Journal of Virological Methods 196 (2014) 204–211

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Extraction of total nucleic acid based on silica-coated magnetic particles for RT-qPCR detection of plant RNA virus/viroid Ning Sun a,b,c , Congliang Deng b , Xiaoli Zhao b , Qi Zhou b , Guanglu Ge c , Yi Liu b , Wenlong Yan d , Qiang Xia a,∗ a

State Key Laboratory of Bioelectronics, School of Biological Science and Medical Engineering, Southeast University, Nanjing 210096, China Beijing Entry-Exit Inspection and Quarantine Bureau, Beijing 100026, China c CAS Key Laboratory of Measurement and Standardization for Nanotechnology, National Center for Nanoscience and Technology, Beijing 100190, China d Grirem Advanced Materials Co., Ltd., National Engineering Research Center for Rare Earth Materials, General Research Institute for Nonferrous Metals, Beijing 100088, China b

a b s t r a c t Article history: Received 10 July 2013 Received in revised form 16 November 2013 Accepted 20 November 2013 Available online 28 November 2013 Keywords: Virus/viroid Nucleic acid extraction RT-qPCR Silica-coated magnetic particles

In this study, a nucleic acid extraction method based on silica-coated magnetic particles (SMPs) and RTqPCR assay was developed to detect Arabis mosaic virus (ArMV), Lily symptomless virus (LSV), Hop stunt viroid (HSVd) and grape yellow speckle viroid 1 (GYSVd-1). The amplification sequences of RT-qPCR were reversely transcribed in vitro as RNA standard templates. The standard curves covered six or seven orders of magnitude with a detection limit of 100 copies per each assay. Extraction efficiency of the SMPs method was evaluated by recovering spiked ssRNAs from plant samples and compared to two commercial kits (TRIzol and RNeasy Plant mini kit). Results showed that the recovery rate of SMPs method was comparable to the commercial kits when spiked ssRNAs were extracted from lily leaves, whereas it was two or three times higher than commercial kits when spiked ssRNAs were extracted from grapevine leaves. SMPs method was also used to extract viral nucleic acid from15 ArMV-positive lily leaf samples and 15 LSV-positive lily leaf samples. SMPs method did not show statistically significant difference from other methods on detecting ArMV, but LSV. The SMPs method has the same level of virus load as the TRIzol, and its mean virus load of was 0.5 log10 lower than the RNeasy Plant mini kit. Nucleic acid was extracted from 19 grapevine-leaf samples with SMPs and the two commercial kits and subsequently screened for HSVd and GYSVd-1 by RT-qPCR. Regardless of HSVd or GYSVd-1, SMPs method outperforms other methods on both positive rate and the viroid load. In conclusion, SMPs method was able to efficiently extract the nucleic acid of RNA viruses or viroids, especially grapevine viroids, from lily-leaf or grapevine-leaf samples for RT-qPCR detection. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Quantitative real-time polymerase chain reaction (qPCR) assay has been widely used to detect different plant viruses such as Sweetpotato viruses (Kokkinos and Clark, 2006), Rice stripe virus (Zhang et al., 2008), Tobacco ringspot virus (Shiller et al., 2010), Squash mosaic virus (Ling et al., 2011), Arabis mosaic virus (ArMV) (Lopez-Fabuel et al., 2013), Lily symptomless virus (LSV) (Wei et al., 2012). It is considered as a benchmark molecular diagnostic method in plant virology due to its sensitivity, specificity and relatively short time taking to finish the complete test (Lopez et al., 2009). However, sample processing and nucleic acid extraction is still a problem which adversely affects the application of RT-qPCR or qPCR assays (Nakaune and Nakano, 2006; Lopez et al., 2009; Osman et al.,

∗ Corresponding author. Tel.: +86 0512 62867117; fax: +86 0512 62867117. E-mail address: [email protected] (Q. Xia). 0166-0934/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2013.11.012

2012). Traditionally, sample preparation involves manual disruption and homogenization with the help of mortar and pestle under addition of liquid nitrogen, which is labor-intensive and timeconsuming, and is also subject to cross-contamination (Vincelli and Amsden, 2013). Recently, several tissue-disruption instruments, e.g., the Bioreba Extraction bags, HOMEX 6 homogeniser (Reinach, Switzerland) (Ling et al., 2011; Osman et al., 2012), Tissue Lyser (Qiagen, Germany) (Osman et al., 2012) and tissue homogenization (Retsch MM400, Germany), have been used to facilitate the sample preparation with a goal to minimize cross-contamination and achieve higher efficiency in tissue homogenization (Vincelli and Amsden, 2013). Material homogenization only disrupts the cells or tissues. Nucleic acid extraction method is consequently used to isolate and purify the nucleic acid from broken tissues or cells. Since plant materials are complicate and contain abundant polysaccharides and polyphenols which either has similar chemical property or has chemical reaction with RNA (Mumford et al.,

