American Journal of Pathology. Vol. 136, No. 6, June 1990 Copyright ) American Associatiotn ofPathologists
Western Thymomas Lack Epstein-Barr Virus by Southern Blotting Analysis and by Polymerase Chain Reaction
Giorgio Inghirami, Marco Chilosi, and Daniel M. Knowles Fronm the Division of Surgical Pathology, Department of Pathology, Columbia University College ofPhysicians and Surgeons, New York, New York; anid Istituto diAniatomia Patologica, Universita di Veronta, Italy
The authors investigated 16 western thymomas, 9 from the United States and 7 from Europe, for the presence of Epstein-Barr virus (EBV) DNA sequences by both Southern blot hybridization analysis and polymerase chain reaction using EBV-specific DNA probes that detect the long internal repeat and terminal repeat regions and the EBNA- I gene. None of the 16 thymomas contained evidence of the EBVgenome, even though we could detect EBV by Southern blotting when EBV DNA represents .1% of the total DNA and by polymerase chain reaction when a single EBV-positive cell is present among 105 EBV-negative cells. These resultsfail to demonstrate EBVgenome in western thymomas and stand in contrast to those of McGuire et al (Am J Pathol 1988, 131:385) who previously reported that the EBV genome is present in thymomas occurring in southern Chinese patients. Therefore EBV does not appear to be implicated in the pathogenesis of all thymomas. The presence of EBV in eastern thymomas, regions where EBV is endemic, may be due to epidemiologic factors and/or genetic predispositions. (AmJPathol 1990, 136:1429-1436)
quences similar to those occurring within the normal thymus.1,35 In this regard, it has been recently demonstrated that the thymocytes present within thymomas represent polyclonal T cell populations that have undergone productive T-cell receptor (TCR) gene rearrangement and normally express TCR gene products on their cell mem-
branes.6'7 Recently it was suggested that EBV infection may play a role in the pathogenesis of neoplasms derived from thymic epithelium.8-10 The serologic profiles and the presence of the EBV genome observed in some cases of thymoma and thymic carcinoma are consistent with this hypothesis.6 10 On the basis of these observations, it has been proposed that thymomas should be included among the EBV-related epithelial neoplasms, together with nasopharyngeal carcinoma, malignant lymphoepithelial lesions of the salivary gland, palatine tonsil carcinoma, and so on.10 However the EBV genome has been demonstrated in thymomas occurring only in southern Chinese patients reported from Hong Kong so far, and data from other geographic areas is lacking. Therefore we examined 16 western thymomas, 9 from the United States and 7 from Europe, which had been well characterized histopathologically and immunohistochemically for the presence of EBV DNA using Southern blot hybridization analysis and polymerase chain reaction to confirm or deny the role of EBV in the pathogenesis of western thymomas.
Materials and Methods Thymoma Specimens
Recent immunophenotypic and antigen receptor gene rearrangement studies have provided a considerable amount of new information concerning human thymomas. These studies have confirmed that thymomas are epithelial neoplasms with cortical thymic epithelium representing the neoplastic cell component in most cases.` The lymphocytes that are characteristically admixed with the neoplastic epithelial cells in most thymomas are not 'reactive' mature T lymphocytes, as formerly suggested.4 Rather they are actively proliferating, immature TdT+CD1 + thymocytes that undergo maturation se-
Thymomas were collected from 16 patients, 9 from the Columbia-Presbyterian Medical Center in New York City and 7 from the University of Verona Medical Center in VeSupported in part by grants EY06337 and CA48236 from the National Institutes of Health, Bethesda, Maryland, awarded to Dr. Knowles. Accepted for publication February 7, 1990. Address reprint requests to Dr. Daniel M. Knowles, Columbia University, College of Physicians and Surgeons, Department of Pathology, 630 West 168th Street, New York, NY 10032.
1429
1430
lnghirami, Chilosi, and Knowles
AJPJune 1990, Vol. 136, No. 6
rona, Italy, during the course of standard diagnostic evaluation. The patients ranged in age from 42 to 76 years (median, 59 years). Six of the sixteen patients had myasthenia gravis. Representative portions of each thymoma were routinely processed for histopathology. Additional representative portions of each thymoma were snap frozen in liquid nitrogen or a mixture of isopentane and dry ice and cryopreserved at -70°C. The epithelial and lymphoid components of each thymoma were analyzed with an extensive panel of monoclonal antibodies in cryostat and paraffin tissue sections using previously described immunohistochemical techniques.5 The monoclonal antibody panel included AE1, AE3 (Hybritech Inc., San Diego, CA), MR3,11 RFD4,2 Leul (CD5), Leu9 (CD7) (Becton Dickinson, Mountain View CA), OKT3 (CD3), OKT4 (CD4), OKT6 (CD1), OKT8 (CD8), OKT9 (CD71), OKT1 0 (CD38), OKT1 1 (CD2) (Ortho Diagnostics, Raritan NJ), Bi (CD20), B4 (CD1 9) (Coulter, Hialeah FL), TdT (Bethesda Research Laboratory, Bethesda, MD), flF1 (T Cell Sciences, Inc., Cambridge, MA), BL-9 (CD22), HLA-DR, and IL2-R (CD25) (United Biomedical, Lake Success, NY).
