Virulence genes and genetic diversity of Streptococcus suis serotype 2 isolates from Thailand.

Transboundary and Emerging Diseases

ORIGINAL ARTICLE

Virulence Genes and Genetic Diversity of Streptococcus suis Serotype 2 Isolates from Thailand K. Maneerat1, S. Yongkiettrakul2, I. Kramomtong3, P. Tongtawe1, P. Tapchaisri1, P. Luangsuk4, W. Chaicumpa1,5, M. Gottschalk6 and P. Srimanote1 1 2

3 4 5 6

Graduate Program in Biomedical Sciences, Faculty of Allied Health Sciences, Thammasat University, Pathumthani, Thailand Protein-Ligand Engineering and Molecular Biology Laboratory, National Center for Genetic Engineering and Biotechnology, Thailand Science Park, Pathumthani, Thailand Department of Microbiology, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, Thailand Chiang Kham General Hospital, Phayao, Thailand Department of Parasitology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand Faculty of Veterinary Medicine, University of Montreal, St-Hyacinthe Quebec, Canada

Keywords: Streptococcus suis; Thailand; virulence genes; RAPD; multilocus sequence typing Correspondence: Potjanee Srimanote. Graduate Program in Biomedical Sciences, Faculty of Allied Health Sciences, Thammasat University. 99 Moo 18, Pahonyothin Road, Klong Luang, Pathumthani Province, Thailand. Tel.: +662 9879213-7 ext 7265, +668 70800731; Fax: +662 5165379; E-mail: [email protected] Received for publication November 15, 2012 doi:10.1111/tbed.12157

Summary Isolates of Streptococcus suis from different Western countries as well as those from China and Vietnam have been previously well characterized. So far, the genetic characteristics and relationship between S. suis strains isolated from both humans and pigs in Thailand are unknown. In this study, a total of 245 S. suis isolates were collected from both human cases (epidemic and sporadic) and pigs (diseased and asymptomatic) in Thailand. Bacterial strains were identified by biochemical tests and PCR targeting both, the 16S rRNA and gdh genes. Thirty-six isolates were identified as serotype 2 based on serotyping and the cps2-PCR. These isolates were tested for the presence of six virulence-associated genes: an arginine deiminase (arcA), a 38-kDa protein and protective antigen (bay046), an extracellular factor (epf), an hyaluronidase (hyl), a muramidase-released protein (mrp) and a suilysin (sly). In addition, the genetic diversities of these isolates were studied by RAPD PCR and multilocus sequence typing (MLST) analysis. Four virulence-associated gene patterns (VAGP 1 to 4) were obtained, and the majority of isolates (32/36) carried all genes tested (VAGP1). Each of the three OPB primers used provided 4 patterns designated RAPD-A to RAPD-D. Furthermore, MLST analysis could also distinguish the 36 isolates into four sequence types (STs): ST1 (n = 32), ST104 (n = 2), ST233 (n = 1) and a newly identified ST, ST336 (n = 1). Dendrogram constructions based on RAPD patterns indicated that S. suis serotype 2 isolates from Thailand could be divided into four groups and that the characteristics of the individual groups were in complete agreement with the virulence gene profiles and STs. The majority (32/36) of isolates recovered from diseased pigs, slaughterhouse pigs or human patients could be classified into a single group (VAGP1, RAPD-A and ST1). This genetic information strongly suggests the transmission of S. suis isolates from pigs to humans in Thailand. Our findings are the first to report genetic characteristics of strains from Thailand and to elucidate the genetic relationship among S. suis isolates from human and pig origins.

© 2013 Blackwell Verlag GmbH • Transboundary and Emerging Diseases. 60 (Suppl. 2) (2013) 69–79

69

Virulence Genes and Genetic Diversity of S. suis

K. Maneerat et al.

Impact

• The number of patients with zoonotic Streptococcus suis •

infections in Thailand has significantly increased in the past 10 years. However, genetic characteristics of S. suis strains isolated from pigs and humans in this region are still very limited. We observed that genotypes based on the presence of virulence-associated genes, RAPD profiles and ST types are highly conserved within individual groups. Moreover, genetic profiles based on RAPD and MLST assays confirmed the relationship between human and pig S. suis serotype 2 isolates in Thailand, suggesting their anthropozoonotic transmission.

Introduction Streptococcus suis (S. suis) is an important swine pathogen, particularly in piglets and young fattening pigs. Swine infections include sepsis, meningitis, endocarditis, arthritis and pneumonia (Sihvonen et al., 1988; Touil et al., 1988). S. suis serotype 2 is the most prevalent serotype associated with disease in pigs in most regions of the world. This serotype, along with serotype 14, is recognized as an important zoonotic agent, causing mainly sepsis, meningitis, endocarditis, severe arthritis and septic shock with sometimes relatively high mortality rates (Perch et al., 1968; Suankratay et al., 2004; Yu et al., 2006; Mai et al., 2008). Apart from the capsular polysaccharide (CPS), other putative virulence candidates, such as an extracellular protein factor (EF, encoded by the epf gene), a muramidase-released protein (MRP, encoded by the mrp gene), the suilysin (SLY, encoded by the sly gene), adhesins, an arginine deiminase (ArcA), a 38 kDa BAY046 protein (encoded by the bay046 gene) and an hyaluronidase (encoded by the hyl gene), have been suggested. However, their roles in the pathogenesis of human and swine infections remain poorly understood (Tikkanen et al., 1996; Gottschalk and Segura, 2000; Winterhoff et al., 2002; Allen et al., 2004; Okwumabua and Chinnapapakkagari, 2005; Fittipaldi et al., 2012). Genotyping of S. suis serotype 2 isolates has been achieved using various methods including. random amplified polymorphic DNA (RAPD) PCR with the OPB7, OPB10 and OPB17 primers, and multilocus sequence typing (MLST) (Chatellier et al., 1999; Martinez et al., 2003; Maiden, 2006). The diversity of isolates from North America and Europe have been previously studied, and all isolates possessing an MRP+EF+SLY+ phenotype were found to cluster in a single RAPD fingerprint, regardless of their geographical origin (Chatellier et al., 1999). Consequently, S. suis strains with the similar phenotypic characteristics from both North America and Europe possibly originate 70

