Vibrio vulnificus bacteriophage SSP002 as a possible biocontrol agent.

Vibrio vulnificus Bacteriophage SSP002 as a Possible Biocontrol Agent

Updated information and services can be found at: http://aem.asm.org/content/80/2/515 These include: SUPPLEMENTAL MATERIAL REFERENCES

CONTENT ALERTS

Supplemental material This article cites 60 articles, 38 of which can be accessed free at: http://aem.asm.org/content/80/2/515#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more»

Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/

Downloaded from http://aem.asm.org/ on June 27, 2014 by UZH Hauptbibliothek / Zentralbibliothek Zuerich

Hyun Sung Lee, Slae Choi, Hakdong Shin, Ju-Hoon Lee and Sang Ho Choi Appl. Environ. Microbiol. 2014, 80(2):515. DOI: 10.1128/AEM.02675-13. Published Ahead of Print 8 November 2013.

Vibrio vulnificus Bacteriophage SSP002 as a Possible Biocontrol Agent Hyun Sung Lee,a Slae Choi,a Hakdong Shin,a Ju-Hoon Lee,b Sang Ho Choia

A novel Vibrio vulnificus-infecting bacteriophage, SSP002, belonging to the Siphoviridae family, was isolated from the coastal area of the Yellow Sea of South Korea. Host range analysis revealed that the growth inhibition of phage SSP002 is relatively specific to V. vulnificus strains from both clinical and environmental samples. In addition, a one-step growth curve analysis and a bacteriophage stability test revealed a latent period of 65 min, a burst size of 23 ⴞ 2 PFU, as well as broad temperature (20°C to 60°C) and pH stability (pH 3 to 12) ranges. A Tn5 random transposon mutation of V. vulnificus and partial DNA sequencing of the inserted Tn5 regions revealed that the flhA, flhB, fliF, and fleQ mutants are resistant to SSP002 phage infection, suggesting that the flagellum may be the host receptor for infection. The subsequent construction of specific gene-inactivated mutants (flhA, flhB, fliF, and fleQ) and complementation experiments substantiated this. Previously, the genome of phage SSP002 was completely sequenced and analyzed. Comparative genomic analysis of phage SSP002 and Vibrio parahaemolyticus phage vB_VpaS_MAR10 showed differences among their tail-related genes, supporting different host ranges at the species level, even though their genome sequences are highly similar. An additional mouse survival test showed that the administration of phage SSP002 at a multiplicity of infection of 1,000 significantly protects mice from infection by V. vulnificus for up to 2 months, suggesting that this phage may be a good candidate for the development of biocontrol agents against V. vulnificus infection.

V

ibrio vulnificus is a Gram-negative, motile, curved, rodshaped, pathogenic bacterium that is generally found in marine environments such as estuarine waters or coastal areas. V. vulnificus commonly contaminates oysters and various kinds of seafood, leading to infection in humans via the ingestion of V. vulnificus-contaminated seafood or through the contact of open wounds with contaminated seawater while swimming, causing septicemia and cellulitis (1). The symptoms of septicemia generally include fever, chills, nausea, and hypotension, with mortality rates of approximately 50 to 60%. It sometimes causes death within 1 to 2 days after the first signs of illness. In addition, wounds infected by V. vulnificus cause cellulitis, ecchymosis, or bullae, which can progress to necrotizing fasciitis at the site of infection (2–4). These diseases may result from various potential virulence factors of V. vulnificus, such as endotoxin, extracellular hemolysin/cytolysin (5, 6), iron sequestration (7), polysaccharide capsules (8), elastase (9), and other exotoxins. To control this pathogen, a variety of antibiotics, such as erythromycin, tetracycline, minocycline, and the third-generation cephalosporins, have been tested (10–12). However, multidrug-resistant strains of V. vulnificus have recently emerged (13), suggesting that alternative biocontrol agents should be developed to overcome this pathogen. Bacteriophages are bacterial viruses that are used to recognize and infect specific host bacteria with a wide distribution in various environments (14). After the recognition and adsorption of phages to specific host bacteria, they inject their genomic DNA into the host and utilize the host’s replication and protein biosynthesis systems for their replication and reconstruction. After replication, phages lyse the host membrane and burst out from the host, demonstrating host lysis and bactericidal activities of these types of phages. During phage infection and replication in specific host bacteria, other adjacent bacteria are not affected by the phages, suggesting their host specificity. In addition, a cocktail of Listeria-targeting phages (ListShield; Intralytix, Inc., Baltimore, MD) was approved as a novel type of food preservative by the U.S.

January 2014 Volume 80 Number 2

Food and Drug Administration in 2006, acquiring the GRAS (generally recognized as safe) status of these bacteriophages, which suggests their safety (15, 16). Therefore, bacteriophages could serve as a biocontrol agent against V. vulnificus given these demonstrated instances of host specificity and bactericidal activity and the suggestion of the safety of phages. Furthermore, this bacteriophage approach would be suitable to control the growth of V. vulnificus in raw seafood, and it may also even be able to control antibiotic-resistant strains for therapeutic purposes. Since the first isolation of nine V. vulnificus-infecting phages in 1995 (17), numerous and diverse studies of V. vulnificus-infecting phages have shown that they generally belong to the Podoviridae or Siphoviridae family and also that they are present at a concentration of up to 104 PFU per gram in raw oysters, suggesting the widespread presence and easy acquisition of V. vulnificus-infecting phages for phage research and further applications (18). Among these phages, some of them show a broad host range and high susceptibility to V. vulnificus host strains, indicating the possibility of their application for control of V. vulnificus (19). Interestingly, V. vulnificus-infecting phage treatment of raw oysters revealed a 105-CFU/ml reduction of V. vulnificus in a raw oyster sample, supporting this possibility (20). In addition, a mouse treatment trial using V. vulnificus-infecting phages demonstrated their potential as a means of phage therapy (21). While that report showed in vivo growth inhibition of V. vulnificus in ICR mice

Received 11 August 2013 Accepted 31 October 2013 Published ahead of print 8 November 2013 Address correspondence to Ju-Hoon Lee, [email protected], or Sang Ho Choi, [email protected]. Supplemental material for this article may be found at http://dx.doi.org/10.1128 /AEM.02675-13. Copyright © 2014, American Society for Microbiology. All Rights Reserved. doi:10.1128/AEM.02675-13

Applied and Environmental Microbiology

p. 515–524

aem.asm.org

515


‹Department of Agricultural Biotechnology, Center for Food Safety and Toxicology, and Center for Food and Bioconvergence, Seoul National University, Seoul, South Koreaa; Department of Food Science and Biotechnology, Graduate School of Biotechnology, Kyung Hee University, Yongin, South Koreab

Lee et al.