N. Sun et al. / Journal of Virological Methods 196 (2014) 204–211

205

2006; Schrader et al., 2012), nucleic acid extraction is a challenging task. Nucleic acid extraction method can be divided into two categories (Berensmeier, 2006; Xu et al., 2011). One category, including the guanidinium thiocyanate–phenol–chloroform method (Chomczynski and Sacchi, 2006) and cetyltrimethylammonium bromide-based method (Li et al., 2008), is dependent on aqueous-to-organic liquid stratification prior to precipitation of nucleic acid. The other category like Boom’s method (Boom et al., 1990) is solid-phase extraction where nucleic acid is adsorbed onto the surface of solid-phase materials. The common commercial kits such as RNeasy/DNeasy Plant mini kit (Qiagen, Germany) are based on solid-phase extraction and have been widely used for nucleic acid extraction from plant materials (Ling et al., 2011; Johnson and Walcott, 2012; Wei et al., 2012). With the increasing demands for high throughput sample tests in certification and quarantine programs, magnetic particles are well posed to extract nucleic acid automatically and efficiently, greatly simplifying the sample testing process. Up to now, a large number of modified magnetic particles are designed and used to extract nucleic acid from biological samples (Zhu et al., 2008; Intorasoot et al., 2009; Milia et al., 2010; Jiang et al., 2012). To the best of our knowledge, there are few reports about application of silica-coated magnetic particles (SMPs) to extract RNA of viruses or viroids from plant samples, and few studies reported the comparative evaluation of the commercial kits based on magnetic particles (Kim et al., 2009; Osman et al., 2012; Verheyen et al., 2012). In this study, plant RNA viruses and viroids including lily-infecting LSV and ArMV, and grapevine-infecting Hop stunt viroid (HSVd) and Grapevine yellow speckle viroid 1 (GYSVd-1) were selected as the study subjects. The nucleic acid extraction method based on SMPs for viruses and viroids detection was described in detail and compared with commercial kits.

tube submerged in liquid nitrogen for 30 s. After positioning the tube in the pre-chilled holder and fixing device, homogenization was carried out at 30 Hz for 1 min. Five hundred microliters of lysis buffer (4.5 M guanidinium thiocyanate, 100 mM Tris–HCl, 20 mM EDTA, 0.5% (wt/vol) N-LauroylSarcosine Sodium, 0.1% (vol/vol) Triton X-100, 10 mM sodium chloride, 25 mM citrate sodium, 2% (wt/vol) PVP, 0.3 M sodium acetate, pH 5.5) was immediately added into the tube and vigorously vortexed for 15 s. The lysates were subsequently incubated for 5 min at room temperature. After incubation the lysates were centrifuged at 12,000 × g for 2 min. Two hundred microliters of clear supernatant was transfer to a new tube (the volume of the lysate should be more than 400 ␮l) and mixed with 200 ␮l of SMPs (if the plant samples contain high levels of the polysaccharides and polyphenols, the volume of ethanol should be decreased to half). And then the mixture was incubated for 10 min at room temperature. Discard the supernatant after SMPs were collected from mixture using DynaMagTM -2 Magnet (life technology, USA). To redisperse SMPs completely, 500 ␮l of washing buffer I (2.0 M guanidinium thiocyanate, 100 mM Tris–HCl, 20 mM EDTA, pH value adjusted to 5.5 and mix with isovolumetric 100% ethanol) was added to redisperse SMPs completely. The SMPs were washed twice with 100% ethanol and 70% ethanol. The SMPs mixture was incubated for 10 min after adding 50 ␮l of TE buffer (10 mM Tris–HCl, 1 mM EDTA, adjusted pH value to 8.0). Finally, supernatant was transferred to a new tube and stored at −80 ◦ C after SMPs were collected with DynaMagTM -2 Magnet. TRIzol and RNeasy Plant kit were used to extract viral RNA as recommended by the manufacture. To compare to the SMPs method, the extracts were dissolved in 100 ␮l of RNase-free water. Ten microliters of the nucleic acid extract from lily leaves and grapevine leaves was analyzed using 1% agarose gel containing DuRed nucleic acid gel stain (FANBO CHEMICALS Co., Ltd., China).

2. Materials and methods

2.4. Primers and probes

2.1. Plant materials

The primers and TaqMan probes (TaKaRa Biotechnology, Dalian, China) used for transcription in vitro were listed in Table 1. According to the alignments of the conserved sequences of each pathogen in the GeneBank, the primers with T7 promoter and six protecting bases at the sense primer terminals were designed and used for the transcription in vitro. TaqMan probes used for RT-qPCR, which were labeled with FAM and BHQ1 at the both terminals, had been validated in our laboratory.

