marker levels after WIP overexpression in luminal cells, but found no alteration in their expression (Fig. 6A). On the other hand, MDA-MB-231 (mesenchymal-like) WIP-deficient cells showed notable changes in cell morphology after at least one month in culture, when they acquired epithelial-like characteristics (Fig. 6B and C). Analyses of epithelial marker expression indicated an increase in E-cadherin and ␤-catenin expression in MDA-MB-231 and Hs578T WIP-depleted cells (Fig. 6D and data not shown), whereas the mesenchymal marker vimentin was significantly reduced in WIP-depleted MDA-MB-231 cells (Fig. 6E and F). WIP depletion clearly altered the mesenchymal phenotype in MDA-MB-231 cells and, with variable intensity, induced an increase in epithelial markers in the basal B cell lines tested. This suggests that reduced invasive capability of WIP-depleted cells might be related to a loss of mesenchymal phenotype over time (Fig. 2).

Discussion In this study we use advanced imaging approaches, some of which mimic conditions of in vivo invasion, to provide insights into the role of WIP in BCC invasiveness in both 2D and 3D systems. Closely related to its role in invadopodium formation and matrix degradation, we identified an unpredicted WIP function in the regulation of mesenchymal properties. Although the localisation of overexpressed exogenous WIP at invadopodia and the contribution of WIP to invadopodiummediated invasion was described a few years ago (Yamaguchi et al., 2005), our laboratories provided the first evidence of the presence of endogenous WIP at invadopodia and in the invasive protrusions developed in Matrigel (Garcia et al., 2012). In this work we show that the absence of WIP significantly reduced invadopodium formation on gelatin-coated matrices. Moreover, although WIP depletion provoked no obvious change in cell morphology in Matrigel, it drastically decreased the degree of 3D Matrigel invasion, which is thought to better mimic in vivo invasion than gelatin degradation assays (Friedl and Wolf, 2008). We further demonstrate that the inhibition of MMP activity in an inverse invasion assay decreased invasion of both control and WIP-deficient cells (Fig. 5) suggesting that the reduced invasiveness due to WIP depletion is not directly linked to MMP secretion. This finding is in agreement with our previous data showing that disruption of a WIP–cortactin interaction caused by ectopic expression of a cortactin-domain deficient WIP construct in WIP-null cells did not significantly alter total MMP synthesis but the targeting of MMP-containing vesicles to sites of malformed podosomes was affected (Banon-Rodriguez et al., 2011). WIP−/− dendritic cells (DCs) remain able to synthesise MMPs but do not degrade the extracellular matrix. Infection of WIP KO DCs with lentivirus expressing WIP restored both podosome formation and their ability to degrade the extracellular matrix, implicating WIP-induced podosomes as foci of functional MMP location. When WIP KO DCs were infected with a mutant form of WIP lacking the cortactin-binding domain (WIP110–170) DCs were only able to elaborate disorganised podosomes that were unable to support MMP-mediated matrix degradation. A similar finding has more recently been reported by others for