MATERIALS AND METHODS Bacterial strains and growth conditions. V. vulnificus-specific phage SSP002 was newly isolated by using V. vulnificus clinical strain MO624/O. All bacterial strains and plasmids used in this study are listed in Table 1. Vibrio strains were grown at 30°C with shaking in Luria-Bertani (LB) medium supplemented with 2% NaCl (LBS). Other bacterial species, in this case Salmonella enterica serovar Typhimurium SL1344 and Escherichia coli O157:H7 ATCC 43889, were grown at 37°C with shaking in LB medium. All of the medium components were purchased from Difco (Detroit, MI), and chemicals were obtained from Sigma (St. Louis, MO). Bacteriophage isolation, propagation, and purification. V. vulnificus-infecting phages were isolated by using a phage isolation procedure described previously by Park et al. (24). The overall phage propagation procedure described previously by Sambrook and Russell was used (25). For the propagation of V. vulnificus-infecting phages, V. vulnificus host strain MO6-24/O was infected with the phages at a multiplicity of infection (MOI) of 1 and was subsequently incubated at 30°C for 12 h. Host cell debris was removed by centrifugation at 5,000 ⫻ g for 15 min and subsequent filtration using 0.22-␮m filters (Millipore, Billerica, MA). Phages in the filtrate were precipitated in a solution containing 1 M NaCl and 10% polyethylene glycol 6000 (PEG 6000) (final concentration) (Junsei Chemical, Tokyo, Japan) and incubated on ice for 12 h. After centrifugation at 10,350 ⫻ g at 4°C for 20 min, the pellet containing the phages was resuspended in sodium chloride magnesium sulfate (SM) buffer (50 mM TrisHCl, 100 mM NaCl, 10 mM MgSO4 [pH 7.5] [final concentration]). Finally, CsCl density gradient ultracentrifugation was performed at 78,500 ⫻ g at 4°C for 2 h. The phage particles in the specific bands were collected and dialyzed in a standard dialysis buffer (10 mM NaCl, 10 mM MgCl2, and 50 mM Tris-HCl at pH 8.0). The purified phages were then stored at 4°C for further experiments. Transmission electron microscopy. The morphology of phage SSP002 was determined by using CsCl-purified phage samples. The samples were negatively stained with 2% aqueous uranyl acetate (pH 4.0) and adsorbed onto carbon-coated copper grids, after which they were observed with an energy-filtering transmission electron microscope (EFTEM) (JEM1010; JEOL, Japan) at an accelerating voltage of 80 kV at the National Instrumentation Center for Environmental Management (NICEM) (Seoul, South Korea). Host range analysis. The host range was tested by spotting the phage lysate onto bacterial lawns using a double-layer method: 100 ␮l of stationary-phase host culture (108 CFU/ml) was added to 6 ml of 0.3% molten LBS top agar and overlaid onto a 1.5% LBS agar plate. After the top agar was solidified, 10 ␮l of each serially diluted phage suspension was spotted onto the overlaid plates and incubated overnight at 30°C. After incuba-

516

aem.asm.org

TABLE 1 Bacterial strains and plasmids used in this study Strain or plasmid Bacterial strains V. vulnificus MO6-24/O SA103 SA104 SA105 SA106 ENVI SS108A3A 3001C1 CECT4867 CECT5763 CMCP6 ATCC 29307 V. fischeri ES114 V. harveyi BB120 V. mimicus ATCC 33653 V. cholerae ATCC 14035 V. parahaemolyticus BB22 Salmonella enterica serovar Typhimurium SL1344 E. coli O157:H7 ATCC 43889 DH5␣ SM10␭pir

Plasmids pDM4 pGEM-T Easy pSA1006 pSA1008 pSA1010 pSA1012 pRK415 pSA1014 pSA1016 pSA1018 pSA1020 a

Relevant characteristic(s)

Clinical isolate; virulent MO6-24/O with ⌬flhA MO6-24/O with ⌬flhB MO6-24/O with ⌬fliF MO6-24/O with ⌬fleQ Environmental isolate Environmental isolate Environmental isolate Eel isolate; serovar E Eel isolate; serovar E Clinical isolate; virulent Clinical isolate; virulent

supE44 ⌬lacU169 (␾80 lacZ⌬M15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 thi thr leu tonA lacY supE recA:: RP4-2-Tc::Mu ␭pir Kmr; host for p-requiring plasmids; conjugal donor R6K ␥ori sacB; suicide vector; oriT of RP4; Cmr PCR product cloning vector; Apr pDM4 with ⌬flhA; Cmr pDM4 with ⌬flhB; Cmr pDM4 with ⌬fliF; Cmr pDM4 with ⌬fleQ; Cmr IncP ori; broad-host-range vector; oriT of RP4; Tcr pRK415 with the flhA gene; Tcr pRK415 with the flhB gene; Tcr pRK415 with the fliF gene; Tcr pRK415 with the fleQ gene; Tcr

Reference or sourcea

8 This study This study This study This study LC LC LC LC LC LC LC LC LC LC LC LC LC LC LC 63

This study This study This study This study 34 This study This study This study This study

LC, laboratory collection.

tion, plaque formation on the plates was observed to determine the sensitivity of the host bacteria to spotted phages. Heat and pH stability. To determine phage stability at different temperatures, phage lysate (about 2.2 ⫻ 107 PFU/ml) was added to SM buffer, and the mixtures were incubated in preheated water at 20°C, 30°C, 40°C, 50°C, 60°C, and 70°C. After 30 min of incubation, the phage titer was evaluated by the double-layer method. For the determination of the stability of the phages at different pH values, phage lysates were added to SM buffer. and the pH was adjusted from pH 2 to 13 by using HCl or NaOH. After incubation of the mixtures at 30°C for 12 h, the titer of each surviving phage was enumerated by using the double-layer method. One-step growth curve. One-step growth curves were determined as described previously (26), with some modifications. A bacteriophage was added to a late-exponential-phase culture (109 CFU/ml) of V. vulnificus MO6-24/O at an MOI of 1 and allowed to adsorb for 10 min at room temperature. Subsequently, the mixture was harvested by centrifugation (10,000 ⫻ g for 5 min), resuspended in the same volume of fresh LBS broth, and then incubated at 30°C with shaking. During a 2-h incubation, samples were collected every 5 min and immediately centrifuged, after which the supernatants were plated onto LBS agar to determine the phage titration. The latent period and burst size were calculated from the onestep growth curve.



using three different V. vulnificus phages, CK2, 153A-5, and 153A-7, the authors of that study did not genotypically characterize these phages. Recently, complete genome sequences of V. vulnificus-infecting phages were reported after efforts to understand them further at the genomic level (22, 23). In this study, a novel V. vulnificus-specific phage, SSP002, that infects both clinical and environmental strains was isolated and characterized by morphological observation, host range analysis, one-step growth curve analysis, and determination of the host receptor by using transposon random mutations, gene-specific knockouts, and complementation experiments. In addition, genomic information and analysis results were used to enhance our understanding of this phage at the genomic level. Furthermore, to evaluate therapeutic applications of this phage for in vitro and in vivo control of V. vulnificus, inhibition activity assessments and a mouse model trial were conducted. This report will be helpful to extend our knowledge about V. vulnificus-infecting bacteriophages and their future applications as novel therapeutic or biocontrol agents against V. vulnificus.

Novel V. vulniﬁcus Bacteriophage SSP002

TABLE 2 Oligonucleotides used in this study Oligonucleotide sequence (5=¡3=)a

Use

FLHA-F1 FLHA-R1 FLHA-F2 FLHA-R2 FLHB-F1 FLHB-R1 FLHB-F2 FLHB-R2 FLIF-F1 FLIF-R1 FLIF-F2 FLIF-R2 FLAK-F1 FLAK-R1 FLAK-F2 FLAK-R2 FLHAC-F FLHAC-R FLHBC-F FLHBC-R FLIFC-F FLIFC-R FLAKC-F FLAKC-R