Nucleic Acid Analysis High molecular weight DNA was extracted and purified from the cryopreserved blocks of tissue representative of each thymoma by sodium dodecyl sulfate-proteinase K digestion, extraction with phenolchloroform, and ethanol precipitation, as previously described.12 Fifteen micrograms of the DNA were digested with various appropriate restriction endonucleases (Boehringer-Mannheim, Indianapolis, IN), according to the manufacturer's instructions, electrophoresed in 0.8% agarose gel, denatured, neutralized, transferred to a nitrocellulose filter, and hybridized according to Southern13 as previously described.14 DNA clones were 32P-labeled by random priming15 for use as probes. The presence of EBV sequences was investigated by hybridization of BamHl-digested DNAs to the long internal repeat and to the terminal repeat probes (BamHI-W/V16 kindly provided by Dr. E. Kieff and BamHI-Eco RI, Xhol 1,9,17 kindly provided by Dr. J. Sklar), respectively. The Tcell receptor beta chain (TCR,B) gene was investigated by hybridization of Eco RI and BamHl-digested DNAs to a DNA probe that hybridizes to the constant region (C,61 and C#2) of the TCRf gene.18 The immunoglobulin heavychain (IgH) gene was analyzed by hybridization of Eco RI and HindIll-digested DNAs to an immunoglobulin heavychain gene-joining region (JH) probe.19 A Burkift cell line (Daudi) and an EBV-infected B-cell lymphoblastoid cell line (M-1) served as monoclonal and oligoclonal EBV positive controls, respectively. DNAs were analyzed using the polymerase chain reaction (PCR) as previously described.20 Specific primers
and probes were synthesized on published DNA se-
quences16 corresponding to the BMRF-1 region [5' primer (sense); 110204-110223: CTCAACGTGGTCTCCTTCTT; 3' primer (antisense); 110408-110427: AGGAGATTGGTGTGAAAGGA]. All of the samples were also amplified with MYC (Exl-lnt-1) primers [5' primer (sense); 28032822: CTGCCAGGACCCGCTTCTCT; 3' primer (antisense); and 3061-3041: TTTACCCCGATCCAGTTCTG]21 to insure that the DNAs did not contain PCR inhibitors. Polymerase chain reaction mixtures contained 1 yg of genomic DNA, 50 mmol/l (molar) KCL, 10 mmol/l TRIS (pH 8.3), 1.5 mmol/l MgCI2, 20 pmol/l (picomolar) of each primer, 200 Mmol/l (micromolar) of each dNTP (dATP, dCTP, dTTP, and dGTP), gelatin 100 jg/ml, and one U of thermostable Taq polymerase (Cetus Corp., Norwalk, CT) in a final volume of 50 MI. The amplifications were carried out using a thermostable DNA polymerase and an automated temperature cycling device (Perkin-Elmer-Cetus), as previously described.Y0 Briefly, 30 cycles of denaturation, annealing, and extension at 940C, 550C, and 720C, respectively, were performed on automated heat block according to manufacturer's specifications. The analysis of the amplified DNAs was performed using one tenth of the amplified DNA by slot blot and/or Southern blot and hybridized to 32P-end-labeled probes [for BMRF-1 EBV region 5'; 110331-110350 GTGCCAACTTAAACAGATAC; for myc gene 5'; 2872-2891: GGTGCTTACCTGGTTTTCCA] as previously described.20 Briefly, 5 Ml aliquots of each PCR mixture were transferred to replicate nylon filter with a slot manifold (Scleicher & Schuell, Keene, NH) and hybridized to synthetic oligonucleotide probes labeled with y-[32P] ATP (specific activity 3000 Ci/mmol) by means of T4-polynucleotide kinase (New England Biol Labs, Boston, MA) and separated from unincorporated nucleotides through a Bio-Gel P4 fine column (Bio-Rad Laboratories, Richmond, CA). Prehybridization, hybridization, and washing of filters were performed in a 3 mol/ (molar) tetramethyl ammonium chloride salt solution as described.22 The Namalwa Burkitt lymphoma and HL60 cell lines were used as EBV-positive and -negative controls, respectively.
Results Each of the 16 pathologic specimens exhibited histopathologic characteristics consistent with thymoma. Each neoplasm was composed of a network of epithelial cells, without cytologic atypia and with minimal mitotic activity, on which a variable number of small to intermediate sized, benign appearing lymphocytes were superimposed. The neoplastic epithelial cells comprising each thymoma exhibited strong immunohistochemical reactivity with monoclonal antibodies specific for cytokeratin and the MR3 antigen but lacked reactivity for RFD4. The lymphoid com-
Western Thymomas Lack EBV
1431
AJPJune 1990, Vol. 136, No. 6
1
A
2
3
4
5
6
7
8
9
10
12kb-
2.1kb-
EcoRI
1
B
2
3
4
5
6
7
8
9
10
11 kb-
Hindlill Figure 1. Seven representative thymoma DNAs (A, B, lanes 1- 7) were digested u'ith EcoRI (A) and Hind III (B) restriction enzymes, electrophoresed, blotted, and hybridized with 32P-labeled 7)3 andJH probes. Daudi, M-1 and HL-60 cell line DNAs (A, B, lanes 8-10, respectively) were used aspositive and negative controls, for EBVgenome. All of the EcoRI digested thymoma samplesshow detectable 12-Kb bandsand no clonal Tcell receptorgene rearrangements uhen investigated u'ith32p labeled 713 probe. The extra bandsseen in lanes 4, 5, 7, 8, and9 have been previously reported.22 Thbe represent cross hybridization to unkniownt TCGR gene-related sequences. Furthermore, none of the thymoma samples exhibited detectable immunoglobulin gene rearranigement bands afterJH probing. On the other hand, Daudi and M-1 exhibited one (B, lane 8) and two (B, lane 9) immunoglobulin heavy chain gene rearrangement bands, respectivel, demonstrating the monoclonality anid oligoclonalitjy of these two cell linies (see arrows).