invadopodia using inhibitory cortactin nanobodies. The WIPcortactin functional domain was shown to be important for the formation of properly organised invadopodia, MMP-9 secretion, matrix degradation, and cancer cell invasion (Van Audenhove et al., 2014). Our data indicate that WIP is necessary to maintain a mesenchymal phenotype in MDA-MB-231 and Hs578T cells, as its reduction promotes loss of the mesenchymal marker vimentin and induces expression of markers of epithelial phenotype, namely E-cadherin and ␤-catenin. These data agree with a previous study showing upregulation of WIP during EMT in prostate cancer cells (Gu et al., 2007) and suggest that WIP plays a role in the modulation of mesenchymal-epithelial phenotypes. We detected significant changes only after 4 weeks in culture, but gradual steps in this transition were recorded at earlier intervals. Although EMT and MET have been widely reported to occur in vitro, these events (frequently reversible) are highly variable and depend on the cell lines or the signalling factors used to induce transition (Brown et al., 2004; Scheel et al., 2011; Takebe et al., 2011). In our study we have observed MET in WIP-deficient cells cultured in conventional medium (10% FBS, without any specific signalling factor), so we cannot infer the pathways involved in these process. It is worthy of note that Geha and colleagues report that WIP transcriptionally regulates cell adhesion in fibroblasts by shifting the F–G actin equilibrium away from G-actin, promoting activation of serum response factor (SRF). SRF in turn drives the expression of genes that encode for focal adhesion proteins (Ramesh et al., 2014). SRF not only regulates cancer invasion and migration via ROCK (Zhao et al., 2013) but also modulates the expression of beta-catenin and Wnt/beta-catenin target genes such as cmyc and cyclin D1 (Choi et al., 2009; Kwon et al., 2010). These findings provide a logical link between actin dynamics regulated by WIP and EMT-related programs involved in cancer progression. During tumour progression, cell plasticity is essential to facilitate metastasis; for individual or collective invasion, epithelial cells must mobilise their interconnecting adherence junctions as well as altering adhesion to the basement membrane (Peglion et al., 2014). Once cells have reached a new tissue, they must likewise establish and regain cell-cell interactions. This transition shares common regulatory pathways that involve Rac, Src, FAK integrins and Wnt signalling pathways (Janmey et al., 2013; Reffay et al., 2014; Savagner, 2001). These signals are activated by external factors from the ECM such as collagen, EGF or TGF␤ (Savagner et al., 1994), or by mechanical forces that regulate cell behaviour (Janmey et al., 2013). Adherence junctions and the actin cytoskeleton are essential to convey these signals, frequently by inducing changes in gene expression through the myocardin-related transcription factor (MAL/MRTF) pathway, adjusting cell response to changes in ECM stiffness or composition (Halder et al., 2012; McGee et al., 2011). Our findings on the contribution of WIP to regulation of mesenchymal behaviour suggest that WIP is a candidate as a regulator of epithelial-mesenchymal or mesenchymal-epithelial transition in cancer cells. WIP overexpression is insufficient to induce invasiveness and mesenchymal-like characteristics in luminal cells, so WIP is not likely to be a primary driver of EMT. The connection between WIP expression levels and mesenchymal phenotype is also seen in prostate cancer cells, where EMT induction leads to overexpression of WIP and other genes linked to cell adhesion and integrin signalling, promoting cell motility (Gu et al., 2007). Although further experiments must be performed to confirm these data, our results suggest that WIP has an important role in controlling not only the invasive behaviour of BCC through regulating invadopodia and 3D migration, but also other alterations in the phenotype of these cells that are necessary for different stages of tumour progression.

Please cite this article in press as: García, E., et al., WIP is necessary for matrix invasion by breast cancer cells. Eur. J. Cell Biol. (2014), http://dx.doi.org/10.1016/j.ejcb.2014.07.008

427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492

G Model EJCB 50788 1–11

ARTICLE IN PRESS E. García et al. / European Journal of Cell Biology xxx (2014) xxx–xxx

9

Fig. 6. WIP deficiency modifies the expression of epithelial and mesenchymal markers. (A) Representative WB shows E-cadherin expression after WIP overexpression in T47D cells. (B) Images of cultured MDA-MB-231 cells stably infected with shControl or various shWIP. (C) Representative images of cells grown on glass (24 h), fixed in 4% PFA and stained by IF for tyrosinated-tubulin (Tyr-Tub, green) and F-actin (red). MCF-7 cells are included as a positive control for epithelial morphology. Bars: 25 ␮m. (D) Representative WB in which levels of WIP, E-cadherin, ␤-catenin and GAPDH proteins in shControl and shWIP are shown (total cell lysates, 30 ␮g/lane). (E) Stably infected MDA-MB-231 cells stained by IF with antibody against the mesenchymal marker vimentin (pseudocolour in upper panels, green in lower panels) and F actin (red). Bars: 10 ␮m. (F) Quantification of vimentin fluorescence intensity (CTCF) is shown as mean ± SD. * P < 0.05 by Student’s t test.