from a common ancestor (Chatellier et al., 1999; Martinez et al., 2003). Previous reports have demonstrated that S. suis sequence type (ST) 1 is a highly evolved clone that predominates in human and pig infections in both Asia and Europe (Schultsz et al., 2012). Streptococcus suis ST1 strains have also been associated with invasive diseases, such as meningitis, in both swine and humans in Thailand and Vietnam (Kerdsin et al., 2011; Mai et al., 2008). More recently, a new sequence type, ST7, was reported as the cause of a Chinese outbreak in 2005 (Tang et al., 2006). Many patients affected by S. suis ST7 strains developed streptococcal toxic shock-like syndrome (STSLS), resulting in a high mortality rate (Tang et al., 2006). However, this clinical manifestation was also found in humans infected with ST1 strains in Vietnam (Mai et al., 2008), but was rarely reported in patients infected with S. suis ST1 strains in Thailand (Khadthasrima et al., 2008). Interestingly, and differently from Europe and Asia, most North American strains (including those isolated from human patients) belong to either ST25 or ST28 (Fittipaldi et al., 2011). In addition, new STs associated with human infections have been recently reported as ST104 and ST20 in human patients from Thailand and the Netherlands, respectively (Kerdsin et al., 2011; Schultsz et al., 2012). The first case of zoonotic S. suis infection in Thailand was reported in 1987 (Phuapradit et al., 1987). From 1994 to 2006, Thailand reported only 37 sporadic and 41 outbreak cases of human infections in the Northern Provinces of the country (Wangkaewa et al., 2006; Suankratay et al., 2004; Vilaichone et al., 2002; : Wangkaewa et al., 2006). However, a more recent outbreak of human S. suis serotype 2 infection, which involved over 300 individuals (29 bacteriological confirmed cases) in Phayao Province in 2007, significantly increased public health concerns regarding S. suis infections (Wangkaewa et al., 2006; Khadthasrima et al., 2008). The Northern Provinces of Thailand, in particular Phayao, Phrae and Lamphun, are considered endemic areas of zoonotic S. suis infection as nearly all reported human cases originated in this region. Although some characteristics of Thai S. suis serotype 2 strains have been studied, particularly those isolated from human patients (Kerdsin et al., 2011), the genetic relationships among S. suis isolates from both pigs and humans in Thailand has not yet been addressed. Therefore, it was important to investigate the virulence gene profiles and genetic relatedness among isolates from human patients and diseased and asymptomatic pigs using RAPD fingerprinting and MLST analysis. The information from these studies would provide insights into the epidemiology of this pathogen and will be important towards the development of control and prevention strategies.



K. Maneerat et al.

Materials and Methods Bacterial isolates A total of 245 S. suis field strains isolated from human patients (15 from epidemic and 12 from sporadic cases) and pigs (24 presenting clinical signs of infection and 194 asymptomatic) from three geographical regions of Thailand (Table 1, Fig. 1) were used in this study. In patients with meningitis, S. suis were isolated from both blood and cerebrospinal fluid (CSF), whereas in non-meningitis cases, bacteria were collected from blood only. The 15 human epidemic isolates were obtained from patients during an April-May 2007 outbreak in a Northern endemic region of Thailand (Phayao Province). Among the 12 sporadic case isolates, 4 were isolated from patients in endemic areas (either the Phrae or Phayao Provinces) from 2006 to March 2007 (prior to the outbreak) and obtained from the collection of the Ministry of Public Health. The other seven isolates were recovered from sporadic cases after the outbreak had been declared, from the Phayao Province. The remaining isolate was recovered from a patient in the Phayaocontiguous Phrae Province. The 24 S. suis isolates from diseased pigs were collected from blood. Among these, 12 isolates were from the Phayao Province and six from the Nakhon Pathom and Nakhon Si Thammarat Provinces, respectively. The remaining 194 isolates were obtained from whole tonsil homogenates of slaughterhouse pigs (considered as isolates from asymptomatic pigs) in the Phayao Province during the 2007 epidemic period. All field strains were isolated on 5% blood agar plates (Lab M, Lancashire, UK) and incubated at 37°C in 5% CO2 for 16–18 h. Alpha hemolytic colonies were further identified by conventional biochemical tests and carbohydrate utilization as previously described (Hommez et al., 1986; Tarradas et al., 1994). The suspected S. suis colonies were confirmed by two species-specific PCR assays for the 16S

Fig. 1. Map of Thailand with the locations of the provinces from where Streptococcus suis strains were isolated from humans and pigs.

rRNA and gdh genes (Marois et al., 2004; Okwumabua et al., 2003) (Table 3). Serotyping of the 245 S. suis isolates was performed by coagglutination test using serotype-specific anti-sera for all 35 serotypes at the Reference Laboratory for S. suis Serotyping, Faculty of Veterinary Medicine, University of Montreal, Canada. The presence of the cps2 gene in isolates belonging to serotype 2 was also determined by PCR as previously described (Smith et al., 1999). The S. suis serotype 2 strain P1/7 was used as a positive control for PCR assays and RAPD amplifications, as well as for the MLST analysis. Presence of virulence-associated genes in S. suis isolates Genomic DNA from 36 S. suis serotype 2 isolates was extracted using the PurelinkTMgenomic DNA Mini kit (Invitrogen, Carlsbad, CA, USA). The presence of arcA, bay046, epf, hyl, mrp and sly was determined by conventional and multiplex PCR (Silva et al., 2006). The sequence of oligonucleotide primers, the respective PCR products and the

Table 1. Streptococcus suis isolates in this study Source (total no. of isolates) Epidemic human cases (n = 15) Meningitis (CSF) Non-meningitis (Blood) Sporadic human cases (n = 12) Meningitis (CSF) Non-meningitis (Blood)

Diseased pigs (n = 24) Blood Blood Blood Asymptomatic pigs (n = 194) Tonsil homogenate

Province (region) of isolation

No. of isolates

No. of serotype 2 isolates

Phayao Province (Northern) Phayao Province (Northern)

8 7

8 7

Phayao Province (Northern) Ministry of Public Health (Northern) Phayao Province (Northern) Phrae Province (Northern)

4 4 3 1

4 4 3 1

12 6 6

0 2 0

194

7

Phayao Province (Northern) Nakhon Pathom Province (Central Plane) Nakhon Si Thammarat Province (Southern) Phayao Province