ponent in each thymoma expressed immunophenotypic profiles consistent with cortical thymocytes. The majority of the lymphoid cells in each thymoma expressed TDT, CD7, CD2, fF1, CD3, CD5, CD1, and CD38. In addition, a variable number of lymphoid cells in each thymoma expressed CD71 and CD4 and/or CD8. B cells, based on the expression of CD19, CD20, and CD22, were almost entirely absent. The DNAs extracted and purified from each of the 16 thymomas were initially investigated by TCR# gene rearrangement analysis to determine the presence or absence of clonal T-cell populations. None of the 16 thymomas exhibited clonal TCRJ3 gene rearrangements, consistent with polyclonal thymocyte populations. Furthermore, a 12-kb band was evident in each of the 16 thymoma samples on hybridization of Eco RI-digested DNA to the TCRf3 gene probe (Figure 1, panel A, lanes 1 to 7). As previously reported, polyclonal thymocytes isolated and purified from normal thymus or thymomas by cell suspension techniques, and therefore depleted of thymic epithe-
lial cells, do not exhibit the 12-kb band on hybridization of Eco RI-digested DNA to the TCRp probe.23 The presence of the Eco RI 12-kb band in the DNAs extracted and purified from cryopreserved tissue blocks of each of these 16 thymomas indicates the presence of a considerable nonT-cell DNA component, most likely thymic epithelial cell DNA, in each sample. Furthermore, to exclude the presence of clonal B-cell populations, Eco Rl- and Hindlll-digested DNAs representative of each of the 16 thymoma samples were also analyzed by hybridization to the JH probe. None of the 16 thymomas exhibited clonal immunoglobulin heavy-chain gene rearrangements (Figure 1, panel B, lanes 1 to 8). The Daudi Burkitt's cell line and an EBV-infected B-lymphoblastoid cell line (Ml) served as monoclonal and oligoclonal positive controls, respectively (Figure 1, panel B, lanes 9 to 10). Each of the 16 thymomas were investigated for the presence of EBV sequences using probes specific for the long internal direct repeat (Bam-W/V) and EBV termini (Xhol 1,9). These probes recognize sequences repeated
1432
Inghirami, Chilosi, and Knowles
A/P.june 1990, Vol. 136, No. 6
1
2
3
4
5
6
7
8
9
3kbBamHI Figure 2. Dauidi cell line DNA (from 100 to 0%, lanie 1:100%, lanie 2:50%, lante 3:25%, lanie 4:10%, lane 5:5%, lante 6:2.5%, lanie 7: 1.25%, lane 8:0.5%, lanie 9:0%) uas mixed uitb PIIIA-stimulated humani lymphocyte DNA (from 0 to 100%) to a total of 15 jig DNA/ samples. DNAs were digested with l3anmHI restrictioni enzyme and hybridized uith 32P-labeled Baam W-Vprobe. Films were exposed J]b 3 hoiurs at -70' C anid thbeI developed. The results indicate that the presence of EBV genome can be unequivocally detected wbhen onlly 0. 5% oJlthe total DNA consists of Dauidi FBV DNA (lanie 8).
at least 5 to 10 times of 3000 and 500 base pairs each, respectively.16 We first evaluated the number of copies of EBV that are detectable in Daudi cells using the long internal repeat probe because each Daudi cell contains 224 EBV copies and it is possible to calculate the minimum number of copies detectable using Southern blot analysis. Daudi DNA was mixed with variable amounts of DNA obtained from purified, PHA-stimulated normal T lymphocytes, digested with BamHl, blotted, and hybridized to the Bam-W/V probe. A positive signal, after 3 hours of exposure, was detectable when only 0.5% of the total DNA was represented by Daudi DNA (Figure 2, lane 8). Therefore these data indicate that 0.9 EBV genomic DNA copies per cell can be detected using this technique. However, when the thymomas were investigated for the presence of EBV sequences using Southern blot analysis, no detectable signal was present, even after 7 days exposure, using both the Bam-W/V and the termini probes (Figure 3, lanes 1 to 7). Both the Daudi and Ml lymphoblastoid cell lines exhibited positive signals when hybridized to the long internal repeat and termini probes after only 1 hour exposure (Figure 3, lanes 8 and 9, panels A and B, respectively). Furthermore, the Daudi Burkitt's cell line displayed a single band and the Ml lymphoblastoid cell line displayed three distinct bands when the termini probe was applied (Figure 3, lanes 8 and 9, panel B), indicating that Dandi and Ml lymphoblastoid cell lines contain one and three polyclonal EBV-infected subpopulations,
respectively. To confirm these findings using a more sensitive approach, we applied a PCR to detect EBV sequences. Namalwa Burkitt lymphoma DNA, which contains two integrated copies of the EBV genome for each cell,24 was used as a positive control. One microgram of purified Namalwa DNA was amplified by PCR using 10 to 50 cycles. Epstein-Barr virus sequences were detected after 20 cycles (data not shown). Namalwa DNA was mixed with HL60 EBV-negative DNA to evaluate the sensitivity of
PCR to detect EBV-infected cells among EBV-negative cells. A positive signal was present when only 10 ng of EBV-positive DNA was present. This indicates that a single EBV-positive cell among 105 EBV-negative cells can be detected in this system (data not shown). Nonetheless, once again none of the 16 thymomas exhibited evidence of the presence of EBV sequences when investigated by PCR (Figure 4, panel A, lanes 1 to 16). Namalwa (100 ng) and HL60 (1 ,ug) cell lines served as positive and negative EBV DNA controls (Figure 4, panel A, lanes 17 and 18), respectively. Finally, these DNAs were also amplified using a c-myc primer specific for the first exon (Figure 4, panel B, lanes 1 to 16) to exclude the presence of inhibitors of the PCR in the thymoma samples.