Please cite this article in press as: García, E., et al., WIP is necessary for matrix invasion by breast cancer cells. Eur. J. Cell Biol. (2014), http://dx.doi.org/10.1016/j.ejcb.2014.07.008

G Model EJCB 50788 1–11

E. García et al. / European Journal of Cell Biology xxx (2014) xxx–xxx

10 493

494

495

ARTICLE IN PRESS

Conflict of interest statement The authors declare no competing interests. Acknowledgements

˜ We thank S. Manes, A. Cuenda and I. Mérida (CNB-CSIC, 497 Madrid, Spain) for reagents. We thank X. Yu and H.J. Spence for help with 3D invasion assays. We thank M. O’Prey and Beatson 498 Advance Image Resource for help with imaging. IMA is supported 499 Q4 by the Spanish Ministry of Science and Innovation (BFU2010500 Q5 21374/BMC) and CIBERNED (Instituto de Salud Carlos III). IMA 501 and GEJ are both supported by the Medical Research Council 502 (G1100041) and GEJ is additionally funded for this study by 503 the European Union (FP7/2007-2013) under grant agreement no. 504 237946. LMM is funded by a core grant from Cancer Research 505 UK. EGG held a contract from the Comunidad Autónoma de 506 Madrid (CAM) and short-term fellowships from EMBO and the 507 CSIC. 508 496