71


K. Maneerat et al.

thermocycle programs are listed in Table 2. PCRs were composed of 2.5 mM deoxynucleotide triphosphates, 19 PCR buffer (Fermentas, Vilnius, Lithuania), 2.5 mM MgCl2, 100 pmol forward primer and reverse primers (Bio Basic Inc., Toronto, Canada), 1.5 U Taq DNA polymerase (Fermentas) and 25 ng of S. suis DNA. The reaction mixtures were completed to 25 ll with ultrapure distilled water. The no template control corresponded to the PCR mixture without DNA. Amplicons were electrophoresed on 1.2% agarose gel (Axygen Biosciences, Union, California, USA) in Tris-Borate-EDTA buffer and visualized using an UV transilluminator following ethidium bromide staining (Sigma Chemical Co., St. Louis, MO, USA). DNA fingerprinting by RAPD Three RAPD primers, OPB7, OPB10 and OPB17 (Table 3), were used in this study to amplify S. suis serotype 2 genomic DNA preparations. The PCR mixtures were prepared as previously described (Chatellier et al., 1999). The PCRs were achieved using one cycle at 94°C for 4 min, 36°C for 1 min and 72°C for 2 min; 33 cycles at 94°C for 1 min, 36°C for 1 min and 72°C for 2 min; and a cycle at 94°C for 2 min, 36°C for 1 min and 72°C for 10 min in a MasterCycler (Eppendorf, Hamburg, Germany) (Chatellier et al., 1999). Amplification products were analysed on 1.5% agarose gel in Tris-Borate-EDTA buffer and visualized using an UV transilluminator following ethidium bromide staining. The RAPD band pattern images from GeneFlash gel documentation system (Syngene, Cambridge, UK) were further analysed by band matching software (Syngene). The band patterns were compared using Dice similarity

coefficient and clustered to construct a dendrogram using Unweighted Pair Group Method with Arithmetic Mean (UPGMA) at 3.5% tolerance window (GeneDirectory software, Syngene). The variation between experiments was determined by testing the same three S. suis strains (including P1/7) in every experiments. The reproducibility of theses RAPD patterns was over 99%, and each of the DNA band patterns of the isolates was imported only once in GeneDirectory. Multilocus sequence typing (MLST) analysis Seven S. suis housekeeping genes, a 5-enolpyruvylshikimate 3-phosphate synthase (aroA), a 60 kDa chaperonine (cpn60), a peroxide resistance protein (dpr), a glucose kinase (gki), a DNA mismatch repair protein (mutS), a homologous recombination factor (recA) and an aspartokinase (thrA), were amplified for the 36 S. suis serotype 2 genomic DNA preparations using the primer sequences listed in Table 3 (King et al., 2002; Rehm et al., 2007). Each PCR product was purified using PCR purification kits or agarose gel extraction kits (both from Jena Bioscience GmbH, Jena, Germany). The sequences of both strands of the individual fragments were determined by dye terminator chemistry with primers similar to those used in the initial amplification with the exception of the thrA sense primer (Table 3), on an Applied Biosystems model 3070 automated DNA sequencer (King et al., 2002). Multilocus sequence typing alleles of the individual genes, sequence types (STs) and clonal complexes (CC) were identified using the S. suis MLST database and eBURST Web application (http://ssuis.mlst.net/).

Table 2. Streptococcus suis virulence-associated gene primers and PCR product length Product length (bp)

Genes

Primer sequence (5′-3′)

16S rRNA gdh

CAGTATTTACCGGCATGGTAGATAT (forward) GTAAGATACCGTCAAGTGAGAA (reverse) GCAGCGTATTCTGTCAAACG (forward) CCATGGACAGATAAAGATGG (reverse) TGATAGTGATTTGTCGGGAGGG (forward) GAGTATCTAAAGAATGCCTATTG (reverse) ATCTACTGGGTATCCTTCTGC (forward) CTATCTGGATCTGTGATTGGA (reverse) TGCTGAAAATACGAGTGC (forward) TGCCADCATAATCATACCC (reverse) ACTCTATCACCTCATCCGC (forward) ATGAGAAAAAGTTCGCACTTG (reverse) CTCAGATGAAAGCCTTTCTA (forward) TTTGTCCTTGGTCGTTGTC (reverse) GATGCCTTTGCTCAAGCTCT (forward) TTTCACGGTTCCGTGTTTCT (reverse) ATGCCACGGATTACCTTCCC (forward) CCGTCTCCTTAATGATCCGC (reverse)

cps2 epf mrp sly hyl arcA bay046

72

294 688 557 626 970

PCR condition

Reference

Initial denaturation for 4 min., followed by 35 cycles of 30 s at 94°C, 1 min at 54°C, and 1 min at 72°C. Final extension was performed for 7 min at 72°C.

Marois et al. (2004) Okwumabua et al. (2003) Okwumabua et al. (2003) This study This study

1,400

Kim et al. (2010)

1,290

King et al. (2004)

441

This study

253

Okwumabua and Chinnapapakkagari (2005 )



K. Maneerat et al.

Table 3. Streptococcus suis RAPD PCR and multilocus sequence typing (MLST) primers Primers RAPD PCR OPB7 OPB10 OPB17 Housekeeping genes for MLST aroA-up aroA-dn cpn-up cpn-dn dpr-up dpr-dn gki-up gki-dn mutS-up mutS-dn recA-up recA-dn thrA-up thrA-dn Sequencing primer thrA-forward

Primer sequence (5′-3′)

Product length (bp)

Reference

GGTGACGCAG CTGCTGGGAC AGGGAACGAG

300 to 3,000 300 to 3,000 100 to 2,000

Chatellier et al. (1999) Chatellier et al. (1999) Chatellier et al. (1999)

TTCCATGTGCTTGAGTCGCTA ACGTGACCTACCTCCGTTGAC TTGAAAAACGTRACKGCAGGTGC ACGTTGAAIGTACCACGAATC CGTCTTTCAGCCCGCGTCCA GACCAAGTTCTGCCTGCAGC GGAGCCTATAACCTCAACTGG AAGAACGATGTAGGCAGGATT AAGCAGGCAGTCGGCGTGGT AGTACAAACTACCATGCTTC TATGATGAGTCAGGCCATG CGCTTAGCATTTTCAGAACC GATTCAGAACGTCGCTTTGT’ AAGTTTTCATAGAGGTCAGC

366

King et al. (2002)