Lily leaf samples including 15 LSV-infected and 15 ArMVinfected, which were intercepted by Beijing Entry-exit Inspection and Quarantine Bureau of China, were collected from a biological isolation greenhouse. Nineteen grapevine leaf samples were obtained from vineyards in Shandong province (China) during the summer of 2012. All the samples were screened by RT-qPCR using SMPs method, TRIzol, and RNeasy Plant mini kit for nucleic acid extraction. When detection result from all methods was negative, the negative sample was used as no-template control. 2.2. Preparation of silica-coated magnetic particles SMPs were prepared by encapsulating magnetic Fe3 O4 nanoparticles synthesized by thermal decomposition method with tetraethylorthosilicate (TEOS) hydrolysis (Stöber et al., 1968; Li et al., 2011). SMPs were dispersed and ultrasonicated for 10 min in acidic ethanol (contain 10% (wt/wt) of hydrochloric acid), and then washed with ethanol and deionized water. SMPs were dispersed in 100% alcohol with a concentration of 20 mg/ml. 2.3. Extraction of total nucleic acid To homogenize the samples and reduce the errors from manual handling, all samples were lyophilized with vacuum freezedrying apparatus before automated tissue homogenization (Retsch MM400, Germany) was used in the sample processing. The use of SMPs for extracting total nucleic acids from plant materials was described as follows. Fifty milligrams of sample was cut into small pieces before to fill into a pre-chilled 1.5-ml tube. The

2.5. RT-PCR and RT-qPCR RT-qPCR was performed in two steps. The cDNA was synthesized using reverse transcriptase M-MLV (TaKaRa Biotech., Dalian, China). In brief, 5 ␮l of RNA was mixed with 1.0 ␮l of antisense primer (10 ␮M) or 1.0 ␮l of random primer (25 ␮M) and incubated 10 min at 70 ◦ C in waterbath. The mixture was put on ice immediately for 2 min. Two microliters of 1× M-MLV Buffer (TaKaRa Biotech., Dalian, China), 0.5 ␮l of dNTP mixture (10 mM each), 0.25 ␮l of RNase inhibitor (40 U/␮l, TaKaRa Biotech., Dalian, China) and 0.25 ␮l of M-MLV (RNase H−) (200 U/␮l, TaKaRa Biotech., Dalian, China) were added into the mixture and the total volume is to 10 ␮l by adding the molecule-grade water free of RNase. The mixture was incubated for 60 min at 42 ◦ C then 15 min at 70 ◦ C to terminate the reaction. PCR was performed in a 20-␮l volume containing 2 ␮l of cDNA, 2 ␮l of 1× PCR buffer containing 2 mM MgCl2 (TaKaRa Biotech., Dalian, China), 0.5 ␮l of dNTP mixture (10 mM each, TaKaRa Biotech., Dalian, China), 0.4 ␮l of antisense primer (ArMV RP2, LSV RP2, HSVd RP2, or GY RP2, 10 ␮M each), 0.4 ␮l of sense primer (ArMV FP2, LSV FP2, HSVd FP2, or GY FP2, 10 ␮M each) and 0.2 ␮l of Taq polymerase (5 U/␮l, TaKaRa Biotech., Dalian, China). PCR was carried out by using the ABI 2720 PCR

206

N. Sun et al. / Journal of Virological Methods 196 (2014) 204–211

Table 1 Primers and probes used in this study. Name

Sequence (5 –3 )a , b

ArMV FP ArMV RP ArMV probe ArMV FP2 ArMV RP2

GCACTGTAGCCCTTGGAGATAATCC CCCTCCAAATCCCACATTAACTTA CTCACATGATAGCTTGTCATGGACTCC GATCACtaatacgactcactatagggTCATTTCACATGCCTCAC TCTGTAAAGCACAAACACG

LSV FP LSV RP LSV probe LSV FP2 LSV RP2

CCCCTACGGGAGATTCTCAA GGTTGCCATGTTGTTAGATACGA TGACGAACTCTTCAAGATGAAGGTTGGC GATCACtaatacgactcactatagggATGCAATCAAGACCAGCACAA TCATCCTATATTTGCGTATCGA

HSVd FP HSVd RP HSVd probe HSVd FP2 HSVd RP2

CCGCGGATCCTCTCTTGA CCGGGGCTCCTTTCTCAG CTGGGGAATTCTCGAGTTGCCGCA GATCACtaatacgactcactatagggAACCCGGGGCAACTCTTCTC AACCCGGGGCTCCTTTCTCA

GY FP GY RP GY probe GY FP2 GY RP2

CTTGTGGTTCCTGTGGTTTCAC CCTCTGCCCCTATCTTCTTCTTT AAGGCCGCCGCGGACCTG GATCACtaatacgactcactatagggTCGAGCGGACTTGGTCTCT ACTAGCGGAGGCATCCTCA

a b

Pathogen and GenBank accession no.