509

510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566

References Anton, I.M., de la Fuente, M.A., Sims, T.N., Freeman, S., Ramesh, N., Hartwig, J.H., Dustin, M.L., Geha, R.S., 2002. WIP deficiency reveals a differential role for WIP and the actin cytoskeleton in T and B cell activation. Immunity 16, 193–204. Anton, I.M., Jones, G.E., Wandosell, F., Geha, R., Ramesh, N., 2007. WASP-interacting protein (WIP): working in polymerisation and much more. Trends Cell Biol. 17, 555–562. Banon-Rodriguez, I., Monypenny, J., Ragazzini, C., Franco, A., Calle, Y., Jones, G.E., Anton, I.M., 2011. The cortactin-binding domain of WIP is essential for podosome formation and extracellular matrix degradation by murine dendritic cells. Eur. J. Cell Biol. 90, 213–223. Banon-Rodriguez, I., Saez de Guinoa, J., Bernardini, A., Ragazzini, C., Fernandez, E., Carrasco, Y.R., Jones, G.E., Wandosell, F., Anton, I.M., 2013. WIP regulates persistence of cell migration and ruffle formation in both mesenchymal and amoeboid modes of motility. PLoS One 8, e70364. Beckmann, M.W., Niederacher, D., Schnurch, H.G., Gusterson, B.A., Bender, H.G., 1997. Multistep carcinogenesis of breast cancer and tumour heterogeneity. J. Mol. Med. (Berl.) 75, 429–439. Blick, T., Widodo, E., Hugo, H., Waltham, M., Lenburg, M.E., Neve, R.M., Thompson, E.W., 2008. Epithelial mesenchymal transition traits in human breast cancer cell lines. Clin. Exp. Metastasis 25, 629–642. Brown, K.A., Aakre, M.E., Gorska, A.E., Price, J.O., Eltom, S.E., Pietenpol, J.A., Moses, H.L., 2004. Induction by transforming growth factor-beta1 of epithelial to mesenchymal transition is a rare event in vitro. Breast Cancer Res.: BCR 6, R215–R231. Calle, Y., Anton, I.M., Thrasher, A.J., Jones, G.E., 2008. WASP and WIP regulate podosomes in migrating leukocytes. J. Microsc. 231, 494–505. Charafe-Jauffret, E., Ginestier, C., Monville, F., Finetti, P., Adelaide, J., Cervera, N., Fekairi, S., Xerri, L., Jacquemier, J., Birnbaum, D., Bertucci, F., 2006. Gene expression profiling of breast cell lines identifies potential new basal markers. Oncogene 25, 2273–2284. Choi, H.N., Kim, K.R., Lee, J.H., Park, H.S., Jang, K.Y., Chung, M.J., Hwang, S.E., Yu, H.C., Moon, W.S., 2009. Serum response factor enhances liver metastasis of colorectal carcinoma via alteration of the E-cadherin/beta-catenin complex. Oncol. Rep. 21, 57–63. Clark, E.S., Whigham, A.S., Yarbrough, W.G., Weaver, A.M., 2007. Cortactin is an essential regulator of matrix metalloproteinase secretion and extracellular matrix degradation in invadopodia. Cancer Res. 67, 4227–4235. de la Fuente, M.A., Sasahara, Y., Calamito, M., Anton, I.M., Elkhal, A., Gallego, M.D., Suresh, K., Siminovitch, K., Ochs, H.D., Anderson, K.C., Rosen, F.S., Geha, R.S., Ramesh, N., 2007. WIP is a chaperone for Wiskott-Aldrich syndrome protein (WASP). Proc. Nat. Acad. Sci. U.S.A. 104, 926–931. Franco, A., Knafo, S., Banon-Rodriguez, I., Merino-Serrais, P., Fernaud-Espinosa, I., Nieto, M., Garrido, J.J., Esteban, J.A., Wandosell, F., Anton, I.M., 2012. WIP is a negative regulator of neuronal maturation and synaptic activity. Cereb. Cortex 22, 1191–1202. Friedl, P., Wolf, K., 2008. Tube travel: the role of proteases in individual and collective cancer cell invasion. Cancer Res. 68, 7247–7249. Gallego, M.D., de la Fuente, M.A., Anton, I.M., Snapper, S., Fuhlbrigge, R., Geha, R.S., 2006. WIP and WASP play complementary roles in T cell homing and chemotaxis to SDF-1alpha. International immunology 18, 221–232. Garcia, E., Jones, G.E., Machesky, L.M., Anton, I.M., 2012. WIP: WASP-interacting proteins at invadopodia and podosomes. Eur. J. Cell. Biol. 91, 869–877. Gu, X., Zerbini, L.F., Otu, H.H., Bhasin, M., Yang, Q., Joseph, M.G., Grall, F., Onatunde, T., Correa, R.G., Libermann, T.A., 2007. Reduced PDEF expression increases invasion and expression of mesenchymal genes in prostate cancer cells. Cancer Res. 67, 4219–4226.