318

King et al. (2002)

336

King et al. (2002)

321

King et al. (2002)

339

Rehm et al. (2007)

354

King et al. (2002)

336

King et al. (2002)

AAGAATGGATCATCAACCGT

Results Identification and presence of virulence-associated genes of S. suis serotype 2 isolates A total of 36 S. suis serotype 2 isolates were identified by serotyping and cps2 PCR from the 245 S. suis human and pig isolates collected from different regions in Thailand. All human patient isolates were serotype 2; however, this serotype was not isolated from diseased pigs in the endemic Northern Province (Phayao) and the non-endemic Southern Province (Nakhon Si Thammarat), but it was found in two of the six isolates from the non-endemic Central Plain Province (Nakhon Pathom). On the other hand, seven of the 194 S. suis serotype 2 isolates were identified in asymptomatic pigs in the S. suis zoonotic endemic Phayao Province (Table 1 and Fig. 1). Although half of the isolates recovered from asymptomatic pigs were non-typable using all serotype-specific anti-sera or presented autoagglutination, they were negative for cps2-PCR. Twelve serotypes other than serotype 2 were also found in this collection (data not shown). Data about the presence of the six virulence-associated genes of S. suis serotype 2 isolates are presented in Table 4, and the gene amplification products are shown in Fig. 2. Four virulence-associated gene patterns (VAGP) were identified among the different isolates (Table 4). Most of the S. suis serotype 2 isolates (32/36) collected from human epidemic and sporadic cases in the Phayao and other Northern Provinces, from diseased pigs in the Nakhon

King et al. (2002)

Pathom Province (1 isolate; non-endemic area) and from asymptomatic pigs in the Phayao Province (5 isolates; endemic area) possessed all virulence genes tested (designated as VAGP1). Of the 4 remaining isolates recovered from two sporadic human patients in the endemic Phayao Province and from two diseased pigs in the non-endemic Nakhon Pathom Province, lacked both the epf and mrp genes (designated as VAGP2). Interestingly, of the two isolates from asymptomatic pigs in the Phayao Province, one isolate lacked the epf, mrp and bay046 gene (designated as VAGP3), while the other lacked the mrp gene only (designated as VAGP4). Genetic diversity of S. suis using RAPD PCR Extracted genomic DNA of the 36 S. suis serotype 2 isolates was subjected to RAPD amplification using three OPB primers as described in the Materials and Methods. Each of the three primers showed 4 RAPD patterns (RAPD-A to RAPD-D) with differences in band numbers and sizes. Patterns of up to four bands with sizes ranging between 300 and 3,000 bp were obtained using OPB7. The OPB10 primer produced RAPD patterns with seven to nine bands with a similar size range as those obtained with OPB7. However, OPB17 generated patterns of eight to ten bands with sizes ranging between 100 and 2,000 bp. The RAPD patterns based on the three OPB primers used are shown in Figs 3a–c and Table 4. Moreover, a high correlation of RAPD patterns among the three primers used was


73


K. Maneerat et al.

Table 4. Geographical origin, source of isolation and characteristics of the 36 Streptococcus suis serotype 2 isolates in this study

Origin of isolation; no. of isolates

Source of isolation; no. of isolates

Phayao Province; 15

Human (epidemic) CSF; 4 Blood; 11 Blood; 4 Human (sporadic) CSF; 2 Blood; 4 Blood; 1 Human (sporadic) Blood; 1 Diseased pigs Blood; 1 Blood; 1 Asymptomatic pigs Tonsil; 5 Tonsil; 1 Tonsil; 1

Northern region; 4a Phayao Province; 7

Phrae Province; 1 Nakhon Pathom Province, Central Plain; 2 Phayao Province; 7

RAPD pattern primers

Presence of virulence-associated genes

using

epf

mrp

Sly

hyl

arcA

bay046

VAGP

OPB7

OPB10

OPB17

ST/CC

+ + +

+ + +

+ + +

+ + +

+ + +

+ + +

1 1 1

A A A

A A A

A A A

ST1/1 ST1/1 ST1/1

+ +

+ +

+ + +

+ + +

+ + +

+ + +

1 1 2

A A B

A A B

A A B

ST1/1 ST1/1 ST104/225

+

+

+

+

+

+

1

A

A

A

ST1/1

+

+

+ +

+ +

+ +

+ +

1 2

A B

A B

A B

ST1/1 ST104/225

+

+

+ + +

+ + +

+ + +

+

1 3 4

A C D

A C D

A C D

ST1/1 ST233/ST336/-

+

+

VAGP, virulence-associated gene profile; ST, sequence type; CC, clonal complex; a Ministry of Public Health collection.

Fig. 2. PCR amplicons of the Streptococcus suis virulence-associated genes. The target genes of the PCR amplification products of one isolate from an epidemic human patient are indicated on the right-hand side. Marker, GeneRuler 100 bp Plus DNA Ladder (Fermentas). TM

observed. For example, an isolate that presented a RAPD-A pattern using the primer OPB7 also had a RAPD-A pattern when using either the OPB10 or OPB17 primer for amplification (Table 4). 74

The UPGMA-based dendrogram construction of the RAPD-A to RAPD-D patterns from the individual primers revealed that RAPD patterns from primers OPB7 and OPB17 could group strains into two unrelated major clusters (clusters 1 and 2) with some minor differences (Figs 3a and c), while a single major cluster was evident for primer OPB10 (Fig. 3b). Interestingly, these four RAPD patterns correlated with the four individual virulence gene profiles (Table 4). Consequently, the 32 S. suis serotype 2 isolates belonging to the virulence gene profile VAGP1, regardless of their origin (human or swine), had a RAPD-A pattern and were located in the cluster 1 of the dendrograms constructed from all OPB primers used (Figs 3a–c). The two isolates with the VAGP2 profile had a RAPD-B pattern for all primers. Based on the dendrograms constructed from the OPB7 and OPB17 primers, these isolates were located in cluster 2 with a low similarity to the RAPD-A pattern (Figs 3a and c) and were therefore assigned to cluster 1 of the OPB10 primer-dendrogram, having 65% similarity to the RAPD-A pattern (Fig. 3b). The asymptomatic pig isolate from the endemic area with a VAGP3 profile had a RAPD-C pattern and was also assigned to cluster 1 of the OPB10-based dendrogram but had only 45% similarity with the RAPD-A pattern (Fig. 3b). On the other hand, this isolate was located on cluster 2 based on the dendrograms constructed by the OPB7 and OPB17 primers and was not related to RAPD-A. Furthermore, it revealed 40% and 68% similarities with the