GCCATGGCCGTATCCGTATGTT TCTCTAGACACCATAATCGGTGCGC TGTCTAGAGAACCCGACATCCTGAC CGACTAGTCTTTCCAGCAATGAGTTCA ATTACCATGGACCCGGCCAATG TGTCTAGATTCTTCACGAGAGAGGCTAA AATCTAGACACTTTTCTGTTGCACTGCG TAACTAGTCAAGGTGGCCAACACCATA ATTACCATGGCAAAGAAATGGCG AGTCTAGAAATCGAGAGGACTAACACGA TTTCTAGACTCGGTCAAGGATCGGT GCACTAGTTCGTTAGCCATTTATCATCC TATCCATGGCAGGGGCGATC TCTCTAGAGCTGAGCTGAGGATAGTTAA GCTCTAGAGAATTCCAACCAGAGACGT GTACTAGTGCGCTTCTGGATTGGC CTGCAGCCATTGAGACGAAGT TCTAGATGGAGTAATGCAGTTCGCAT CTGCAGTTGCTAGGAGGCTGG TCTAGAGGTGCTAGCTAGCAATCT CTGCAGCTAATGTGGGTAGTAAACT TCTAGAGAATCCAATCGTTGAAGTTA CTGCAGAAGGCAATAATCGGTAC TCTAGACCTCAAATACTAGAATAGCCT

Construction of the flhA mutant Construction of the flhA mutant Construction of the flhA mutant Construction of the flhA mutant Construction of the flhB mutant Construction of the flhB mutant Construction of the flhB mutant Construction of the flhB mutant Construction of the fliF mutant Construction of the fliF mutant Construction of the fliF mutant Construction of the fliF mutant Construction of the fleQ mutant Construction of the fleQ mutant Construction of the fleQ mutant Construction of the fleQ mutant Complementation of flhA Complementation of flhA Complementation of flhB Complementation of flhB Complementation of fliF Complementation of fliF Complementation of fleQ Complementation of fleQ

a

Regions of oligonucleotides not complementary to the corresponding genes are underlined.

Transposon mutagenesis. A transposon mutant library was constructed as previously described (27), with some modification. Suicide vector pRL27 (28), containing the hypertransposable mini-Tn5 element, was delivered to V. vulnificus MO6-24/O via conjugation with E. coli donor strain S17-1␭pir (29). V. vulnificus recipient cells were grown at 30°C in LBS medium, and the donor strain, E. coli S17-1␭pir, was grown at 37°C in LB medium prior to mating. Both cell types were then subcultured at a 1/100 dilution and grown in an appropriate medium until the mid-exponential phase was reached. Mixtures of the donor and recipient (2:1) were spotted onto LB agar plates and incubated for 8 h at 37°C. To select for V. vulnificus transconjugants, the cells were suspended in 1 ml of LBS medium and spread onto LBS agar supplemented with polymyxin B (Pm) (12.94 ␮g/ml) and kanamycin (Km) (100 ␮g/ml) (30). After overnight incubation at 30°C, individual colonies were selected and placed into 200 ␮l of LBS medium containing Km in 96-well plates, grown overnight, and subsequently converted into a frozen stock by adding dimethyl sulfoxide (DMSO) to a final concentration of 5% to each well. Selection of phage SSP002-resistant mutants. SSP002-resistant mutants were screened in the V. vulnificus mutant library and selected. The transposon mutants in 96-well plates were duplicated in two 96-well plates containing LBS medium with 100 ␮g/ml Km. After duplication, one plate was infected with SSP002 (109 PFU/ml), and both plates were incubated at 30°C with shaking for 3 h. The optical density at 600 nm (OD600) of the two plates was measured by using a VERSAmax tunable microplate reader (Molecular Devices, Sunnyvale, CA) to screen for SSP002-resistant mutants. Construction of the flhA, flhB, fliF, and fleQ mutants and complementation. Specific gene inactivation mutants (⌬flhA, ⌬flhB, ⌬fliF, and ⌬fleQ) were constructed by means of PCR-mediated linker-scanning mutagenesis (31). To construct these mutants, each target gene was inactivated by homologous recombination of the suicide vector containing partial target gene DNA. The primers used to construct the linker-scanning mutants are listed in Table 2. Each DNA target gene fragment was amplified by PCR, and the resulting PCR product was ligated with ApaI/SpeIdigested pDM4 (32), forming the suicide vectors pSA1006 (flhA), pSA1008 (flhB), pSA1010 (fliF), and pSA1012 (fleQ). E. coli SM10␭pir


containing each suicide vector was used as a conjugal donor for V. vulnificus MO6-24/O to generate each specific gene inactivation mutant by means of homologous recombination. The conjugation and isolation of the transconjugants were performed by using previously described methods (33). To complement the ⌬flhA, ⌬flhB, ⌬fliF, and ⌬fleQ mutations, each expression vector was constructed with the broad-host-range vector pRK415 (34), in this case pSA1014, pSA1016, pSA1018, and pSA1020,

FIG 1 Transmission electron microscopy image of phage SSP002 negatively stained with 2% uranyl acetate. Scale bar, 100 nm.

aem.asm.org 517


Oligonucleotide

Lee et al.

strain MO6-24/O was infected by phage SSP002. (B) ⌬flhA, ⌬flhB, ⌬fliF, and ⌬fleQ mutants were resistant to infection by phage SSP002. pRK415 is an empty vector control. (C) Complementation of the deletion mutants by individual gene expression of flhA, flhB, fliF, or fleQ with the pRK415 expression vector recovered susceptibility to infection by phage SSP002.

containing the PCR-amplified target gene DNA with the specific primer set (Table 2). The constructed vectors were mobilized into mutant strains SA103, SA104, SA105, and SA106 by means of conjugative transfers, as described above. Bacteriophage genome sequencing and bioinformatics analysis. Phage genomic DNA was extracted from dialyzed phage particles as previously described (25). The whole genome of phage SSP002 was sequenced by using the FLX Titanium genome sequencer (Roche, Mannheim, Germany), and the qualified filtered reads were assembled by using the Newbler 2.3 program (Roche) from Macrogen, Inc. (Seoul, South Korea). Open reading frames (ORFs) were predicted with GeneMarkS for phages (35) and with the Glimmer 3 program (36). Functional analyses and their annotations were carried out by using the BLASTP (37) and InterProScan (38) programs. Bacterial challenge assay. For a comparison of the growth rates of wild-type V. vulnificus MO6-24/O and phage-treated MO6-24/O, bacterial growth was monitored by measuring CFU. V. vulnificus MO6-24/O was inoculated into LBS medium at a final cell density of 2.6 ⫻ 106 CFU/ ml, and phage lysate was added at an MOI of 10, with incubation at 30°C with shaking. The control group (only V. vulnificus MO6-24/O) was incubated under the same conditions. The CFU of two samples were measured by using the standard viable cell count method. Mouse survival test. To examine the therapeutic potential of phage SSP002, a mouse survival test was performed by using specific-pathogen-free, 6-week-old, female ICR outbred mice (CrljOri:CD1[ICR]; Seoul National University). V. vulnificus MO6-24/O grown overnight in LBS medium at 30°C was inoculated and subsequently harvested when bacterial growth reached an OD600 value of 0.7. Cells were washed with phosphate-buffered saline (PBS), and 5 ⫻ 105 CFU of the bacterial suspension in 100 ␮l of PBS buffer was injected into the intraperitoneal cavities of the mice. After bacterial challenge, 100 ␮l of the purified phage sample (MOIs of 0, 1, 10, 100, and 1,000, with each group containing 5 mice) was immediately injected into the other side of the abdomen of the mice, and numbers of live mice were counted for 48 h. All manipulations of mice were approved by the Animal Care and Use Committee at Seoul National University.