Hennigan, R.F., Hawker, K.L., Ozanne, B.W., 1994. Fos-transformation activates genes associated with invasion. Oncogene 9, 3591–3600. Janmey, P.A., Wells, R.G., Assoian, R.K., McCulloch, C.A., 2013. From tissue mechanics to transcription factors. Differentiation 86, 112–120. Kenny, P.A., Lee, G.Y., Myers, C.A., Neve, R.M., Semeiks, J.R., Spellman, P.T., Lorenz, K., Lee, E.H., Barcellos-Hoff, M.H., Petersen, O.W., Gray, J.W., Bissell, M.J., 2007. The morphologies of breast cancer cell lines in three-dimensional assays correlate with their profiles of gene expression. Mol. Oncol. 1, 84–96. Kim, A.S., Kakalis, L.T., Abdul-Manan, N., Liu, G.A., Rosen, M.K., 2000. Autoinhibition and activation mechanisms of the Wiskott-Aldrich syndrome protein. Nature 404, 151–158. Kinley, A.W., Weed, S.A., Weaver, A.M., Karginov, A.V., Bissonette, E., Cooper, J.A., Parsons, J.T., 2003. Cortactin interacts with WIP in regulating Arp2/3 activation and membrane protrusion. Curr. Biol.: CB 13, 384–393. Kwon, C.Y., Kim, K.R., Choi, H.N., Chung, M.J., Noh, S.J., Kim, D.G., Kang, M.J., Lee, D.G., Moon, W.S., 2010. The role of serum response factor in hepatocellular carcinoma: implications for disease progression. Int. J. Oncol. 37, 837–844. Lacroix, M., Leclercq, G., 2004. Relevance of breast cancer cell lines as models for breast tumours: an update. Breast Cancer Res. Treat. 83, 249–289. Lanzardo, S., Curcio, C., Forni, G., Anton, I.M., 2007. A role for WASP interacting protein, WIP, in fibroblast adhesion, spreading and migration. Int. J. Biochem. Cell Biol. 39, 262–274. Le Bras, S., Massaad, M., Koduru, S., Kumar, L., Oyoshi, M.K., Hartwig, J., Geha, R.S., 2009. WIP is critical for T cell responsiveness to IL-2. Proc. Nat. Acad. Sci. U.S.A. 106, 7519–7524. Li, A., Dawson, J.C., Forero-Vargas, M., Spence, H.J., Yu, X., Konig, I., Anderson, K., Machesky, L.M., 2010. The actin-bundling protein fascin stabilizes actin in invadopodia and potentiates protrusive invasion. Curr. Biol.: CB 20, 339–345. Linder, S., Wiesner, C., Himmel, M., 2011. Degrading devices: invadosomes in proteolytic cell invasion. Annu. Rev. Cell Dev. Biol. 27, 185–211. Martinez-Quiles, N., Rohatgi, R., Anton, I.M., Medina, M., Saville, S.P., Miki, H., Yamaguchi, H., Takenawa, T., Hartwig, J.H., Geha, R.S., Ramesh, N., 2001. WIP regulates N-WASP-mediated actin polymerization and filopodium formation. Nat. Cell Biol. 3, 484–491. Miki, H., Sasaki, T., Takai, Y., Takenawa, T., 1998. Induction of filopodium formation by a WASP-related actin-depolymerizing protein N-WASP. Nature 391, 93–96. Neve, R.M., Chin, K., Fridlyand, J., Yeh, J., Baehner, F.L., Fevr, T., Clark, L., Bayani, N., Coppe, J.P., Tong, F., Speed, T., Spellman, P.T., DeVries, S., Lapuk, A., Wang, N.J., Kuo, W.L., Stilwell, J.L., Pinkel, D., Albertson, D.G., Waldman, F.M., McCormick, F., Dickson, R.B., Johnson, M.D., Lippman, M., Ethier, S., Gazdar, A., Gray, J.W., 2006. A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell 10, 515–527. Peglion, F., Llense, F., Etienne-Manneville, S., 2014. Adherens junction treadmilling during collective migration. Nat. Cell Biol. 16, 639–651. Prehoda, K.E., Scott, J.A., Mullins, R.D., Lim, W.A., 2000. Integration of multiple signals through cooperative regulation of the N-WASP-Arp2/3 complex. Science 290, 801–806. Ramesh, N., Massaad, M.J., Kumar, L., Suresh, K., Sasahara, Y., Anton, I., Bhasin, M., Libermann, T., Geha, R., 2014. Binding of the WASP/N-WASP interacting protein WIP to actin regulates focal adhesion assembly and adhesion. Mol. Cell. Biol. 34, 