Primer position

ArMV EU433920

1181–1205 1257–1280 1211–1237 438–455 1360–1378

LSV AJ516059

HSVd NC 001351

GYSVd-1 JQ686711

7397–7416 7447–7469 7418–7445 7140–7160 7973–7994 279–296 65–82 1–24 78–95 66–83 17–38 63–85 44–61 267–285 251–267

Product size (bp)

100 941

73 855

106 307

69 368

Protecting bases are shown in boldface. T7 promoter at the 5 terminal of sense primer are shown in lowercase.

system involving the following steps: initial denaturation at 95 ◦ C for 5 min; 35 cycles of 95 ◦ C for 30 s, 55 ◦ C for 30 s, 72 ◦ C for 30 s; final extension at 72 ◦ C for 10 min. RT-qPCR was performed in ABI 7900HT real-time PCR system and the one-step PrimeScript® RT-PCR Kit (TaKaRa Biotech., Dalian, China) was used for amplification. The protocol was optimized for the concentration of primer and probe. Amplification was carried out in 25-␮l reaction volume which consists of 12.5 ␮l of 1× One Step RT-PCR buffer III, 0.5 ␮l of TaKaRa Ex TaqHS (5 U/␮l), 0.5 ␮l of PrimeScript RT Enzyme Mix II, 0.5 ␮l of ROX Reference Dye (50×), 1.0 ␮l of sense primer (10 ␮M), 1.0 ␮l of antisense primer (10 ␮M), 0.4 ␮l of TaqMan probe (10 ␮M), and 5 ␮l of RNA. All Ct values were calculated automatically by SDS 2.4 software (Applied Biosystem).

2.6. In vitro transcription and standard curve The sequence containing RT-qPCR amplification region was purified and cloned into the pMD® 18-T Vector (TaKaRa) for sequencing. The linear PCR products including T7 promoter were reversely transcribed and digested with DNase I using the In vitro Transcription T7 Kit (TaKaRa Biotech., Dalian, China). The singlestranded RNA was purified and its concentration was quantitated by a spectrophotometer (NanoDrop Nano-1000, Thermo scientific). Tenfold serial dilutions of each transcript (ArMV, HSVd, and GYSVd-1) for RT-qPCR amplification were prepared in triplicate using RNase-free water with a range from 109 to 102 copies per 5 ␮l, and the concentration of LSV is from 108 to 102 copies per 5 ␮l. These dilutions were stored at −80 ◦ C and prepared for one-step RT-qPCR.

2.7. Assessment of viral nucleic acid extraction method To assess accurately the efficiency of SMPs method used for extracting viral nucleic acid from plant materials, nucleic acid of the negative homogenized samples spiked with known copy transcripts were extracted by SMPs method. Typically, 107 copies of LSV transcripts and 106 HSVd transcripts were respectively spiked into 200-␮l lysates of lily leaf homogenization and grapevine leaf homogenization after the addition of lysis buffer. The spiked transcripts were extracted using SMPs method and quantitated by

RT-qPCR, and the results were compared with both TRIzol and RNeasy Plant mini kit. It is well known that impurities in nucleic acid extracts had an inhibitory effect on enzyme reaction (Mumford et al., 2006; Schrader et al., 2012). Thus, single-stranded RNAs from transcription in vitro were serially tenfold diluted using SMPs extracts from negative material samples and molecule-grade RNase-free water (Kokkinos and Clark, 2006). These dilutions were used as the templates in RT-qPCR for the assessment of inhibitory effect of RT-qPCR. 2.8. Statistical analysis Experimental data were analyzed by SPSS Statistics 19 (SPSS Inc., Chicago, USA). Ct values, which are defined as quantification cycle representing the crossing point between fluorescent value and threshold, were calculated automatically by the SDS 2.4 software (Applied Biosystems). The recovery differences among three nucleic acid extraction methods (SMPs, TRIzol and RNeasy Plant mini kit) were determined by Student’s t-test in SPSS Statistics 19 (SPSS Inc., Chicago, USA). In all cases, the confident interval was set at 95%. 3. Results 3.1. In vitro transcription and standard curve All transcription regions in vitro covered the entire amplification sequences of RT-qPCR (Table 1). The products were purified and quantitated after double-stranded DNAs were digested with DNase I (TaKaRa Biotech., Dalian, China). Each of single-stranded RNAs from transcription in vitro was tenfold serially diluted by moleculegrade water in triplicate and determined by RT-qPCR. Since each transcript includes all viral amplification regions of RT-qPCR, the copies of transcripts are equivalent to viral gene copies. The relationship between Ct values and the logarithm of gene copies was analyzed by linear regression analysis (Fig. 1). The standard curves cover a range from 102 to 109 copies for ArMV, HSVd, and GYSVd1, while the standard curve is from 102 to 108 copies for LSV. The slopes and correlation coefficients (R2 ) indicated the standard curves can be used for calibrating and quantitating the load of viruses or viroids.