Discussion Human thymomas are neoplasms of thymic epithelial origin that frequently contain variable numbers of benign, polyclonal thymocytes (immature T cells) assembled to mimic the organization and cell distribution observed in the normal human thymus. The biologic relationships that exist between neoplastic thymic epithelial cells and benign T lymphocytes are incompletely understood. However, we recently demonstrated that neoplastic thymic epithelial cells, which synthesize thymic hormones,25 may actively control the differentiation and proliferation of precursor T cells.257 On the other hand, neoplastic thymic epithelial cells often appear to be immunologically incompetent.26 In this context, they may be responsible for an abnormal thymic microenvironment in which handicapped T-cell clones are generated.27 Such handicapped T lymphocytes may be involved in the pathogenesis of the autoimmune diseases that are frequently associated with thymomas.428 31 Even less is known concerning the pathogenesis of thymomas. In this regard, however, several authors have
Western Thymomas Lack EBV
1433
AJPJune 1990, Vol. 136, No. 6
A 1
2
3
4
5
6
7
8
9
10
3kbBamHI
B 1 1
2
3
4
5
6
7
8
9
10
Okb-
BamHI Figure 3. Seven representative thymoma (lanes 1- 7) and Daudi, M-1 and HL-60 cell line (lanes 8, 9 and 10, respectively) DNAs were digested with BamHI and probed with the Bam W/V(A) and termini (B) probes. Detectable signals for EBVsequences are only preseint in lanes 8 and 9 containinlg Daudi and M-1 DNAs and not in any thymoma DNAs. Furthermore, when the termini probes were applied, otne and three bands were identified in the Daudi and M- 1 DNAs, respectively. These data indicate that Daudi and M- 1 cell lines are monoclonial and oligoclonalfor EBVgenomes, respectively.
recently demonstrated the presence of EBV genomes in thymomas, thymic carcinomas, and hyperplastic thymus.8 10 Epstein-Barr virus, the etiologic agent of infectious mononucleosis,32 has been implicated in the pathogenesis of a variety of neoplasms, including Burkitt lymphoma,33 nasopharyngeal carcinoma,3435 and malignant lymphoepithelial neoplasms of the parotid salivary gland.36 Interestingly, nasopharyngeal, parotid gland, and thymic epithelium have a common embryologic derivation from the primitive pharynx. This may explain the peculiar tropism of EBV for these different target cells. Further-
1
more, EBV preferentially binds to and infects cells that express the C3d cell-surface receptor that also serves as the EBV receptor on human cells.37 The C3d/EBV receptor has been demonstrated in human B lymphocytes37 and in nasopharyngeal epithelium,38 but is not expressed by normal or neoplastic thymic epithelial cells (Chilosi, unpublished data). The recent report indicating that EBV may play a contributory role in the pathogenesis of thymic epithelial neoplasms occurring in patients from southern China prompted us to investigate whether the high incidence of
2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
A
EBV 1
2 3 4 5 6 7 8 9 10
11 12 13 14 15 16 17 18
B
myc Figure 4. Sixteetn thymomas (lanes 1-16) and Namalwa and HL-60 (lanes 17, 18, respectiively) DNAs were amplified using EBV(A) and myc (B) oligoprimers as described aboi'e. Onfe tenth of the amplified DNAs were blotted and hybridized with specific 32P-labeled EBV (110331-110350)i6 and myc (2872-2891)' oligoprobes. Thefilms were developed after 1-hour exposure at -70' C Only Namalua DNA was positive for the pre,sence ofEBVsequences. However, all the DNAs could be efficiently amplified when myc oliprimers were used.