RESULTS

Isolation and host range of phage SSP002. Phage SSP002 was isolated from a seawater sample from the Yellow Sea off the west

518

aem.asm.org

coast of South Korea in August 2009. Phage SSP002 produced small plaques on the lawn of a host (data not shown). The host range of phage SSP002 was determined by using 3 environmental strains and 12 clinical strains. Phage SSP002 showed lytic activity against two V. vulnificus clinical strains, MO6-24/O and CMCP6, and an environmental strain, SS108A3A. However, the other five V. vulnificus strains were not infected by phage SSP002, suggesting that phage SSP002 had a narrow host range with specificity for some V. vulnificus strains. Strains of other genera or species shown in Table 1 were not infected by this phage either. Morphology of phage SSP002. A morphological characterization of phage SSP002 was carried out by means of transmission electron microscopy (TEM). Phage SSP002 had an 80.5-nm elongated capsid and a 161-nm-long noncontractile tail (Fig. 1), and it belongs to the Siphoviridae family according to the International Committee on Taxonomy of Viruses (ICTV) (39). Latent period, burst size, and stress stability. A one-step growth curve of phage SSP002 propagated on V. vulnificus MO624/O was performed. The latent period and burst time were approximately 65 and 100 min, respectively, and the burst size was estimated to be 23 ⫾ 2 PFU per infected cell. To apply phage SSP002 as a biocontrol agent to inhibit the growth of V. vulnificus, viable stability is required under various stress conditions, such as different pHs and temperatures. A heat and pH stability test showed that phage SSP002 is stable under the stress conditions tested. Phage SSP002 was stable during a heat treatment from 20°C to 50°C lasting 30 min. However, the phage titer was reduced by 10% (a reduction of approximately 2 ⫻ 106 PFU) at 60°C and by 95% (a reduction of approximately 1.9 ⫻ 107 PFU) at 70°C. The phage was inactivated at 80°C. In addition, the pH stability test showed that phage SSP002 was stable at a pH range from 4 to 11. However, phage activity decreased by about 50% (a reduction of approximately 1.5 ⫻ 107 PFU) at pH 3 and 12, and the phage was inactivated at pH 2 and 13. These findings show that phage SSP002 is stable under wide ranges of temperatures and pHs. Identification of the host receptor. To identify the host recep-



FIG 2 Identification of the V. vulnificus host receptor of phage SSP002 by deletion and complementation of flagellum-related genes. (A) Wild-type V. vulnificus


TABLE 3 Functional grouping of predicted ORFs in phage SSP002 Identity (%)a

Functional group

Locus tag

Predicted function

BLASTP best match

Structure/packaging

SSP002_029

Terminase large subunit

SSP002_030

Structural protein 1

SSP002_032


SSP002_033


SSP002_031

Head morphogenesis domaincontaining protein

Terminase large subunit (Vibrio phage vB_VpaS_MAR10) Portal protein (Vibrio phage vB_VpaS_MAR10) Putative peptidase (Vibrio phage vB_VpaS_MAR10) Hypothetical protein MAR10_037 (Vibrio phage vB_VpaS_MAR10) Hypothetical protein MAR10_031 (Vibrio phage vB_VpaS_MAR10)

SSP002_042

Tail tape measure protein

SSP002_046

Tail assembly protein

SSP002_015 SSP002_028

DNA ligase HNH endonuclease

SSP002_058

DNA polymerase IA

SSP002_067

DNA polymerase IB

SSP002_066

DNA polymerase III beta subunit

SSP002_069 SSP002_059

DNA polymerase III gamma/tau subunit DNA helicase 1

SSP002_060

DNA helicase 2

SSP002_074

RecA

SSP002_077

DNA repair exonuclease

SSP002_078

Exonuclease

Host lysis

SSP002_052

Endolysin

Protein containing a transglycosylase domain (Vibrio phage vB_VpaS_MAR10)

88.0

Transcription regulation

SSP002_019

Transcriptional regulator

Putative transcriptional regulator (Vibrio phage vB_VpaS_MAR10)

70.3

Additional function

SSP002_056

Ist ATP-binding domaincontaining protein Thymidylate synthase Thymidylate kinase

Hypothetical protein MAR10_057 (Vibrio phage vB_VpaS_MAR10) Thymidylate synthase (Vibrio tubiashii) Putative thymidylate kinase (Vibrio phage vB_VpaS_MAR10)

78.4

DNA replication/modification

SSP002_068 SSP002_073 a

77.4 82.9 70.1 82.3

Tail tape measure protein (Vibrio phage vB_VpaS_MAR10) Hypothetical protein MAR10_046 (Vibrio phage vB_VpaS_MAR10)

84.6 69.4

DNA ligase (Vibrio phage vB_VpaS_MAR10) HNH endonuclease (Vibrio phage vB_VpaS_MAR10) Putative DNA polymerase (Vibrio phage vB_VpaS_MAR10) DNA polymerase (Vibrio phage vB_VpaS_MAR10) Putative beta clamp protein (Vibrio phage vB_VpaS_MAR10) Putative DNA polymerase III (Vibrio phage vB_VpaS_MAR10) DNA primase/helicase (Vibrio phage vB_VpaS_MAR10) Putative ATP-dependent helicase (Vibrio phage vB_VpaS_MAR10) Putative RecA protein (Vibrio phage vB_VpaS_MAR10) Putative recombination endonuclease (Vibrio phage vB_VpaS_MAR10) SbcC type exonuclease (Vibrio phage vB_VpaS_MAR10)

74.7 65.8 83.8 91.1 80.5 83.3 85.3 84.1 93.2 84.5 76.4

86.6 76.8

Protein sequence identity.

tor for phage SSP002, phage SSP002-resistant mutants were screened in the Tn5 random mutant library, after which four mutants were selected. Partial DNA sequencing of inserted Tn5 regions showed that flhA, flhB, fliF, and fleQ were inactivated by Tn5 insertions into these mutants, suggesting that these genes are involved in the host receptor for phage SSP002 infection. The flhAand flhB-encoded membrane proteins were involved in the export of flagellum proteins (40). The protein encoded by fliF is the M ring of the host flagellum, and the protein encoded by fleQ is a


two-component response regulator (41), suggesting that the host receptor for phage SSP002 is most likely the host flagellum. In order to confirm this, V. vulnificus MO6-24/O mutants with an inactivated flhA, flhB, fliF, or fleQ gene were constructed by PCRmediated linker-scanning mutagenesis. As a result, while phage SSP002 efficiently infected intact V. vulnificus MO6-24/O bacteria, it did not infect these four deletion mutants (Fig. 2A and B). Furthermore, complementation of these mutants by expression of each gene in each corresponding mutant revealed the recovery of

aem.asm.org 519


Tail assembly

89.4

Lee et al.

hypothetical proteins, and the colored arrows indicate the genes encoding annotated proteins in predicted functional categories. Six different functional groups are indicated with different colors according to key, and each specific function is labeled under the genome map. The scale units are in base pairs.

susceptibility to phage SSP002 infection (Fig. 2C), substantiating that the host receptor for phage SSP002 is the host flagellum. Phage genome analysis. Complete genome sequencing and genome analysis of phage SSP002 were reported previously (22). Functional categorization of predicted open reading frames (ORFs) is shown in Table 3, and their functional groups are illustrated in the genome map of phage SSP002 (Fig. 3). Interestingly, the DNA replication/modification group contains DNA polymerase I (SSP002_058 and SSP002_067), DNA polymerase III (SSP002_066 and SSP002_069), DNA ligase (SSP002_015), DNA primase/helicase (SSP002_059), DNA helicase (SSP002_060), endo- and exonucleases (SSP0002_028, SSP002_077, and SSP002_078), and RecA (SSP002_074), suggesting that this group has a nearly complete set of genes for phage DNA replication and modification. While the host lysis group generally contains holin and endolysin in other phage genomes, that of the SSP002 phage genome contains only endolysin, suggesting that the gene encoding holin was not properly annotated due to insufficient annotation information for the Vibrio phages in sequence databases (22). Recently, the genome sequence of temperate Vibrio parahaemolyticus phage vB_VpaS_MAR10 was reported (42). While this phage infects different species of Vibrio, its genome sequence is very similar to that of the V. vulnificus-infecting phage SSP002. A comparative genome sequence analysis of these phages at the DNA level showed a large gap between the two genes encoding a tail tape measure protein (SSP002_042) and a tail assembly protein (SSP002_046). Interestingly, this gap contains three ORFs encoding different hypothetical proteins (SSP002_043, SSP002_044, and SSP002_045), indicating that these three ORFs encoding hypothetical proteins are quite different between the two phage genomes, despite the fact that the two adjacent genes encoding the tail tape measure protein and tail assembly protein are highly homologous (Table 3). In addition, a host range analysis of these two phages showed a high host specificity at the species