N. Sun et al. / Journal of Virological Methods 196 (2014) 204–211

207

Fig. 1. Standard curves obtained by plotting Ct values vs. log copy number of ArMV, LSV, HSVd, or GYSVd-1 transcripts. Tenfold serial dilutions of transcripts (102 to 109 copies for ArMV, HSVd, and GYSVd-1; 102 to 108 copies for LSV) were tested by RT-qPCR in triplicate. The Ct values for each dilution are the mean of three replicates. The slopes and correlation coefficients (R2 ) were calculated and shown in the figure.

3.2. Nucleic acid extraction and recovery

3.3. Evaluation of inhibitory effect

Nucleic acids were extracted by SMPs method, TRIzol, and RNeasy Plant mini kit (Fig. 2). As shown in Fig. 2, nucleic acids extracted from lily leaves by these three methods were of good integrity (Fig. 2A). Compared to the commercial kits, the concentration of nucleic acid extracted from grapevine leaves by SMPs method was higher (Fig. 2B). Although the integrity of nucleic acid extracted from grapevine leaf samples using SMPs method is not good, the concentration of viroid nucleic acid is high enough to be detected by RT-qPCR. The SMPs method was used with lysis buffer consisting of highconcentration guanidine thiocyanate according to previous reports with some modifications (Boom et al., 1990; Jiang et al., 2012). In order to assess and compare the extracting efficiency of SMPs method, single-stranded RNAs of different lengths, LSV transcripts and HSVd transcripts, were used respectively to spike the lysates of lyophilized lily leaves and grapevine leaves. The spiked ssRNAs were extracted by the SMPs method and the commercial kits (TRIzol and RNeasy Plant mini kit). The recovered ssRNAs were quantitated by RT-qPCR and the recovery rates were calculated (Table 2). There is no significant difference on the recovery of the spiked LSV transcripts from lily leaves among these three methods (P > 0.05, Student’s t-test). However, for grapevine the recovery rate of SMPs method was approximately three times higher than TRIzol and two times higher than RNeasy Plant mini kit, respectively (P < 0.05, Student’s t-test) (Table 2). Furthermore, the recovery rate of the spiked 107 copies was lower than that of the spiked 106 copies for SMPs method (Table 2).

The nucleic acids extracted from plant materials usually contain phenolic and polysaccharide contaminants which could inhibit the subsequent detections (Kokkinos and Clark, 2006; Mumford et al., 2006; Schrader et al., 2012). To evaluate inhibitory effect, ssRNAs, which were serially tenfold diluted by molecule-grade water and extracts obtained from lily leaves or grapevine leaves using SMPs method, were amplified with RT-qPCR (Fig. 3). The Ct values of RT-qPCR did not show any significant difference in Student’s ttest (LSV: P = 0.128, HSVd: P = 0.156). The results indicate that the extracts used for diluting the ssRNAs have no inhibitory effect on RT-qPCR and the method based on SMPs is suitable for extracting viral nucleic acid from plant materials. 3.4. Comparison of nucleic acid extraction methods for virus/viroid detection Viral nucleic acids were extracted from two groups of lily leaf samples (one group including 15 samples infected by LSV, and another group including 15 samples infected by ArMV) using SMPs method, TRIzol, and RNeasy Plant mini kit, and subsequently quantitated by RT-qPCR assay. The mean LSV loads of the positive samples were 6.36 ± 0.96 log10 (SMPs method), 6.53 ± 1.03 log10 (TRIzol), and 6.87 ± 1.11 log10 (RNeasy Plant mini kit). The LSV loads using SMPs method were lower than those obtained from the other methods. The difference between SMPs and TRIzol was not significant (P = 0.064), but it was significantly different from RNeasy Plant mini kit (P < 0.05) (Fig. 4A). For detecting ArMV, the mean

208

N. Sun et al. / Journal of Virological Methods 196 (2014) 204–211

Fig. 2. Agarose gel electrophoresis analysis of nucleic acid extracted from lily leaves (A, lanes 1–4, SMPs method, lanes 5–6, RNeasy Plant mini kit, lanes 9–12, TRIzol, lane M, DL2000 marker (TaKaRa Biotech., Dalian, China)) and grapevine leaves (B, lanes 1–4, TRIzol, lanes 5–8, SMPs method, lanes 9–12, RNeasy Plant mini kit). The concentration of agarose was 1% (wt/vol).