2600–2610. Reffay, M., Parrini, M.C., Cochet-Escartin, O., Ladoux, B., Buguin, A., Coscoy, S., Amblard, F., Camonis, J., Silberzan, P., 2014. Interplay of RhoA and mechanical forces in collective cell migration driven by leader cells. Nat. Cell Biol. 16, 217–223. Sasahara, Y., Rachid, R., Byrne, M.J., de la Fuente, M.A., Abraham, R.T., Ramesh, N., Geha, R.S., 2002. Mechanism of recruitment of WASP to the immunological synapse and of its activation following TCR ligation. Mol. Cell 10, 1269–1281. Savagner, P., 2001. Leaving the neighborhood: molecular mechanisms involved during epithelial–mesenchymal transition. BioEssays 23, 912–923 (news and reviews in molecular, cellular and developmental biology). Savagner, P., Boyer, B., Valles, A.M., Jouanneau, J., Thiery, J.P., 1994. Modulations of the epithelial phenotype during embryogenesis and cancer progression. Cancer Treat Res. 71, 229–249. Scheel, C., Eaton, E.N., Li, S.H., Chaffer, C.L., Reinhardt, F., Kah, K.J., Bell, G., Guo, W., Rubin, J., Richardson, A.L., Weinberg, R.A., 2011. Paracrine and autocrine signals induce and maintain mesenchymal and stem cell states in the breast. Cell 145, 926–940. Staub, E., Groene, J., Heinze, M., Mennerich, D., Roepcke, S., Klaman, I., Hinzmann, B., Castanos-Velez, E., Pilarsky, C., Mann, B., Brummendorf, T., Weber, B., Buhr, H.J., Rosenthal, A., 2009. An expression module of WIPF1-coexpressed genes identifies patients with favorable prognosis in three tumor types. J. Mol. Med. (Berl.) 87, 633–644. Takebe, N., Warren, R.Q., Ivy, S.P., 2011. Breast cancer growth and metastasis: interplay between cancer stem cells, embryonic signaling pathways and epithelial-to-mesenchymal transition. Breast Cancer Res.: BCR 13, 211. Van Audenhove, I., Boucherie, C., Pieters, L., Zwaenepoel, O., Vanloo, B., Martens, E., Verbrugge, C., Hassanzadeh-Ghassabeh, G., Vandekerckhove, J., Cornelissen, M., De Ganck, A., Gettemans, J., 2014. Stratifying fascin and cortactin function in invadopodium formation using inhibitory nanobodies and targeted subcellular delocalization. FASEB J. (official publication of the Federation of American Q6 Societies for Experimental Biology). Yamaguchi, H., Lorenz, M., Kempiak, S., Sarmiento, C., Coniglio, S., Symons, M., Segall, J., Eddy, R., Miki, H., Takenawa, T., Condeelis, J., 2005. Molecular mechanisms of invadopodium formation: the role of the N-WASP-Arp2/3 complex pathway and cofilin. J. Cell Biol. 168, 441–452.

Please cite this article in press as: García, E., et al., WIP is necessary for matrix invasion by breast cancer cells. Eur. J. Cell Biol. (2014), http://dx.doi.org/10.1016/j.ejcb.2014.07.008

567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652

G Model EJCB 50788 1–11

ARTICLE IN PRESS E. García et al. / European Journal of Cell Biology xxx (2014) xxx–xxx

653 654 655 656

Yamaguchi, H., Oikawa, T., 2010. Membrane lipids in invadopodia and podosomes: key structures for cancer invasion and metastasis. Oncotarget 1, 320– 328. Zhao, M., Xu, H., He, X., Hua, H., Luo, Y., Zuo, L., 2013. Expression of serum response factor in gastric carcinoma and its molecular mechanisms involved in the

11

regulation of the invasion and migration of SGC-7901 cells. Cancer Biother. Radiopharm. 28, 146–152. Zufferey, R., Nagy, D., Mandel, R.J., Naldini, L., Trono, D., 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat. Biotechnol. 15, 871–875.

Please cite this article in press as: García, E., et al., WIP is necessary for matrix invasion by breast cancer cells. Eur. J. Cell Biol. (2014), http://dx.doi.org/10.1016/j.ejcb.2014.07.008

657 658 659 660 661