520

aem.asm.org

level of V. vulnificus or V. parahaemolyticus (22, 42), implying that the different host specificity characteristics at the species level between these two phages may be related to the three different hypothetical proteins of these two phage genomes. Furthermore, a lifestyle prediction of the two phages SSP002 and vB_VpaS_ MAR10 using the PHACTS program showed that phage SSP002 may be virulent, whereas phage vB_VpaS_MAR10 may be temperate, supporting data from a previous report on phage vB_VpaS_MAR10 (see Fig. S1 in the supplemental material) (42). However, the present genome annotation data for phage vB_VpaS_MAR10 showed that phage vB_VpaS_MAR10 does not have lysogenization-related components such as integrase and the lysogeny control region. Therefore, these lysogenization-related components in phage vB_VpaS_MAR10 need to be studied further with updated genome annotation data in the near future. Bacterial challenge test. The phage was added to the bacterial host culture (at 2.6 ⫻ 106 CFU/ml) at the initial incubation time of 0 h (see Fig. 5). During the first 6 h of incubation after phage infection, bacterial growth was not inhibited by phage infection. However, after 6 h of incubation, the number of CFU decreased, indicating bacterial growth inhibition by the phage. Interestingly, once the number of CFU was reduced, bacterial growth was still inhibited until 24 h of incubation. This result indicates that phage SSP002 inhibits the growth of V. vulnificus, suggesting that it could be a candidate biocontrol agent for phage therapy against V. vulnificus. In vivo mouse survival test. To estimate the in vivo protection effect of phage SSP002 against V. vulnificus infection, a mouse survival test was performed with ICR mice. The survival rates of phage-treated and untreated mice infected with V. vulnificus MO6-24/O were compared for 2 days. As shown in Fig. 6, the phage-untreated group (MOI ⫽ 0) died within 27 h. Data for phage-treated groups at MOIs of 1 and 10 showed that one of five mice (20%) survived up to 48 h, suggesting a slight improvement in the survival rate. The phage-treated groups at MOIs of 100 and



FIG 3 Genome map of phage SSP002. The arrows indicate the predicted ORFs in the genome of phage SSP002. The open arrows indicate the genes encoding


1,000 showed much higher survival rates (60% and 80%, respectively), indicating a reduction of mouse lethality by phage treatment. This result suggests that the mouse survival rate increases in a dose-dependent manner when V. vulnificus-infected mice receive phage SSP002 treatment. In addition, the surviving mice appeared to be healthy during the 2-month observation period after phage SSP002 treatment (see Fig. 6). Therefore, phage SSP002 may be a candidate as an effective biocontrol agent for phage therapy against V. vulnificus. DISCUSSION

It has been reported that V. vulnificus-mediated food-borne diseases occur more frequently in summer and are sometimes fatal to human (1–4). Various antimicrobial agents to control V. vulnificus have been used (10–12), but the use of currently available antibiotics has caused the emergence of antibiotic-resistant bacteria (13), suggesting that the development of alternative biocontrol agents is needed. Lytic bacteriophages generally disrupt bacterial metabolism and lyse the bacterial host, indicating bactericidal activity. In addition, human phage therapy trials have shown a high level of safety without any side effects (43), indicating safety for human applications. Furthermore, while general antibiotics affect both pathogens and normal microflora, bacteriophages infect only specific host bacteria due to their host specificity (14, 44). Therefore, due to their bactericidal activity, host specificity, and safety for human applications, phage treatment has been proposed in the form of a novel alternative biocontrol agent for foodborne and antibiotic-resistant pathogens (45). Bacteriophages generally infect bacteria through host receptors, including outer membrane proteins (46, 47), O-antigen of lipopolysaccharides (LPS) (48, 49), Vi capsular antigen (50), and flagella (51, 52). Some bacteriophages attack only motile strains via the movement of flagella, indicating that flagella are the host receptors for phage infection (51–53). To identify the host receptor of V. vulnificus-infecting phage SSP002, deletion mutants of flagellum-related genes, i.e., flhA, flhB, fliF, and fleQ, were found to show resistance against phage SSP002, suggesting that V. vulnificus flagella may be the host receptor for phage SSP002 infection. To confirm this, complementation of the expression of each gene by using a plasmid expression system in V. vulnificus restored the level of phage susceptibility (Fig. 2). Therefore, the flagella of V. vulnificus are associated with the recognition and reception of phage SSP002. Previous and recent studies of flagellum-targeting phage infection mechanisms showed that the counterclockwise rotation of flagella is essential for phage adsorption and that it is required for phage infection (52, 54). In addition, a Salmonella ⌬motA mutant host, which is flagellated but not motile, could not


be infected by phage iEPS5, suggesting the requirement of flagellar rotation for phage infection (54). While the specific mechanism of flagellum-dependent infection of V. vulnificus by phage SSP002 is still unknown, it may be related to the results of those previous reports. While V. cholerae bacteriophage genome sequences have been reported (55, 56), the V. vulnificus phage SSP002 genome sequence was recently studied (22). A few months after that study of phage SSP002, a highly homologous genome sequence, that of V. parahaemolyticus phage vB_VpaS_MAR10, was reported (42). Interestingly, comparative genomic analyses of these two similar phages showed ⬎95% similarity at the DNA level. However, a genome comparison showed a large gap between two tail-related genes, encoding a tail tape measure protein (SSP002_042) and a tail assembly protein (SSP002_046) (Fig. 4). This gap contains three predicted ORFs (SSP002_043, SSP002_044, and SSP002_045), but their functions were not predicted due to an insufficient amount of Vibrio phage genome annotation information. Interestingly, in the Vibrio phages belonging to the family Siphoviridae, tail component/assembly genes are located in a gene cluster (i.e., ORF87-ORF95 and ORF148-ORF157 in the genomes of phages SIO-2 and pVp-1, respectively) (57, 58). While the functions of these three ORFs are still unknown, they may be related to tail component or tail assembly functions due to their locations

FIG 5 Bacterial challenge assay of phage SSP002 with V. vulnificus M06-24/O at an MOI of 10. This test was performed in triplicate, and the error bars indicate standard deviations.

aem.asm.org 521


FIG 4 Comparative genome analysis of two phages, SSP002 and vB_VpaS_MAR10 (MAR10), using the BLASTN and ACT12 programs. The open box indicates the largest gap between the two phage genomes. Major functional groups are labeled and indicated by brackets on the genome comparison map.