Table 2 Recovery of the spiked ssRNA with three extraction methods. Materials

Spiked ssRNA (copies)

Nucleic acid extraction methods SMPs

TRIzol

Recovery

Recovery rate

Recovery

RNeasy Plant mini kit Recovery rate

Recovery

6

7

Lily leaves

10 106

6

(0.90 ± 0.25) × 10 (1.51 ± 0.59) × 105

9.0 15.1

(1.17 ± 0.57) × 10 (1.81 ± 0.98) × 105

Grapevine leaves

107 106

(1.11 ± 0.19) × 106 (2.65 ± 0.40) × 105

11.1 26.5

(0.34 ± 0.04) × 106 (1.46 ± 0.26) × 105

ArMV loads of the samples were 6.19 ± 1.85 log10 (SMPs method), 6.42 ± 1.72 log10 (TRIzol), and 6.02 ± 1.68 log10 (RNeasy Plant mini kit), and Student’s t-test indicated that there is no significant difference among these three methods (P = 0.068 or 0.305) (Fig. 4B). For the 19 grapevine-leaf specimens, the positive rates are different among these three methods. The SMPs method produced the highest rate (18/19) on both HSVd and GYSVd-1 (Table 3). When using RNeasy Plant mini kit, there were 16 HSVd-positive and 13 GYSVd-1-positive specimens, and the positive rate was lower than SMPs method (Table 3). For TRIzol, only 9 and 3 specimens were considered to be positive for HSVd and GYSVd-1 respectively (Table 3) and all the Ct value was above than 30. Comparisons of the viroid loads of the positive samples using SMPs method and RNeasy Plant mini kit suggested that the quality of nucleic acids of HSVd and GYSVd-1 extracted from grapevine leaf samples by SMPs method are higher than RNeasy Plant mini kit. The difference between the two methods is significant (P < 0.05) (Fig. 4C and D). 4. Discussion For RNA virus or viroid, ssRNA from transcription in vitro is a better choice than DNA plasmids in plotting the standard curves

Recovery rate

11.7 18.1

6

(1.47 ± 0.43) × 10 (1.44 ± 0.76) × 105

14.7 14.4

3.4 14.6

(0.57 ± 0.06) × 106 (1.84 ± 0.26) × 105

5.7 18.4

for calibration (Bustin, 2000). In the experiments, the sensitivity of RT-qPCR assays is up to 100 copies per each reaction and the standard curves cover six or seven orders of magnitude with reasonable linearity, which can be used to quantify the loads of virus/viroid. Even if the loads of virus/viroid can be calculated using standard curves, the results represent only the viral copies of extracts but not the initial samples due to loss of viral nucleic acid in the extraction. Therefore, the actual virus loads are usually more than the calculated. The recovery rates of these three methods (TRIzol, RNeasy Plant mini kit, and SMPs method) were evaluated by known-amount ssRNAs spiked into the lysate (Table 2). This result is similar to the recovery of hepatitis A virus and Bacillus anthracis spores respectively from spinach and feed matrices using commercial kits (Hida et al., 2013). However, this result was based on our hypothesis that the recovery of nucleic acid of virus or viroid is determined when the nucleic acids of viruses or viroids are free in the lysis buffer. Magnetic particles have been widely used to extract nucleic acid from various biological samples, especially from medical samples (Kim et al., 2009; Milia et al., 2010; Shan et al., 2012). However, two crucial issues associated with virus or viroid nucleic acid extraction, the extracted quality of nucleic acid and inhibitory effect

N. Sun et al. / Journal of Virological Methods 196 (2014) 204–211

209

Fig. 3. Evaluation of inhibitory effect on RT-PCR. LSV ssRNA and HSVd ssRNA were tested by RT-qPCR in triplicate before they were serially tenfold diluted by molecule-grade water (white columns) and extracts (gray columns) from lily leaves (for LSV) or grapevine leaves (for HSVd), respectively. The Ct values for each dilution were the mean of three replicates.

Fig. 4. Comparisons of virus/viroid load by using the different extraction methods.