1434
Inghirami, Chilosi, and Knowles
AJPJune 1990, Vol. 136, No. 6
EBV genome in thymomas is a general phenomenon or is confined to that particular region. Therefore we investigated the presence of the EBV genome in 16 thymomas occurring in two different western regions, New York City, United States, and Verona, Italy, using Southern blot hybridization analysis and PCR, which provides a highly sensitive method for the detection of specific EBV DNA sequences. To exclude the presence of EBV-infected clonal B-cell populations as a major source of EBV DNA, we performed immunohistochemical staining and immunoglobulin gene rearrangement analysis. These studies confirmed that B lymphocytes always represented a minute subpopulation (
Western Thymomas Lack Epstein-Barr Virus by Southern Blotting Analysis and by Polymerase Chain Reaction
Giorgio Inghirami, Marco Chilosi, and Daniel M. Knowles Fronm the Division of Surgical Pathology, Department of Pathology, Columbia University College ofPhysicians and Surgeons, New York, New York; anid Istituto diAniatomia Patologica, Universita di Veronta, Italy
The authors investigated 16 western thymomas, 9 from the United States and 7 from Europe, for the presence of Epstein-Barr virus (EBV) DNA sequences by both Southern blot hybridization analysis and polymerase chain reaction using EBV-specific DNA probes that detect the long internal repeat and terminal repeat regions and the EBNA- I gene. None of the 16 thymomas contained evidence of the EBVgenome, even though we could detect EBV by Southern blotting when EBV DNA represents .1% of the total DNA and by polymerase chain reaction when a single EBV-positive cell is present among 105 EBV-negative cells. These resultsfail to demonstrate EBVgenome in western thymomas and stand in contrast to those of McGuire et al (Am J Pathol 1988, 131:385) who previously reported that the EBV genome is present in thymomas occurring in southern Chinese patients. Therefore EBV does not appear to be implicated in the pathogenesis of all thymomas. The presence of EBV in eastern thymomas, regions where EBV is endemic, may be due to epidemiologic factors and/or genetic predispositions. (AmJPathol 1990, 136:1429-1436)
quences similar to those occurring within the normal thymus.1,35 In this regard, it has been recently demonstrated that the thymocytes present within thymomas represent polyclonal T cell populations that have undergone productive T-cell receptor (TCR) gene rearrangement and normally express TCR gene products on their cell mem-
branes.6'7 Recently it was suggested that EBV infection may play a role in the pathogenesis of neoplasms derived from thymic epithelium.8-10 The serologic profiles and the presence of the EBV genome observed in some cases of thymoma and thymic carcinoma are consistent with this hypothesis.6 10 On the basis of these observations, it has been proposed that thymomas should be included among the EBV-related epithelial neoplasms, together with nasopharyngeal carcinoma, malignant lymphoepithelial lesions of the salivary gland, palatine tonsil carcinoma, and so on.10 However the EBV genome has been demonstrated in thymomas occurring only in southern Chinese patients reported from Hong Kong so far, and data from other geographic areas is lacking. Therefore we examined 16 western thymomas, 9 from the United States and 7 from Europe, which had been well characterized histopathologically and immunohistochemically for the presence of EBV DNA using Southern blot hybridization analysis and polymerase chain reaction to confirm or deny the role of EBV in the pathogenesis of western thymomas.
Materials and Methods Thymoma Specimens
Recent immunophenotypic and antigen receptor gene rearrangement studies have provided a considerable amount of new information concerning human thymomas. These studies have confirmed that thymomas are epithelial neoplasms with cortical thymic epithelium representing the neoplastic cell component in most cases.` The lymphocytes that are characteristically admixed with the neoplastic epithelial cells in most thymomas are not 'reactive' mature T lymphocytes, as formerly suggested.4 Rather they are actively proliferating, immature TdT+CD1 + thymocytes that undergo maturation se-
Thymomas were collected from 16 patients, 9 from the Columbia-Presbyterian Medical Center in New York City and 7 from the University of Verona Medical Center in VeSupported in part by grants EY06337 and CA48236 from the National Institutes of Health, Bethesda, Maryland, awarded to Dr. Knowles. Accepted for publication February 7, 1990. Address reprint requests to Dr. Daniel M. Knowles, Columbia University, College of Physicians and Surgeons, Department of Pathology, 630 West 168th Street, New York, NY 10032.
1429
1430
lnghirami, Chilosi, and Knowles
AJPJune 1990, Vol. 136, No. 6
rona, Italy, during the course of standard diagnostic evaluation. The patients ranged in age from 42 to 76 years (median, 59 years). Six of the sixteen patients had myasthenia gravis. Representative portions of each thymoma were routinely processed for histopathology. Additional representative portions of each thymoma were snap frozen in liquid nitrogen or a mixture of isopentane and dry ice and cryopreserved at -70°C. The epithelial and lymphoid components of each thymoma were analyzed with an extensive panel of monoclonal antibodies in cryostat and paraffin tissue sections using previously described immunohistochemical techniques.5 The monoclonal antibody panel included AE1, AE3 (Hybritech Inc., San Diego, CA), MR3,11 RFD4,2 Leul (CD5), Leu9 (CD7) (Becton Dickinson, Mountain View CA), OKT3 (CD3), OKT4 (CD4), OKT6 (CD1), OKT8 (CD8), OKT9 (CD71), OKT1 0 (CD38), OKT1 1 (CD2) (Ortho Diagnostics, Raritan NJ), Bi (CD20), B4 (CD1 9) (Coulter, Hialeah FL), TdT (Bethesda Research Laboratory, Bethesda, MD), flF1 (T Cell Sciences, Inc., Cambridge, MA), BL-9 (CD22), HLA-DR, and IL2-R (CD25) (United Biomedical, Lake Success, NY).