Lee et al.

between tail-related genes. However, these three ORFs in the two phage genomes have protein sequence identity levels of ⬍36%, suggesting that the tail-associated proteins encoded by these three ORFs may be different in the two phage genomes. Previous host range studies of phages suggested that the host specificity for phage infection is generally determined by tail-associated proteins, including tail fiber proteins and tail spike proteins (24, 59). Therefore, the difference in the host specificity at the species level (V. vulnificus-infecting phage SSP002 and V. parahaemolyticusinfecting phage vB_VpaS_MAR10) may be due to these different tail-associated proteins between the probable tail gene clusters of phages SSP002 and vB_VpaS_MAR10. Most tailed phages produce the peptidoglycan hydrolase endolysin, which destroys peptidoglycan directly and hydrolyzes the covalent bonds essential for peptidoglycan integrity (60, 61). Because most endolysins are quite specific for bacterial species, they lyse the targeted bacteria without disrupting the normal flora of the host (62). Genome sequence analysis of phage SSP002 revealed that it has an endolysin-encoding gene (SSP002_052) (Table 3). Therefore, purified endolysin could be used as a new type of biocontrol agent for food safety against V. vulnificus. In addition to the in vitro bacterial challenge test of phage SSP002 against V. vulnificus (Fig. 5), an in vivo mouse survival test with V. vulnificusinfected ICR mice and phage SSP002 revealed that phage SSP002 protected the host mice from the virulence of V. vulnificus, suggesting that phage SSP002 is a good candidate for phage therapy in a V. vulnificus-infected host (Fig. 6). Previously, DePaola et al. (18, 19) isolated various V. vulnificus-infecting phages from oysters. In addition, Cerveny et al. (21) chose two phages, 153A-5 and 153A-7, from those previous reports (18, 19) and also chose a newly isolated V. vulnificus-infecting phage, CK2. In that report (21), those researchers tested growth inhibition of V. vulnificus in MO6-24/O-infected ICR mice by using these three selected phages to confirm the possibility of in vivo phage therapy against V. vulnificus. While those authors showed in vivo growth inhibition of V. vulnificus using these phages phenotypically, they did not characterize the phages genotypically. In our report, we tried to characterize newly isolated V. vulnificus phage SSP002 at the phenotypic,

522

aem.asm.org

ACKNOWLEDGMENTS This work was supported by grants to S.H.C. from the R&D Convergence Center Support Program of the Ministry of Agriculture, Food and Rural Affairs and by grants to S.H.C. and J.-H.L. from the Public Welfare and Safety Research Program (grant no. NRF-2012M3A2A1051679 and NRF2012M3A2A1051684, respectively) through the National Research Foundation funded by the Ministry of Science, ICT, and Future Planning, Republic of Korea. This work was also supported by a grant to J.-H.L. from IPET (Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries), Ministry of Agriculture, Food and Rural Affairs (grant no. 111033-03-1-HD120).

REFERENCES 1. Strom MS, Paranjpye RN. 2000. Epidemiology and pathogenesis of Vibrio vulnificus. Microbes Infect. 2:177–188. http://dx.doi.org/10.1016 /S1286-4579(00)00270-7. 2. Klontz KC, Lieb S, Schreiber M, Janowski HT, Baldy LM, Gunn RA. 1988. Syndromes of Vibrio vulnificus infections. Clinical and epidemiologic features in Florida cases, 1981–1987. Ann. Intern. Med. 109:318 – 323. 3. Linkous DA, Oliver JD. 1999. Pathogenesis of Vibrio vulnificus. FEMS Microbiol. Lett. 174:207–214. http://dx.doi.org/10.1111/j.1574-6968 .1999.tb13570.x. 4. Oliver JD. 2005. Wound infections caused by Vibrio vulnificus and other marine bacteria. Epidemiol. Infect. 133:383–391. http://dx.doi.org/10 .1017/S0950268805003894. 5. Gray LD, Kreger AS. 1989. Detection of Vibrio vulnificus cytolysin in V. vulnificus-infected mice. Toxicon 27:439 – 464. http://dx.doi.org/10.1016 /0041-0101(89)90206-7. 6. Oliver JD, Wear JE, Thomas MB, Warner M, Linder K. 1986. Production of extracellular enzymes and cytotoxicity by Vibrio vulnificus. Diagn. Microbiol. Infect. Dis. 5:99 –111. http://dx.doi.org/10.1016/0732-8893(86)90112-4. 7. Litwin CM, Rayback TW, Skinner J. 1996. Role of catechol siderophore synthesis in Vibrio vulnificus virulence. Infect. Immun. 64:2834 –2838. 8. Wright AC, Simpson LM, Oliver JD, Morris JG, Jr. 1990. Phenotypic evaluation of acapsular transposon mutants of Vibrio vulnificus. Infect. Immun. 58:1769 –1773. 9. Kothary MH, Kreger AS. 1985. Production and partial characterization of an elastolytic protease of Vibrio vulnificus. Infect. Immun. 50:534 –540. 10. Bowdre JH, Hull JH, Cocchetto DM. 1983. Antibiotic efficacy against Vibrio vulnificus in the mouse: superiority of tetracycline. J. Pharmacol. Exp. Ther. 225:595–598. 11. Chen SC, Lee YT, Tsai SJ, Chan KS, Chao WN, Wang PH, Lin DB, Chen CC, Lee MC. 2012. Antibiotic therapy for necrotizing fasciitis caused by



FIG 6 In vivo mouse survival test using V. vulnificus-infected ICR mice and phage SSP002. Closed circles indicate V. vulnificus-infected mice without treatment with phage SSP002 (MOI of 0) as a control. Open circles, closed triangles, open triangles, and closed squares indicate V. vulnificus-infected mice with treatment with phage SSP002 at MOIs of 1, 10, 100, and 1,000, respectively.

molecular, and genomic levels, and we also tried to understand infection and interaction between the V. vulnificus host strain and phage SSP002. Based on this information, we also tested growth inhibition of V. vulnificus by SSP002 in vitro and in vivo. Therefore, this report contains new information on V. vulnificus phages phenotypically as well as genotypically in other aspects. Furthermore, a host range assay and phage stability test under various temperature and pH conditions showed that phage SSP002 was able to infect both clinical and environmental strains and to survive under a wide range of temperatures and pHs, suggesting that its antimicrobial activity should be retained during food processing and storage. Therefore, the phage itself and its purified endolysin are potentially good biocontrol sources for the development of new types of natural food preservatives with activity against V. vulnificus. However, based on the present research data, further phage application studies with V. vulnificus-infected humans as well as V. vulnificus-contaminated foods should be conducted in the near future to confirm that phage SSP002 is an excellent antimicrobial source for phage therapies and for development of a biocontrol agent against V. vulnificus in the food industry.


12.

13.

15. 16. 17. 18. 19. 20.

21.

22. 23. 24.

25. 26.

27.

28.

29.

30. 31.


32. 33.

34. 35.

36. 37. 38. 39. 40.

41. 42.

43.

44. 45. 46. 47. 48. 49.

50.