K. Maneerat et al.

(a)

separate branch of the dendrograms constructed from RAPD results of primers OPB7 and OPB10 with similarity to the other RAPD patterns (Figs 3a and Nevertheless, it was assigned to the cluster 2 of OPB17-dendrogram, with only 59% similarity to RAPD-B and RAPD-C patterns (Fig. 3c).

the no b). the the

MLST

(b)

(c)

Fig. 3. Genetic relationship among the 36 isolates of Streptococcus suis serotype 2 as predicted by UPGMA-based clustering analysis of the RAPD patterns generated with primers OPB7 (a), OPB10 (b) and OPB17 (c) and multilocus sequence typing analysis. Each scale on the dendrogram indicates percentage of similarity among RAPD patterns. RAPD patterns sharing 100% similarity were grouped into clusters.

RAPD-B patterns of OPB7 and OPB17, respectively (Figs 3a and c). Finally, the VAGP4 asymptomatic pig isolate from the endemic area had a RAPD-D pattern and was assigned to a

Multilocus sequence typing analysis using the DNA sequence data of the seven conserved housekeeping genes amplified from the genomic DNA of the 36 S. suis serotype 2 isolates revealed four STs: ST1, ST104, ST233 and a newly identified ST, ST336 (Table 4). Interestingly and similar to RAPD results, the isolates classified in each of the four STs also belonged to the individual VAGPs (Fig. 3 and Table 4). Therefore, all 32 S. suis serotype 2 isolates with VAGP1/RAPD-A profiles were ST1 and belonged to the clonal complex 1 (CC1). The two VAGP2/RAPD-B isolates were classified as ST104 and belong to the CC225. The isolate from an asymptomatic pig with a VAGP3/RAPD-C was ST233 and did not belong to any related clonal complex although it was different from ST104 by the gki and thrA alleles only. The remaining VAGP4/RAPD-D isolate was classified in a new sequence type, the ST336, as a result of carrying three new alleles for the cpn60, dpr and recA genes. Discussion Streptococcus suis is the cause of a severe zoonotic infection in humans, especially in the Northern region of Thailand, characterized by septicaemia, meningitis and endocarditis. In the past 10 years, the incidence of human S. suis infections in Thailand has substantially increased. Moreover, many retrospective descriptive studies have indicated the involvement of pigs or their by-products as the most probable cause of infection in epidemic and sporadic human cases in this country (Fongcom et al., 2001; Khadthasrima et al., 2008). Previous reports have demonstrated that only a few cases of STSLS, similar to those of the S. suis ST7 Chinese outbreak strain, had been reported in Thailand, providing a hint in pathogenicity differences (Fongcom et al., 2001). However, the information regarding the genetic link of S. suis recovered from human patients and pig isolates has remained unknown. In this study, genetic characteristics of 245 S. suis isolates recovered from either human patients or pigs during the 2007 human outbreak in Thailand in both endemic (Northern) and other non-endemic regions of Thailand were studied. A total of 36 isolates belonged to serotype 2 as identified by PCR and serotyping tests. All human patient isolates were serotype 2, while only 2 of the 6 isolates collected from diseased pigs in


75


K. Maneerat et al.

a non-endemic zoonotic area (Nakhon Pathom) and 7 of the 194 isolates recovered from asymptomatic pigs in an endemic area (Phayao) belonged to this serotype. None of the S. suis isolates recovered from diseased pigs in the Phayao (endemic) and Nakhon Si Thammarat (non-endemic) regions were serotype 2. The lack of S. suis serotype 2 in Phayao and the fact that only 2 isolates of this serotype were isolated from Nakhon Pathom is interesting. As of 2007, almost 5 million pigs in Thailand (representing 60% of the swine population) were being reared in large hygienic farms of intensive swine production industries in the S. suis-zoonotic-free Central Plain area, particularly in the Nakhon Pathom province. Meanwhile, only 1.7 million pigs were domestic and reared in small farms in the Northern region (Thai Livestock Farmer Database System, Department of Livestock Development, Ministry of Agricultural and Cooperatives, Thailand, 2011). However, from 2005 to 2006, only one S. suis case was reported in a diseased pig specimen from the Central Plain Provinces submitted to the microbiology laboratory of the National Institute of Animal Health, Thailand (NIAH) (National Institute of animal Health Thailand, 2012). As such, it is likely that S. suis infections in pigs in the Central Plain Provinces, as in other areas of the country, are virtually unknown and, most probably, underestimated. The epf, mrp and sly genes have been shown to be significant virulence markers for S. suis that allow to differentiate virulent (presence) from less-virulent (absence) strains in Europe and Asia (Schultsz et al., 2012). The presence of other additional genes, such as arcA, bay046 and hyl, has been also reported to be associated with S. suis virulence (Winterhoff et al., 2002; Okwumabua and Sharmila, 2005; Allen et al., 2004). The results of the present study revealed that the majority of serotype 2 isolates regardless of their origin (human or pig), epidemiological status (epidemic or sporadic) and disease category (diseased or asymptomatic pigs), carried all virulence-associated genes tested (VAGP1). The S. suis serotype 2 isolates with the epf+/mrp+/sly+ genotype had also frequently been described from cases of meningitis in patients from Thailand, Vietnam and China, as well as from the majority of diseased pigs during the largest zoonotic outbreak in China, in 2005 (Kerdsin et al., 2011; Mai et al., 2008; Yu et al., 2006). Moreover, isolates that produce the EF, MRP and SLY were frequently associated with S. suis serotype 2 from diseased pigs in Europe (Chatellier et al., 1999). A total of five of the 7 S. suis serotype 2 isolates from healthy pigs possessed also the epf+/mrp+/sly+ genotype indicating that these isolates carried the potential virulence factors required to infect humans. On the other hand, two epf / mrp (VAGP2) isolates, from a sporadic non-meningitis patient and a diseased pig, respectively, had similar genotypes to those of S. suis serotype 2 isolates recovered from 76