Nucleic Acid Analysis High molecular weight DNA was extracted and purified from the cryopreserved blocks of tissue representative of each thymoma by sodium dodecyl sulfate-proteinase K digestion, extraction with phenolchloroform, and ethanol precipitation, as previously described.12 Fifteen micrograms of the DNA were digested with various appropriate restriction endonucleases (Boehringer-Mannheim, Indianapolis, IN), according to the manufacturer's instructions, electrophoresed in 0.8% agarose gel, denatured, neutralized, transferred to a nitrocellulose filter, and hybridized according to Southern13 as previously described.14 DNA clones were 32P-labeled by random priming15 for use as probes. The presence of EBV sequences was investigated by hybridization of BamHl-digested DNAs to the long internal repeat and to the terminal repeat probes (BamHI-W/V16 kindly provided by Dr. E. Kieff and BamHI-Eco RI, Xhol 1,9,17 kindly provided by Dr. J. Sklar), respectively. The Tcell receptor beta chain (TCR,B) gene was investigated by hybridization of Eco RI and BamHl-digested DNAs to a DNA probe that hybridizes to the constant region (C,61 and C#2) of the TCRf gene.18 The immunoglobulin heavychain (IgH) gene was analyzed by hybridization of Eco RI and HindIll-digested DNAs to an immunoglobulin heavychain gene-joining region (JH) probe.19 A Burkift cell line (Daudi) and an EBV-infected B-cell lymphoblastoid cell line (M-1) served as monoclonal and oligoclonal EBV positive controls, respectively. DNAs were analyzed using the polymerase chain reaction (PCR) as previously described.20 Specific primers
and probes were synthesized on published DNA se-
quences16 corresponding to the BMRF-1 region [5' primer (sense); 110204-110223: CTCAACGTGGTCTCCTTCTT; 3' primer (antisense); 110408-110427: AGGAGATTGGTGTGAAAGGA]. All of the samples were also amplified with MYC (Exl-lnt-1) primers [5' primer (sense); 28032822: CTGCCAGGACCCGCTTCTCT; 3' primer (antisense); and 3061-3041: TTTACCCCGATCCAGTTCTG]21 to insure that the DNAs did not contain PCR inhibitors. Polymerase chain reaction mixtures contained 1 yg of genomic DNA, 50 mmol/l (molar) KCL, 10 mmol/l TRIS (pH 8.3), 1.5 mmol/l MgCI2, 20 pmol/l (picomolar) of each primer, 200 Mmol/l (micromolar) of each dNTP (dATP, dCTP, dTTP, and dGTP), gelatin 100 jg/ml, and one U of thermostable Taq polymerase (Cetus Corp., Norwalk, CT) in a final volume of 50 MI. The amplifications were carried out using a thermostable DNA polymerase and an automated temperature cycling device (Perkin-Elmer-Cetus), as previously described.Y0 Briefly, 30 cycles of denaturation, annealing, and extension at 940C, 550C, and 720C, respectively, were performed on automated heat block according to manufacturer's specifications. The analysis of the amplified DNAs was performed using one tenth of the amplified DNA by slot blot and/or Southern blot and hybridized to 32P-end-labeled probes [for BMRF-1 EBV region 5'; 110331-110350 GTGCCAACTTAAACAGATAC; for myc gene 5'; 2872-2891: GGTGCTTACCTGGTTTTCCA] as previously described.20 Briefly, 5 Ml aliquots of each PCR mixture were transferred to replicate nylon filter with a slot manifold (Scleicher & Schuell, Keene, NH) and hybridized to synthetic oligonucleotide probes labeled with y-[32P] ATP (specific activity 3000 Ci/mmol) by means of T4-polynucleotide kinase (New England Biol Labs, Boston, MA) and separated from unincorporated nucleotides through a Bio-Gel P4 fine column (Bio-Rad Laboratories, Richmond, CA). Prehybridization, hybridization, and washing of filters were performed in a 3 mol/ (molar) tetramethyl ammonium chloride salt solution as described.22 The Namalwa Burkitt lymphoma and HL60 cell lines were used as EBV-positive and -negative controls, respectively.
Results Each of the 16 pathologic specimens exhibited histopathologic characteristics consistent with thymoma. Each neoplasm was composed of a network of epithelial cells, without cytologic atypia and with minimal mitotic activity, on which a variable number of small to intermediate sized, benign appearing lymphocytes were superimposed. The neoplastic epithelial cells comprising each thymoma exhibited strong immunohistochemical reactivity with monoclonal antibodies specific for cytokeratin and the MR3 antigen but lacked reactivity for RFD4. The lymphoid com-
Western Thymomas Lack EBV
1431
AJPJune 1990, Vol. 136, No. 6
1
A
2
3
4
5
6
7
8
9
10
12kb-
2.1kb-
EcoRI
1
B
2
3
4
5
6
7
8
9
10
11 kb-
Hindlill Figure 1. Seven representative thymoma DNAs (A, B, lanes 1- 7) were digested u'ith EcoRI (A) and Hind III (B) restriction enzymes, electrophoresed, blotted, and hybridized with 32P-labeled 7)3 andJH probes. Daudi, M-1 and HL-60 cell line DNAs (A, B, lanes 8-10, respectively) were used aspositive and negative controls, for EBVgenome. All of the EcoRI digested thymoma samplesshow detectable 12-Kb bandsand no clonal Tcell receptorgene rearrangements uhen investigated u'ith32p labeled 713 probe. The extra bandsseen in lanes 4, 5, 7, 8, and9 have been previously reported.22 Thbe represent cross hybridization to unkniownt TCGR gene-related sequences. Furthermore, none of the thymoma samples exhibited detectable immunoglobulin gene rearranigement bands afterJH probing. On the other hand, Daudi and M-1 exhibited one (B, lane 8) and two (B, lane 9) immunoglobulin heavy chain gene rearrangement bands, respectivel, demonstrating the monoclonality anid oligoclonalitjy of these two cell linies (see arrows).