210

N. Sun et al. / Journal of Virological Methods 196 (2014) 204–211

Table 3 Comparison on extracting nucleic acid for detection of HSVd and GYSVd-1. Virus/viroid

Total no. of specimens

Nucleic acid extraction methods SMPs

HSVd GYSVd-1

19 grapevine leaf samples

of RT-qPCR, need to be solved. Because plant tissues are complicated, it is unlikely that one nucleic acid extraction method is applicable for any plant sample (Osman et al., 2012). Furthermore, because the capacity of every nucleic acid extraction method is limited and the genomes and structures of virus or viroid are diverse (e.g., the genomes of LSV and ArMV are longer than 18S rRNA while the genomes of HSVd and GYSVd-1 are shorter than 18S rRNA), the interaction between nucleic acids and disruptors such as polysaccharides and polyphenols from host may exhibit different competitive and inhibitory effects (Mumford et al., 2006; Schrader et al., 2012). Since impurities in the extracts could not be removed completely, the Ct value of ssRNA diluted by extracts was a bit higher than those diluted by molecular-grade water in spite of the statistically insignificant difference (Fig. 3). The RNeasy Plant mini kit utilizes the spin column chromatography, and TRIzol uses the aqueous-to-organic liquid stratification and isopropanol precipitation (Lopez-Fabuel et al., 2013), whereas SMPs method depends on magnetic particles adsorption. These three methods have different mechanisms. Magnetic particles have more opportunities to interact with nucleic acids as long as nucleic acids are released completely in the homogenized samples. Compared to TRIzol, there are no significant differences on ArMV and LSV detection using SMPs method (Fig. 4A and B). The difference is insignificant between SMPs method and RNeasy Plant mini kit on detecting ArMV, but the mean virus load using SMPs method is 0.5 log10 less than RNeasy Plant mini kit for LSV detection. For detecting grapevines infected by HSVd and GYSVd-1, the positive rates using TRIzol are far below the two other methods, which indicates that it is not suitable for extracting viroid nucleic acid from grapevine leaves. Comparison of extracting nucleic acids of HSVd and GYSVd-1 from grapevine leaves between RNeasy Plant mini kit and SMPs method shows that the positive rate of the latter was slightly higher, and significant difference was found. In summary, SMPs method is able to extract nucleic acid of RNA virus/viroid from plant samples. In conclusion, a rapid and simple method has been described in detail for extracting total nucleic acids from plant samples based on silica-coated magnetic particles. The recovery of ssRNA and inhibitory effect on RT-qPCR were evaluated and the results suggested that SMPs method can effectively extract RNAs from plant samples without inhibitory effect. Furthermore, the SMPs method is easy to perform with an automatic system, which makes it ideal for high-throughput sample analysis. Finally, SMPs method is cost effective without the need of expensive automatic commercial kit.

Acknowledgment This work was supported by a Special Fund for the Study of Automatic Detecting for Plant Virus Based on Magnetic Nanobeads (201110035) from General Administration of Quality Supervision.

References Berensmeier, S., 2006. Magnetic particles for the separation and purification of nucleic acids. Appl. Microbiol. Biotechnol. 73, 495–504.