51. 52.

http://www.msk.or.kr/jsp/view_old_journalD.jsp?pageNo⫽1&vol⫽45 &no⫽2&paperSeq⫽2520. Milton DL, O’Toole R, Horstedt P, Wolf-Watz H. 1996. Flagellin A is essential for the virulence of Vibrio anguillarum. J. Bacteriol. 178:1310 – 1319. Jeong HS, Jeong KC, Choi HK, Park KJ, Lee KH, Rhee JH, Choi SH. 2001. Differential expression of Vibrio vulnificus elastase gene in a growth phase-dependent manner by two different types of promoters. J. Biol. Chem. 276:13875–13880. http://dx.doi.org/10.1074/jbc.M010567200. Keen NT, Tamaki S, Kobayashi D, Trollinger D. 1988. Improved broadhost-range plasmids for DNA cloning in Gram-negative bacteria. Gene 70:191–197. http://dx.doi.org/10.1016/0378-1119(88)90117-5. Besemer J, Lomsadze A, Borodovsky M. 2001. GeneMarkS: a selftraining method for prediction of gene starts in microbial genomes. Implications for finding sequence motifs in regulatory regions. Nucleic Acids Res. 29:2607–2618. http://dx.doi.org/10.1093/nar/29.12.2607. Delcher AL, Bratke KA, Powers EC, Salzberg SL. 2007. Identifying bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics 23:673– 679. http://dx.doi.org/10.1093/bioinformatics/btm009. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403– 410. Zdobnov EM, Apweiler R. 2001. InterProScan—an integration platform for the signature-recognition methods in InterPro. Bioinformatics 17: 847– 848. http://dx.doi.org/10.1093/bioinformatics/17.9.847. Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA (ed). 2005. Virus taxonomy. Eighth report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press, San Diego, CA. Meron D, Efrony R, Johnson WR, Schaefer AL, Morris PJ, Rosenberg E, Greenberg EP, Banin E. 2009. Role of flagella in virulence of the coral pathogen Vibrio coralliilyticus. Appl. Environ. Microbiol. 75:5704 –5707. http://dx.doi.org/10.1128/AEM.00198-09. Kim YK, McCarter LL. 2000. Analysis of the polar flagellar gene system of Vibrio parahaemolyticus. J. Bacteriol. 182:3693–3704. http://dx.doi.org/10 .1128/JB.182.13.3693-3704.2000. Villa AA, Kropinski AM, Abbasifar R, Abbasifar A, Griffiths MW. 2012. Genome sequence of temperate Vibrio parahaemolyticus bacteriophage vB_VpaS_MAR10. J. Virol. 86:13851–13852. http://dx.doi.org/10.1128 /JVI.02666-12. Bruttin A, Brussow H. 2005. Human volunteers receiving Escherichia coli phage T4 orally: a safety test of phage therapy. Antimicrob. Agents Chemother. 49:2874 –2878. http://dx.doi.org/10.1128/AAC.49.7.2874-2878 .2005. Sulakvelidze A, Alavidze Z, Morris JG, Jr. 2001. Bacteriophage therapy. Antimicrob. Agents Chemother. 45:649 – 659. http://dx.doi.org/10.1128 /AAC.45.3.649-659.2001. Brussow H. 2005. Phage therapy: the Escherichia coli experience. Microbiology 151:2133–2140. http://dx.doi.org/10.1099/mic.0.27849-0. Bonhivers M, Ghazi A, Boulanger P, Letellier L. 1996. FhuA, a transporter of the Escherichia coli outer membrane, is converted into a channel upon binding of bacteriophage T5. EMBO J. 15:1850 –1856. Ho TD, Slauch JM. 2001. OmpC is the receptor for Gifsy-1 and Gifsy-2 bacteriophages of Salmonella. J. Bacteriol. 183:1495–1498. http://dx.doi .org/10.1128/JB.183.4.1495-1498.2001. Israel V. 1978. A model for the adsorption of phage P22 to Salmonella typhimurium. J. Gen. Virol. 40:669 – 673. http://dx.doi.org/10.1099/0022 -1317-40-3-669. Nesper J, Kapfhammer D, Klose KE, Merkert H, Reidl J. 2000. Characterization of Vibrio cholerae O1 antigen as the bacteriophage K139 receptor and identification of IS1004 insertions aborting O1 antigen biosynthesis. J. Bacteriol. 182:5097–5104. http://dx.doi.org/10.1128/JB.182.18 .5097-5104.2000. Pickard D, Toribio AL, Petty NK, van Tonder A, Yu L, Goulding D, Barrell B, Rance R, Harris D, Wetter M. 2010. A conserved acetyl esterase domain targets diverse bacteriophages to the Vi capsular receptor of Salmonella enterica serovar Typhi. J. Bacteriol. 192:5746 –5754. http: //dx.doi.org/10.1128/JB.00659-10. Edwards S, Meynell GG. 1968. The widespread occurrence of enteric flagellar phages. J. Gen. Virol. 2:443– 444. http://dx.doi.org/10.1099/0022 -1317-2-3-443. Samuel ADT, Pitta TP, Ryu WS, Danese PN, Leung ECW, Berg HC. 1999. Flagellar determinants of bacterial sensitivity to ␹-phage. Proc. Natl. Acad. Sci. U. S. A. 96:9863–9866. http://dx.doi.org/10.1073/pnas.96.17 .9863.

aem.asm.org 523


14.

Vibrio vulnificus: retrospective analysis of an 8 year period. J. Antimicrob. Chemother. 67:488 – 493. http://dx.doi.org/10.1093/jac/dkr476. Chiang SR, Chuang YC. 2003. Vibrio vulnificus infection: clinical manifestations, pathogenesis, and antimicrobial therapy. J. Microbiol. Immunol. Infect. 36:81– 88. http://pub.hato.com.tw/jmii/article.asp?rep_id⫽55 3&source_id⫽1. Kim JH, Choresca CH, Jr, Shin SP, Han JE, Jun JW, Park SC. 2011. Occurrence and antibiotic resistance of Vibrio vulnificus in seafood and environmental waters in Korea. J. Food Saf. 31:518 –524. http://dx.doi.org /10.1111/j.1745-4565.2011.00329.x. Calendar R. 2006. The bacteriophages, 2nd ed. Oxford University Press, New York, NY. Bren L. 2007. Bacteria-eating virus approved as food additive. FDA Consum. 41:20 –22. http://permanent.access.gpo.gov/lps1609/www.fda.gov /fdac/features/2007/107_virus.html. Lang LH. 2006. FDA approves use of bacteriophages to be added to meat and poultry products. Gastroenterology 131:1370. http://dx.doi.org/10 .1053/j.gastro.2006.10.012. Pelon W, Siebeling R, Simonson J, Luftig R. 1995. Isolation of bacteriophage infectious for Vibrio vulnificus. Curr. Microbiol. 30:331–336. http: //dx.doi.org/10.1007/BF00369859. DePaola A, McLeroy S, McManus G. 1997. Distribution of Vibrio vulnificus phage in oyster tissues and other estuarine habitats. Appl. Environ. Microbiol. 63:2464 –2467. DePaola A, Motes ML, Chan AM, Suttle CA. 1998. Phages infecting Vibrio vulnificus are abundant and diverse in oysters (Crassostrea virginica) collected from the Gulf of Mexico. Appl. Environ. Microbiol. 64:346 –351. Pelon W, Luftig RB, Johnston KH. 2005. Vibrio vulnificus load reduction in oysters after combined exposure to Vibrio vulnificus-specific bacteriophage and to an oyster extract component. J. Food Prot. 68:1188 –1191. http://www.ingentaconnect.com/content/iafp/jfp/2005/00000068/00000 006/art00009. Cerveny KE, DePaola A, Duckworth DH, Gulig PA. 2002. Phage therapy of local and systemic disease caused by Vibrio vulnificus in iron-dextrantreated mice. Infect. Immun. 70:6251– 6262. http://dx.doi.org/10.1128 /IAI.70.11.6251-6262.2002. Lee HS, Choi S, Choi SH. 2012. Complete genome sequence of Vibrio vulnificus bacteriophage SSP002. J. Virol. 86:7711. http://dx.doi.org/10 .1128/JVI.00972-12. Nigro OD, Culley AI, Steward GF. 2012. Complete genome sequence of bacteriophage VvAW1, which infects Vibrio vulnificus. Stand. Genomic Sci. 6:415– 426. http://dx.doi.org/10.4056/sigs.2846206. Park M, Lee JH, Shin H, Kim M, Choi J, Kang DH, Heu S, Ryu S. 2012. Characterization and comparative genomic analysis of a novel bacteriophage, SFP10, simultaneously inhibiting both Salmonella enterica and Escherichia coli O157:H7. Appl. Environ. Microbiol. 78:58 – 69. http://dx .doi.org/10.1128/AEM.06231-11. Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Pajunen M, Kiljunen S, Skurnik M. 2000. Bacteriophage phiYeO3-12, specific for Yersinia enterocolitica serotype O:3, is related to coliphages T3 and T7. J. Bacteriol. 182:5114 –5120. http://dx.doi.org/10.1128/JB.182.18 .5114-5120.2000. Mueller RS, McDougald D, Cusumano D, Sodhi N, Kjelleberg S, Azam F, Bartlett DH. 2007. Vibrio cholerae strains possess multiple strategies for abiotic and biotic surface colonization. J. Bacteriol. 189:5348 –5360. http: //dx.doi.org/10.1128/JB.01867-06. Larsen R, Wilson M, Guss A, Metcalf W. 2002. Genetic analysis of pigment biosynthesis in Xanthobacter autotrophicus Py2 using a new, highly efficient transposon mutagenesis system that is functional in a wide variety of bacteria. Arch. Microbiol. 178:193–201. http://dx.doi.org/10 .1007/s00203-002-0442-2. Simon R, Priefer U, Puhler A. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Nat. Biotechnol. 1:784 –791. http://dx.doi.org/10.1038 /nbt1183-784. Cerda-Cuellar M, Jofre J, Blanch AR. 2000. A selective medium and a specific probe for detection of Vibrio vulnificus. Appl. Environ. Microbiol. 66:855– 859. http://dx.doi.org/10.1128/AEM.66.2.855-859.2000. Lee JH, Kim MW, Kim BS, Kim SM, Lee BC, Kim TS, Choi SH. 2007. Identification and characterization of the Vibrio vulnificus rtxA essential for cytotoxicity in vitro and virulence in mice. J. Microbiol. 45:146 –152.