ponent in each thymoma expressed immunophenotypic profiles consistent with cortical thymocytes. The majority of the lymphoid cells in each thymoma expressed TDT, CD7, CD2, fF1, CD3, CD5, CD1, and CD38. In addition, a variable number of lymphoid cells in each thymoma expressed CD71 and CD4 and/or CD8. B cells, based on the expression of CD19, CD20, and CD22, were almost entirely absent. The DNAs extracted and purified from each of the 16 thymomas were initially investigated by TCR# gene rearrangement analysis to determine the presence or absence of clonal T-cell populations. None of the 16 thymomas exhibited clonal TCRJ3 gene rearrangements, consistent with polyclonal thymocyte populations. Furthermore, a 12-kb band was evident in each of the 16 thymoma samples on hybridization of Eco RI-digested DNA to the TCRf3 gene probe (Figure 1, panel A, lanes 1 to 7). As previously reported, polyclonal thymocytes isolated and purified from normal thymus or thymomas by cell suspension techniques, and therefore depleted of thymic epithe-
lial cells, do not exhibit the 12-kb band on hybridization of Eco RI-digested DNA to the TCRp probe.23 The presence of the Eco RI 12-kb band in the DNAs extracted and purified from cryopreserved tissue blocks of each of these 16 thymomas indicates the presence of a considerable nonT-cell DNA component, most likely thymic epithelial cell DNA, in each sample. Furthermore, to exclude the presence of clonal B-cell populations, Eco Rl- and Hindlll-digested DNAs representative of each of the 16 thymoma samples were also analyzed by hybridization to the JH probe. None of the 16 thymomas exhibited clonal immunoglobulin heavy-chain gene rearrangements (Figure 1, panel B, lanes 1 to 8). The Daudi Burkitt's cell line and an EBV-infected B-lymphoblastoid cell line (Ml) served as monoclonal and oligoclonal positive controls, respectively (Figure 1, panel B, lanes 9 to 10). Each of the 16 thymomas were investigated for the presence of EBV sequences using probes specific for the long internal direct repeat (Bam-W/V) and EBV termini (Xhol 1,9). These probes recognize sequences repeated
1432
Inghirami, Chilosi, and Knowles
A/P.june 1990, Vol. 136, No. 6
1
2
3
4
5
6
7
8
9
3kbBamHI Figure 2. Dauidi cell line DNA (from 100 to 0%, lanie 1:100%, lanie 2:50%, lante 3:25%, lanie 4:10%, lane 5:5%, lante 6:2.5%, lanie 7: 1.25%, lane 8:0.5%, lanie 9:0%) uas mixed uitb PIIIA-stimulated humani lymphocyte DNA (from 0 to 100%) to a total of 15 jig DNA/ samples. DNAs were digested with l3anmHI restrictioni enzyme and hybridized uith 32P-labeled Baam W-Vprobe. Films were exposed J]b 3 hoiurs at -70' C anid thbeI developed. The results indicate that the presence of EBV genome can be unequivocally detected wbhen onlly 0. 5% oJlthe total DNA consists of Dauidi FBV DNA (lanie 8).
at least 5 to 10 times of 3000 and 500 base pairs each, respectively.16 We first evaluated the number of copies of EBV that are detectable in Daudi cells using the long internal repeat probe because each Daudi cell contains 224 EBV copies and it is possible to calculate the minimum number of copies detectable using Southern blot analysis. Daudi DNA was mixed with variable amounts of DNA obtained from purified, PHA-stimulated normal T lymphocytes, digested with BamHl, blotted, and hybridized to the Bam-W/V probe. A positive signal, after 3 hours of exposure, was detectable when only 0.5% of the total DNA was represented by Daudi DNA (Figure 2, lane 8). Therefore these data indicate that 0.9 EBV genomic DNA copies per cell can be detected using this technique. However, when the thymomas were investigated for the presence of EBV sequences using Southern blot analysis, no detectable signal was present, even after 7 days exposure, using both the Bam-W/V and the termini probes (Figure 3, lanes 1 to 7). Both the Daudi and Ml lymphoblastoid cell lines exhibited positive signals when hybridized to the long internal repeat and termini probes after only 1 hour exposure (Figure 3, lanes 8 and 9, panels A and B, respectively). Furthermore, the Daudi Burkitt's cell line displayed a single band and the Ml lymphoblastoid cell line displayed three distinct bands when the termini probe was applied (Figure 3, lanes 8 and 9, panel B), indicating that Dandi and Ml lymphoblastoid cell lines contain one and three polyclonal EBV-infected subpopulations,
respectively. To confirm these findings using a more sensitive approach, we applied a PCR to detect EBV sequences. Namalwa Burkitt lymphoma DNA, which contains two integrated copies of the EBV genome for each cell,24 was used as a positive control. One microgram of purified Namalwa DNA was amplified by PCR using 10 to 50 cycles. Epstein-Barr virus sequences were detected after 20 cycles (data not shown). Namalwa DNA was mixed with HL60 EBV-negative DNA to evaluate the sensitivity of
PCR to detect EBV-infected cells among EBV-negative cells. A positive signal was present when only 10 ng of EBV-positive DNA was present. This indicates that a single EBV-positive cell among 105 EBV-negative cells can be detected in this system (data not shown). Nonetheless, once again none of the 16 thymomas exhibited evidence of the presence of EBV sequences when investigated by PCR (Figure 4, panel A, lanes 1 to 16). Namalwa (100 ng) and HL60 (1 ,ug) cell lines served as positive and negative EBV DNA controls (Figure 4, panel A, lanes 17 and 18), respectively. Finally, these DNAs were also amplified using a c-myc primer specific for the first exon (Figure 4, panel B, lanes 1 to 16) to exclude the presence of inhibitors of the PCR in the thymoma samples.