non-meningitis patients in Thailand and from diseased pigs in North America, as previously reported (Galina et al., 1996; Fittipaldi et al., 2009; Kerdsin et al., 2011). Finally, an asymptomatic serotype 2 pig isolate in this study was identified as mrp (VAGP4), similar to S. suis serotype 2 strains isolated from meningitis patients in Vietnam (Mai et al., 2008). Taken together, our results support previous reports indicating that the EF and MRP may be significant virulence markers while not being essential for pathogenesis in pigs and humans (Fittipaldi et al., 2012). A previous report suggested that RAPD clusters obtained with the OPB7, OPB10 and OPB17 primers were usually related to a given EF, MRP and SLY phenotype, rather than to the geographic or host origins of the strains (Chatellier et al., 1999). Moreover, RAPD clusters indicated that S. suis serotype 2 isolates from North America and Europe might have originated from a common ancestor (Chatellier et al., 1999). The identical RAPD pattern and its specific virulence gene profile were also found in most clinical S. suis serotype 2 isolates from Brazil indicating the successful spread of a specific clone to South America (Martinez et al., 2003). Similar results were obtained in the present study. The four RAPD obtained patterns (RAPD-A to RAPD-D) were also related to their own specific virulence gene profile (VAGP). RAPD-A patterns obtained with the OPB7 and OPB17 primers were solely located on the Cluster 1 of the dendrogram and not related to other patterns, whereas, using the OPB10 primer, RAPD-A, RAPDB and RAPD-C were related and grouped together in Cluster 1, suggesting differences in the discriminatory power of these OPB primers. Most of S. suis serotype 2 isolates collected from human patients (epidemic and sporadic) and pigs (diseased and asymptomatic) in different regions of Thailand had a RAPD-A/VAGP1 pattern, suggesting a close genetic relationship among human patients and diseased and asymptomatic pig isolates. This phenomenon was further emphasized by the MLST results. The majority of the S. suis serotype 2 RAPD-A/VAGP1 isolates in this study were classified as ST1. This ST is also present in isolates from Vietnam, Hong Kong and Europe as well as a few isolates from North America (Mai et al., 2008; Fittipaldi et al., 2011). Moreover, S. suis serotype 2 ST1 strains have been previously reported to be a frequent cause of meningitis in human patients in Thailand (Kerdsin et al., 2011). In addition, 5 of the 7 S. suis serotype 2 isolates from asymptomatic pigs were found to be ST1, which was similar to that of the isolates from slaughterhouse pigs in Southern Vietnam (Ngo et al., 2011). These results further emphasize the successful establishment of the S. suis serotype 2 ST1 clone in Asia (Schultsz et al., 2012). Two RAPD-B/VAGP2 S. suis serotype 2 isolates from a diseased pig and a non-meningitis human patient were identified to be ST104, a result that



K. Maneerat et al.

is similar to a recent report identifying this ST as a new and unique sequence type found in meningitis patients in Thailand (Kerdsin et al., 2011). Although, these isolates were epf /mrp (VAGP2), similar to those of the S. suis serotype 2 isolates from diseased pigs in North America, their ST was different (Fittipaldi et al., 2009, 2011). The epf /mrp North American S. suis serotype 2 isolates were ST25, which may explain the low incidence of human zoonotic infections in that continent when compared to Thailand. This information indicates that there is a selective pressure on the S. suis ST1 and ST104 clones in pigs to be zoonotically transmitted to humans in Thailand. In this study, two unique STs were found in asymptomatic serotype 2 pig isolates: one with an epf /mrp /sly genotype (VAGP3), belonging to the RAPD-C pattern, was identified as ST233, and the other as VAGP4 (mrp )/ RAPD-D was identified as a newly discovered ST, ST336. The latter ST was assigned to a separate branch of the dendrogram. To date, S. suis serotype 2 clones associated with zoonotic disease in the different regions of the world appear to be unique and diverse based on MLST results (Kerdsin et al., 2011; Schultsz et al., 2012). Although, an ST233 and a new ST336 isolate were only collected from asymptomatic pigs, their RAPD patterns revealed similarities to isolates with RAPD-B pattern recovered from human and diseased pig. Therefore, their zoonotic potential cannot be excluded. In conclusion, the results obtained in this study indicate that virulence gene profiles can be correlated with both the RAPD patterns and STs for different S. suis serotype 2 isolates in Thailand. Our findings, the first pertaining to isolates from Thailand, partially elucidate the genetic relationships and confirm the zoonotic transmission of S. suis isolates from pigs to human for certain STs such as ST1 and ST104. Acknowledgements This study was financed by the Office of the National Research Council of Thailand to Thammasat University and the Higher Education Research Promotion and National Research University Project of Thailand, Office of the Higher Education Commission. K.M. was supported by the Thailand Graduate Institute of Science and Technology (TGIST; TG-22-13-51-008D). P.S. is the TRF scholar (MRG5180235). The authors thank Sonia Lacouture for technical assistance. This work has been presented in part at the Joint Conference on Emerging and Re-Emerging Epidemics Affecting Global Health 2012. Conflicts of interest The authors declare that they have no financial conflict of interest.