Lee et al.

524

aem.asm.org

59. Mahichi F, Synnott AJ, Yamamichi K, Osada T, Tanji Y. 2009. Sitespecific recombination of T2 phage using IP008 long tail fiber genes provides a targeted method for expanding host range while retaining lytic activity. FEMS Microbiol. Lett. 295:211–217. http://dx.doi.org/10.1111/j .1574-6968.2009.01588.x. 60. Jado I, López R, García E, Fenoll A, Casal J, García P, Spanish Pneumococcal Infection Study Network. 2003. Phage lytic enzymes as therapy for antibiotic-resistant Streptococcus pneumoniae infection in a murine sepsis model. J. Antimicrob. Chemother. 52:967–973. http://dx.doi.org /10.1093/jac/dkg485. 61. Matsuzaki S, Rashel M, Uchiyama J, Sakurai S, Ujihara T, Kuroda M, Ikeuchi M, Tani T, Fujieda M, Wakiguchi H, Imai S. 2005. Bacteriophage therapy: a revitalized therapy against bacterial infectious diseases. J. Infect. Chemother. 11:211–219. http://dx.doi.org/10.1007/s10156-005 -0408-9. 62. Yoong P, Schuch R, Nelson D, Fischetti VA. 2004. Identification of a broadly active phage lytic enzyme with lethal activity against antibioticresistant Enterococcus faecalis and Enterococcus faecium. J. Bacteriol. 186: 4808 – 4812. http://dx.doi.org/10.1128/JB.186.14.4808-4812.2004. 63. Miller VL, Mekalanos JJ. 1988. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J. Bacteriol. 170:2575–2583.



53. Iino T. 1969. Genetics and chemistry of bacterial flagella. Bacteriol. Rev. 33:454 – 475. 54. Choi Y, Shin H, Lee JH, Ryu S. 2013. Identification and characterization of a novel flagellum-dependent Salmonella-infecting bacteriophage, iEPS5. Appl. Environ. Microbiol. 79:4829 – 4837. http://dx.doi.org/10 .1128/AEM.00706-13. 55. Davis BM, Moyer KE, Boyd EF, Waldor MK. 2000. CTX prophages in classical biotype Vibrio cholerae: functional phage genes but dysfunctional phage genomes. J. Bacteriol. 182:6992– 6998. http://dx.doi.org/10.1128/JB .182.24.6992-6998.2000. 56. Kapfhammer D, Blass J, Evers S, Reidl J. 2002. Vibrio cholerae phage K139: complete genome sequence and comparative genomics of related phages. J. Bacteriol. 184:6592– 6601. http://dx.doi.org/10.1128/JB.184.23 .6592-6601.2002. 57. Baudoux AC, Hendrix RW, Lander GC, Bailly X, Podell S, Paillard C, Johnson JE, Potter CS, Carragher B, Azam F. 2012. Genomic and functional analysis of Vibrio phage SIO-2 reveals novel insights into ecology and evolution of marine siphoviruses. Environ. Microbiol. 14:2071– 2086. http://dx.doi.org/10.1111/j.1462-2920.2011.02685.x. 58. Kim JH, Jun JW, Choresca CH, Shin SP, Han JE, Park SC. 2012. Complete genome sequence of a novel marine siphovirus, pVp-1, infecting Vibrio parahaemolyticus. J. Virol. 86:7013–7014. http://dx.doi.org/10 .1128/JVI.00742-12.

Q69 (an E. faecalis-Infecting Bacteriophage) As a Biocontrol Agent for Reducing Tyramine in Dairy Products.

A lethal leviathan--Vibrio vulnificus.

Isolation of Vibrio vulnificus from Seawater and Emerging Vibrio vulnificus Septicemia on Jeju Island.

Bacteriophage biocontrol of foodborne pathogens.

Vibrio vulnificus: An Environmental and Clinical Burden.

Hyperthermia as a possible teratogenic agent.

Danger on a half shell: Vibrio vulnificus septicemia.

Lrp, a global regulator, regulates the virulence of Vibrio vulnificus.

Massive rhabdomyolysis: a rare presentation of primary Vibrio vulnificus septicemia.

Low temperature induced non-culturability and killing of Vibrio vulnificus.

Virulence characteristics of clinical and environmental isolates of Vibrio vulnificus.

Vibrio vulnificus: From Oyster Colonist to Human Pathogen.

Functional analysis of TolC homologs in Vibrio vulnificus.

Multiplex PCR for detection of virulence markers of Vibrio vulnificus.

Draft Genome Sequence of Fish Pathogenic Vibrio vulnificus Biotype 2.

Vibrio vulnificus induces mTOR activation and inflammatory responses in macrophages.

Use of tetracycline for treatment of Vibrio vulnificus infections.

Starvation induces phenotypic diversification and convergent evolution in Vibrio vulnificus.

Resuscitation of Vibrio vulnificus from the viable but nonculturable state.

Vibrio vulnificus wound infection treated successfully with oral ciprofloxacin.

Potential of Pseudomonas chlororaphis subsp. aurantiaca Strain Pcho10 as a Biocontrol Agent Against Fusarium graminearum.

Suspension of oysters reduces the populations of Vibrio parahaemolyticus and Vibrio vulnificus.

Occurrence of Vibrio vulnificus and toxigenic Vibrio parahaemolyticus on sea catfishes from Galveston Bay, Texas.

Recreational swimmers' exposure to Vibrio vulnificus and Vibrio parahaemolyticus in the Chesapeake Bay, Maryland, USA.