Discussion Human thymomas are neoplasms of thymic epithelial origin that frequently contain variable numbers of benign, polyclonal thymocytes (immature T cells) assembled to mimic the organization and cell distribution observed in the normal human thymus. The biologic relationships that exist between neoplastic thymic epithelial cells and benign T lymphocytes are incompletely understood. However, we recently demonstrated that neoplastic thymic epithelial cells, which synthesize thymic hormones,25 may actively control the differentiation and proliferation of precursor T cells.257 On the other hand, neoplastic thymic epithelial cells often appear to be immunologically incompetent.26 In this context, they may be responsible for an abnormal thymic microenvironment in which handicapped T-cell clones are generated.27 Such handicapped T lymphocytes may be involved in the pathogenesis of the autoimmune diseases that are frequently associated with thymomas.428 31 Even less is known concerning the pathogenesis of thymomas. In this regard, however, several authors have
Western Thymomas Lack EBV
1433
AJPJune 1990, Vol. 136, No. 6
A 1
2
3
4
5
6
7
8
9
10
3kbBamHI
B 1 1
2
3
4
5
6
7
8
9
10
Okb-
BamHI Figure 3. Seven representative thymoma (lanes 1- 7) and Daudi, M-1 and HL-60 cell line (lanes 8, 9 and 10, respectively) DNAs were digested with BamHI and probed with the Bam W/V(A) and termini (B) probes. Detectable signals for EBVsequences are only preseint in lanes 8 and 9 containinlg Daudi and M-1 DNAs and not in any thymoma DNAs. Furthermore, when the termini probes were applied, otne and three bands were identified in the Daudi and M- 1 DNAs, respectively. These data indicate that Daudi and M- 1 cell lines are monoclonial and oligoclonalfor EBVgenomes, respectively.
recently demonstrated the presence of EBV genomes in thymomas, thymic carcinomas, and hyperplastic thymus.8 10 Epstein-Barr virus, the etiologic agent of infectious mononucleosis,32 has been implicated in the pathogenesis of a variety of neoplasms, including Burkitt lymphoma,33 nasopharyngeal carcinoma,3435 and malignant lymphoepithelial neoplasms of the parotid salivary gland.36 Interestingly, nasopharyngeal, parotid gland, and thymic epithelium have a common embryologic derivation from the primitive pharynx. This may explain the peculiar tropism of EBV for these different target cells. Further-
1
more, EBV preferentially binds to and infects cells that express the C3d cell-surface receptor that also serves as the EBV receptor on human cells.37 The C3d/EBV receptor has been demonstrated in human B lymphocytes37 and in nasopharyngeal epithelium,38 but is not expressed by normal or neoplastic thymic epithelial cells (Chilosi, unpublished data). The recent report indicating that EBV may play a contributory role in the pathogenesis of thymic epithelial neoplasms occurring in patients from southern China prompted us to investigate whether the high incidence of
2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
A
EBV 1
2 3 4 5 6 7 8 9 10
11 12 13 14 15 16 17 18
B
myc Figure 4. Sixteetn thymomas (lanes 1-16) and Namalwa and HL-60 (lanes 17, 18, respectiively) DNAs were amplified using EBV(A) and myc (B) oligoprimers as described aboi'e. Onfe tenth of the amplified DNAs were blotted and hybridized with specific 32P-labeled EBV (110331-110350)i6 and myc (2872-2891)' oligoprobes. Thefilms were developed after 1-hour exposure at -70' C Only Namalua DNA was positive for the pre,sence ofEBVsequences. However, all the DNAs could be efficiently amplified when myc oliprimers were used.
1434
Inghirami, Chilosi, and Knowles
AJPJune 1990, Vol. 136, No. 6
EBV genome in thymomas is a general phenomenon or is confined to that particular region. Therefore we investigated the presence of the EBV genome in 16 thymomas occurring in two different western regions, New York City, United States, and Verona, Italy, using Southern blot hybridization analysis and PCR, which provides a highly sensitive method for the detection of specific EBV DNA sequences. To exclude the presence of EBV-infected clonal B-cell populations as a major source of EBV DNA, we performed immunohistochemical staining and immunoglobulin gene rearrangement analysis. These studies confirmed that B lymphocytes always represented a minute subpopulation (