References Allen, A., H. Lindsay, D. Seilly, S. Bolitho, S. Peters, and D. Maskell, 2004: Identification and characterization of hyaluronatelyase from Streptococcus suis. Microb. Pathog. 36, 327–335. Chatellier, S., M. Gottschalk, R. Higgens, R. Brousseau, and J. Harel, 1999: Relatedness of Streptococcus suis serotype 2 isolates from different geographic origins as evaluated by molecular fingerprinting and phenotyping. J. Clin. Microbiol. 37, 362–366. Fittipaldi, N., T. Fuller, J. Teel, T. Wilson, T. Wolfram, D. Lowery, and M. Gottschalk, 2009: Serotype distribution and production of muramidase-released protein, extracellular factor and suilysin by field strains of Streptococcus suis isolated in the United States. Vet. Microbiol. 139, 310–317. Fittipaldi, N., J. Xu, S. Lacouture, P. Tharavichitkul, M. Osaki, T. Sekizaki, D. Takamatsu, and M. Gottschalk, 2011: Lineage and virulence of Streptococcus suis serotype 2 isolates from North America. Emerg. Infect. Dis. 17, 2239–2244. Fittipaldi, N., M. Segura, D. Grenier, and M. Gottschalk, 2012: Virulence factors involved in the pathogenesis of the infection caused by the swine pathogen and zoonotic agent Streptococcus suis. Future Microbiol. 7, 259–279. Fongcom, A., S. Pruksakorn, R. Mongkol, P. Tharavichitkul, and N. Yoonim, 2001: Streptococcus suis infection in northern Thailand. J. Med. Assoc. Thai. 84, 1502–1508. Galina, L., U. Vecht, H. J. Wisselink, and C. Pijoan, 1996: Prevalence of various phenotypes of Streptococcus suis isolated from swine in the U.S.A. based on the presence of muramidasereleased protein and extracellular factor. Can. J. Vet. Res. 60, 72–74. Gottschalk, M., and M. Segura, 2000: The pathogenesis of the meningitis caused by Streptococcus suis: the unresolved questions. Vet. Microbiol. 76, 259–272. Higgins, R., and M. Gottschalk, 1999: Distribution of Streptococcus suis capsular types in 1998. Can. Vet. J. 40, 277. Hommez, J., L. Devriese, J. Henrichsen, and F. Castryck, 1986: Identification and characterization of Streptococcus suis. Vet. Microbiol. 11, 349–355. Kerdsin, A., S. Dejsirilert, P. Puangpatra, S. Sripakdee, K. Chumla, N. Boonkerd, P. Polwichai, S. Tanimura, D. Takeuchi, T. Nakayama, S. Nakamura, Y. Akeda, M. Gottschalk, P. Sawanpanyalert, and K. Oishi, 2011: Genotypic profile of Streptococcus suis serotype 2 and clinical features of infection in humans, Thailand. Emerg. Infect. Dis. 17, 835–842. Khadthasrima, N., T. Hannwong, P. Thammawitjaya, D. Pingsusean, B. Akkanij, A. Jaikhar, P. Paungmali, P. Yudee, S. Wongyai, S. Samerchea, S. Tipsriraj, S. Pruksakorn, D. Sutdan, T. Noimoh, M. Chalamaat, P. Samitsuwan, T. Chuxnum, and D. Areechokchai, 2008: Human Streptococcus suis outbreak in Phayao Province, Thailand, 2007. OSIR; 1 Available at http//203.157.15.15/osirjournal/issue.php?id = 3 (accessed October 10, 2012). Kim, D., K. Han, Y. Oh, C. H. Kim, I. Kang, J. Lee, M. Gottschalk, and C. Chae, 2010: Distribution of capsular


77


K. Maneerat et al.

serotypes and virulence markers of Streptococcus suis isolated from pigs with polyserositis in Korea. Can. J. Vet. Res. 74, 314–316. King, S. J., J. A. Leigh, P. J. Heath, I. Luque, C. Tarradas, C. G. Dowson, and A. M. Whatmore, 2002: Development of a multilocus sequence typing scheme for the pig pathogen Streptococcus suis: identification of virulent clones and potential capsular serotype exchange. J. Clin. Microbiol. 40, 3671–3680. King, S. J., A. G. Allen, D. J. Maskell, C. J. Dowson, and A. M. Whatmore, 2004: Distribution, genetic diversity, and variable expression of the gene encoding hyaluronatelyase within the Streptococcus suis population. Bacteriol. 186, 4740–4747. Mai, N. T., N. T. Hoa, T. V. T. Nga, L. D. Linh, T. T. H. Chau, D. X. Sinh, N. H. Phu, L. V. Chuong, T. S. Diep, J. Campbell, H. D. T. Nghial, T. N. Minh, N. V. V. Chaul, and M. D. Jong, 2008: Streptococcus suis meningitis in adults in Vietnam. Clin. Infect. Dis. 46, 659–667. Maiden, M. C., 2006: Multilocus sequence typing of bacteria. Annu. Rev. Microbiol. 60, 561–588. Marois, C., S. Bougeard, M. Gottschalk, and M. Kobisch, 2004: Multiplex PCR assay for detection of Streptococcus suis species and serotypes 2 and 1/2 in tonsils of live and dead pigs. J. Clin. Microbiol. 42, 3169–3175. Martinez, G., A. F. P. Castro, K. J. R. Pagnani, G. Nakazato, W. D. Silverira, and M. Gottschalk, 2003: Clonal distribution of an atypical MRP+, EF*, and suilysin+ phenotype of virulent Streptococcus suis serotype 2 strains in Brazil. Can. J. Vet. Res. 67, 52–55. National Institute of animal Health Thailand: 2012 Incidence of swine Streptococcus suis in Thailand. Availabe at http://dld.go. th/niah/AnimalDisease/index.html (accessed August 26, 2012). Ngo, T.H., T. B. Tran, T. T. Tran, V. D. Nguyen, J. Campbell, H. A. Pham, H. T. Huynh, V. V. Nguyen, J. E. Bryant, T. H. Tran, J. Farrar, and C. Schultsz, 2011: Slaughterhouse pigs are a major reservoir of Streptococcus suis serotype 2 capable of causing human infection in southern Vietnam. PLoS ONE 6 (3), e17943. Okwumabua, O., and S. Chinnapapakkagari, 2005: Identification of the gene encoding a 38-kilodalton immunogenic and protective antigen of Streptococcus suis. Clin. Diagn. Lab. Immunol. 12, 484–490. Okwumabua, O., M. O. Connor, and E. Shull, 2003: A polymerase chain reaction (PCR) assay specific for Streptococcus suis based on the gene encoding the glutamate dehydrogenase. FEMS Microbiol. Let. 218, 79–84. Perch, B., P. Kristjansen, and K. Skadhauge, 1968: Group R streptococci pathogenic for man Two cases of meningitis and one fatal case of sepsis. Acta. Pathol. Microbiol. Scand. 74, 69–76. Phuapradit, P., P. Boongrid, S. Boonyakarnkub, S. Niramarnsakul, S. Ponglikitmongkol, M. Vorachit, and P. Jayanetra, 1987: Meningitis cause by Streptococcus suis. Intern. Med. 3, 120–122.