TRIzol

n

%

n

18 18

94.74 94.74

9 3

RNeasy Plant mini kit % 47.37 15.79

n

%

16 13

84.21 68.42

Boom, R., Sol, C.J., Salimans, M.M., Jansen, C.L., Wertheim-van Dillen, P.M., van der Noordaa, J., 1990. Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 3, 495–503. Bustin, S.A., 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, 169–193. Chomczynski, P., Sacchi, N., 2006. The single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction: twenty-something years on. Nat. Protoc. 1, 581–585. Hida, K., Kulka, M., Papafragkou, E., 2013. Development of a rapid total nucleic acid extraction method for the isolation of hepatitis A virus from fresh produce. Int. J. Food Microbiol. 161, 143–150. Intorasoot, S., Srirung, R., Intorasoot, A., Ngamratanapaiboon, S., 2009. Application of gelatin-coated magnetic particles for isolation of genomic DNA from bacterial cells. Anal. Biochem. 386, 291–292. Jiang, C., Xu, S., Zhang, S., Jia, L., 2012. Chitosan functionalized magnetic particle-assisted detection of genetically modified soybeans based on polymerase chain reaction and capillary electrophoresis. Anal. Biochem. 420, 20–25. Johnson, K.L., Walcott, R.R., 2012. Progress towards a real-time PCR assay for the simultaneous detection of Clavibacter michiganensis subsp michiganensis and Pepino mosaic virus in tomato seed. J. Phytopathol. 160, 353–363. Kim, S., Park, S.-J., Namgoong, S., Sung, H., Kim, M.-N., 2009. Comparative evaluation of two automated systems for nucleic acid extraction of BK virus: NucliSens easyMAG versus BioRobot MDx. J. Virol. Methods 162, 208–212. Kokkinos, C.D., Clark, C.A., 2006. Real-time PCR assays for detection and quantification of sweetpotato viruses. Plant Dis. 90, 783–788. Li, R., Mock, R., Huang, Q., Abad, J., Hartung, J., Kinard, G., 2008. A reliable and inexpensive method of nucleic acid extraction for the PCR-based detection of diverse plant pathogens. J. Virol. Methods 154, 48–55. Li, X.Y., Tang, Y., Ge, G.L., 2011. Preparation and xi-potential characterization of highly dispersible phosphate – functionalized magnetite nanoparticles. Sci. China-Phys. Mech. Astron. 54, 1766–1770. Ling, K.S., Wechter, W.P., Walcott, R.R., Keinath, A.P., 2011. Development of a realtime RT-PCR assay for squash mosaic virus useful for broad spectrum detection of various serotypes and its incorporation into a multiplex seed health assay. J. Phytopathol. 159, 649–656. Lopez-Fabuel, I., Wetzel, T., Bertolini, E., Bassler, A., Vidal, E., Torres, L.B., Yuste, A., Olmos, A., 2013. Real-time multiplex RT-PCR for the simultaneous detection of the five main grapevine viruses. J. Virol. Methods 188, 21–24. Lopez, M.M., Llop, P., Olmos, A., Marco-Noales, E., Cambra, M., Bertolini, E., 2009. Are molecular tools solving the challenges posed by detection of plant pathogenic bacteria and viruses? Curr. Issues Mol. Biol. 11, 13–45. Milia, M.G., Allice, T., Gregori, G., Mussino, S., Orofino, G., Bonora, S., Ghisetti, V., 2010. Magnetic-silica based nucleic acid extraction for Human Immunodeficiency Virus Type-1 drug-resistance testing in low viremic patients. J. Clin. Virol. 47, 8–12. Mumford, R., Boonham, N., Tomlinson, J., Barker, I., 2006. Advances in molecular phytodiagnostics – new solutions for old problems. Eur. J. Plant Pathol. 116, 1–19. Nakaune, R., Nakano, M., 2006. Efficient methods for sample processing and cDNA synthesis by RT-PCR for the detection of grapevine viruses and viroids. J. Virol. Methods 134, 244–249. Osman, F., Olineka, T., Hodzic, E., Golino, D., Rowhani, A., 2012. Comparative procedures for sample processing and quantitative PCR detection of grapevine viruses. J. Virol. Methods 179, 303–310. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R., 2012. PCR inhibitors – occurrence, properties and removal. J. Appl. Microbiol. 113, 1014–1026. Shan, Z., Zhou, Z.W., Chen, H., Zhang, Z.M., Zhou, Y., Wen, A.X., Oakes, K.D., Servos, M.R., 2012. PCR-ready human DNA extraction from urine samples using magnetic nanoparticles. J. Chromatogr. B 881–882, 63–68. Shiller, J.B., Lebas, B.S.M., Horner, M., Pearson, M.N., Clover, G.R.G., 2010. Sensitive detection of viruses in pollen using conventional and realtime reverse transcription-polymerase chain reaction. J. Phytopathol. 158, 758–763. Stöber, W., Fink, A., Bohn, E., 1968. Controlled growth of monodisperse silica spheres in the micron size range. J. Colloid Interface Sci. 26, 62–69. Verheyen, J., Kaiser, R., Bozic, M., Timmen-Wego, M., Maier, B.K., Kessler, H.H., 2012. Extraction of viral nucleic acids: comparison of five automated nucleic acid extraction platforms. J. Clin. Virol. 54, 255–259. Vincelli, P., Amsden, B., 2013. Comparison of tissue-disruption methods for PCRbased detection of plant pathogens. Plant Dis. 97, 363–368.

N. Sun et al. / Journal of Virological Methods 196 (2014) 204–211 Wei, T., Lebas, B.S.M., Shiller, J.B., Quinn, B.D., Clover, G.R.G., 2012. Detection of five viruses infecting dormant bulbs by TaqMan-based real-time RT-PCR. Australas. Plant Pathol. 41, 93–98. Xu, L., Lv, J., Ling, L., Wang, P., Song, P., Su, R., Zhu, G., 2011. Altered nucleic acid partitioning during phenol extraction or silica adsorption by guanidinium and potassium salts. Anal. Biochem. 419, 309–316.

211

Zhang, X., Wang, X.F., Zhou, G.H., 2008. A one-step real time RT-PCR assay for quantifying rice stripe virus in rice and in the small brown planthopper (Laodelphax striatellus fallen). J. Virol. Methods 151, 181–187. Zhu, L.Z., Yu, P.G., Shen, H.B., Jia, N.Q., Long, D.H., Zhou, H.Q., 2008. Extraction and detection of mRNA from a single K562 cell based on the functionalized superparamagnetic nanoparticles. Chin. J. Chem. 26, 1041–1044.