78

Rehm, T., C. G. Baums, B. Strommenger, M. Beyerbach, P. V. Weigand, and R. Goethe, 2007: Amplified fragment length polymorphism of Streptococcus suis strains correlates with their profile of virulence-associated genes and clinical background. J. Med. Microbiol. 56, 102–109. Schultsz, C., E. Jansen, W. Keijzers, A. Rothkamp, B. Duim, J. A. Wagenaar, and A. Ende, 2012: Differences in the population structure of invasive Streptococcus suis strains isolated from pigs and from humans in the Netherlands. PLoS ONE 7, e33854. Sihvonen, L., D. N. Kurl, and J. Henrichsen, 1988: Streptococcus suis isolated from pigs in Finland. Acta Vet. Scand. 29, 9–13. Silva, L., C. Baums, T. Rehm, H. Wisselink, R. Goethe, and P. V. Weigand, 2006: Virulence-associated gene profiling of Streptococcus suis isolates by PCR. Vet.Microbiol. 115, 117–127. Smith, H. E., V. Veenbergen, J. V. D. Velde, M. Damman, H. J. Wisselink, and M. A. Smits, 1999: The cps genes of Streptococcus suis serotypes 1, 2, and 9: development of rapid serotypespecific PCR assays. J. Clin. Microbiol. 37, 3146–3152. Suankratay, C., P. Intalapaporn1, P. Nunthapisud, K. Arunyingmongkol, and H. Wilde, 2004: Streptococcus suis meningitis in Thailand. Southeast Asian J. Trop. Med. Public Health. 35, 868–876. Tang, J., C. Wang, Y. Feng, W. Yang, H. Song, Z. Chen, H. Yu, X. Pan, X. Zhou, H. Wang, B. Wu, H. Wang, H. Zhao, Y. Lin, J. Yue, Z. Wu, X. He, F. Gao, A. H. Khan, J. Wang, G. P. Zhao, Y. Wang, X. Wang, Z. Chen, and G. F. Gao, 2006: Streptococcal toxic shock syndrome caused by Streptococcus suis serotype 2. PLoS Med. 3, e151. Tarradas, C., A. Arenas, A. Maldonado, I. Luque, A. Miranda, and A. Perea, 1994: Identification of Streptococcus suis isolated from swine: proposal for biochemical parameters. J. Clin. Microbiol. 32, 578–580. Thai Livestock Farmer Database System, Department of Livestock Development, Ministry of Agricultural and Cooperatives, Thailand, 2011: Available at http://survey.dld.go.th/ (accessed August 26, 2012) Tikkanen, K., S. Haataja, and J. Finne, 1996: The galactosyl(alpha 1-4)-galactose-binding adhesin of Streptococcus suis: occurrence in strains of different hemagglutination activities and induction of opsonic antibodies. Infect. Immun. 64, 3659– 3665. Touil, F., R. Higgins, and M. Nadeau, 1988: Isolation of Streptococcus suis from diseased pigs in Canada. Vet. Microbiol. 17, 171–177. Vilaichone, R., W. Vilaichone, P. Nunthapisud, and H. Wilde, 2002: Streptococcus suis infection in Thailand. J. Med. Assoc. Thai. 85(Suppl 1), S109–S117. Wangkaewa, S., R. Chaiwarith, P. Tharavichitkul, and K. Supparatpinyo, 2006: Streptococcus suis infection: a series of 41 cases from Chiang Mai University Hospital. J. Infect. 52, 455–460. Winterhoff, N., R. Goethe, P. Gruening, M. Rohde, H. Kalisz, H. E. Smith, and P. V. Weigand, 2002: Identification and characterization of two temperature-induced surface-associated



K. Maneerat et al.

proteins of Streptococcus suis with high homologies to members of the arginine deiminase system of Streptococcus pyogenes. J. Bacteriol. 184, 6768–6776. Yu, H., H. Jing, Z. Chen, H. Zheng, X. Zhu, H. Wang, S. Wang, L. Liu, R. Zu, L. Luo, N. Xiang, H. Liu, X. Liu, Y. Shu, S. S.

Lee, S. K. Chuang, Y. Wang, J. Xu, W. Yang, and the Streptococcus suis study groups 2, 2006: Human Streptococcus suis outbreak, Sichuan, China. Emerg. Infect. Dis. 12, 914–920.


79

Serotype- and virulence-associated gene profile of Streptococcus suis isolates from pig carcasses in Chiang Mai Province, Northern Thailand.

Genetic diversity of Streptococcus suis serotype 2 isolated from pigs in Brazil.

Capsular serotypes, virulence-associated genes and antimicrobial susceptibility of Streptococcus suis isolates from pigs in Korea.

Streptococcus suis Serotype 2 Capsule In Vivo.

GidA, a tRNA Modification Enzyme, Contributes to the Growth, and Virulence of Streptococcus suis Serotype 2.

Two Spx regulators modulate stress tolerance and virulence in Streptococcus suis serotype 2.

NisR contributes to the virulence of Streptococcus suis serotype 2.

Draft Genome Sequences of Streptococcus agalactiae Serotype Ia and III Isolates from Tilapia Farms in Thailand.

sly Genotypes of Human Streptococcus suis Serotype 2 in Northern Thailand.

Genetic diversity of geographically distinct Streptococcus dysgalactiae isolates from fish.

First human case report of sepsis due to infection with Streptococcus suis serotype 31 in Thailand.

Virulence Studies of Different Sequence Types and Geographical Origins of Streptococcus suis Serotype 2 in a Mouse Model of Infection.

Complex Population Structure and Virulence Differences among Serotype 2 Streptococcus suis Strains Belonging to Sequence Type 28.

Restoration of bioactive lantibiotic suicin from a remnant lan locus of pathogenic Streptococcus suis serotype 2.

Role of the capsular polysaccharide as a virulence factor for Streptococcus suis serotype 14.

Genetic diversity of Streptococcus suis isolated from three pig farms of China obtained by acquiring antibiotic resistance genes.

The protective protein Sao (surface antigen one) is not a critical virulence factor for Streptococcus suis serotype 2.

Characterisation of Streptococcus suis isolates from wild boars (Sus scrofa).

Streptococcus suis serotype 2 strains can induce the formation of neutrophil extracellular traps and evade trapping.

Whole-Genome Sequence of Streptococcus suis Serotype 3 Strain YB51.

Biofilm formation, host-cell adherence, and virulence genes regulation of Streptococcus suis in response to autoinducer-2 signaling.

Interactions of Streptococcus suis serotype 2 with human meningeal cells and astrocytes.

Genetic diversity and virulence potential of clinical and environmental Aeromonas spp. isolates from a diarrhea outbreak.

Streptococcus suis infection in hospitalized patients, Nakhon Phanom Province, Thailand.