Virology 481 (2015) 179–186

Contents lists available at ScienceDirect

Virology journal homepage: www.elsevier.com/locate/yviro

Brief Communication

Varicella-zoster virus (VZV) origin of DNA replication oriS influences origin-dependent DNA replication and flanking gene transcription Mohamed I. Khalil a,c,n, Marvin H. Sommer a, John Hay b, William T. Ruyechan b, Ann M. Arvin a a

Departments of Pediatrics and Microbiology & Immunology, Stanford University School of Medicine, Stanford, CA, United States Department of Microbiology and Immunology and The Witebsky Center for Microbial Pathogenesis and Immunology, University at Buffalo, Buffalo, NY, United States c Department of Molecular Biology, National Research Centre, El-Buhouth Street, Dokki, Cairo, Egypt b

art ic l e i nf o

a b s t r a c t

Article history: Received 11 November 2014 Returned to author for revisions 11 December 2014 Accepted 23 February 2015

The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. & 2015 Elsevier Inc. All rights reserved.

Keywords: VZV OriS DNA replication Flanking gene transcription

Introduction Varicella-zoster virus (VZV), a neurotropic herpesvirus, causes two diseases, varicella (chickenpox) during primary infection and herpes zoster (shingles) upon reactivation from latency in sensory ganglia. The VZV genome consists of a 125 kb linear doublestranded DNA molecule that encodes at least 71 genes (Straus et al., 1982). The linear sequence of VZV genes is similar to that of herpes simplex virus type 1 (HSV-1) and includes the coding sequences for orthologues of the seven HSV-1 proteins required for origin-dependent DNA replication (Arvin and Gilden, 2013). By analogy to HSV, two origins of DNA replication (oriS) within the internal repeats (IRs) and terminal repeats (TRs) bounding the US segment are identified within the VZV genome. These two copies of oriS are located in the intergenic region between the two immediate early genes encoding IE62 and IE63 proteins. HSV has another origin of DNA replication oriL near the center of the HSV-1 UL region (Davison and Scott, 1985, 1986; Stow, 1982; Stow and McMonagle, 1983; Stow and Davison, 1986). HSV-1 oriL has been shown to be dispensable for replication of HSV DNA (Balliet et al., n Correspondence to: Departments of Pediatrics and Microbiology & Immunology, Stanford University School of Medicine, G311, Stanford, CA 94305, United States. Fax: þ 1 650 725 9828. E-mail address: [email protected] (M.I. Khalil).

http://dx.doi.org/10.1016/j.virol.2015.02.049 0042-6822/& 2015 Elsevier Inc. All rights reserved.

2005; Weller et al., 1985) but has been implicated in HSV pathogenesis and reactivation from latency (Balliet and Schaffer, 2006). The equivalent region in the VZV genome is comprised of a bidirectional promoter that regulates the transcription of the VZV DNA polymerase catalytic subunit (ORF28) and DNA binding protein (ORF29) genes and does not contain any origin of DNA replication (Meier and Straus, 1993; Stow and Davison, 1986; Yang et al., 2004). VZV oriS contains a 46-bp AT-rich palindrome and three consensus binding sites for the VZV origin-binding protein (OBP) (ORF51). All three OBP-binding sites (Boxes A, B, and C) for VZV [50 -C(G/A)TTCGCACT-30 ] are upstream of the palindrome (Fig. 1). This is in contrast to the structure of HSV oriS, where the OBPbinding sites (Boxes I, II, and III) are located both upstream and downstream of the AT-rich element (Hay and Ruyechan, 2007; Stow and Davison, 1986). Using the in vitro DpnI assay, Stow et al. (1990) showed previously that the A site is absolutely required for DNA replication and that the deletion of the C site results in a decreased level of replication in VZV. In contrast, the deletion of the B site showed no effect on the extent of replication. In contrast, all three OBP-binding sites in HSV are required for efficient DNA replication (Stow and McMonagle, 1983; Balliet and Schaffer, 2006; Deb and Doelberg, 1988; Hernandez et al., 1991; Martin et al., 1991; Olsson et al., 2009; Weir and Stow, 1990). Stow et al. (1990) also showed that the CGC motif within the 10 nucleotides forming Box A, C and B is crucial for the binding of

180

M.I. Khalil et al. / Virology 481 (2015) 179–186

Fig. 1. The structure of the HSV-1 and VZV (A) genome and (B) oriS origins of DNA replication. (A) IRs and TRs are the internal and terminal repeat regions that bound the unique short segment of the genome. IRL and TRL are the internal and terminal repeat regions that bound the unique long segment of the genome. Two oriS copies are present in the IRs and TRs of the unique short segment in both HSV-1 and VZV. The HSV-1 oriL is present in the intergenic region between UL28 and UL29. (B) The positions of OBP binding site boxes and their orientations in HSV and VZV genomes. (C) A schematic diagram shows the structure of the wild type pLitmus R62/63 F plasmid used in the experiments where Renilla and firefly luciferase genes were placed in the position of ORF62 and ORF63 respectively.

ORF51 to these sites. Previous studies showed that either the complete deletion of the 10 nucleotides of Box A or the CGC mutations to AAA inhibits the VZV origin dependent DNA replication using the DpnI replication assay (Stow et al., 1990; Khalil et al., 2008, 2011, 2012). The deletion of the 10 nucleotides of Box C inhibited VZV origin dependent DNA replication 50–80% while the deletion of Box B has insignificant effect on VZV DNA replication (Stow et al., 1990). In this study we expand our understanding of the role of Box A, C and B by investigating the influence of the CGC motif mutation in these three origin binding protein boxes on VZV origin dependent DNA replication and the flanking gene transcription. Our results suggest the presence of another functional origin of DNA replication within the VZV genome. This origin(s) might be analogous to the HSV oriL.

Results Origin binding protein Boxes A, C and B influence origin-dependent DNA replication The first set of experiments employed the pLitmus R62/63 F plasmid which contains the whole intergenic region (  1.5 kb) between ORF62 and ORF63 genes and includes the complete VZV oriS structure. The assays were performed as described previously, by transfection of plasmids containing the wild type or mutant oriS sequence followed by VZV superinfection (Khalil et al., 2008, 2011, 2012). DpnI replication assays using the wild type pLitmus R62/63 F plasmid showed a detectable signal at the position predicted for the replicated DNA (Fig. 2A and B). In contrast, assays performed under the same conditions using the Box A mutant plasmid resulted in loss of the replicated DNA. This confirmed the results of Stow et al. (1990) who showed that Box A is required for VZV origin-dependent DNA replication. The CGC motif mutation of Box C inhibited oriS-dependent DNA replication by about 80%

which was a statistically significant inhibition. On the other hand, the CGC motif substitution to AAA of Box B had no effect on the VZV DNA, as shown in Fig. 2A and B. The effect of CGC motif mutation of Box C and B on oriS-dependent DNA replication is in agreement with the effect of the deletion of both boxes shown by Stow et al. (1990).

Influence of Box A, C and B on the expression of ORF62 and ORF63 genes To determine the involvement of the origin binding protein Boxes A, C and B in the expression of the flanking genes ORF62 and ORF63, we carried out a series of luciferase reporter gene assays examining this effect in the presence and absence of the VZV DNA polymerase inhibitor phosphonacetic acid (PAA). DpnI replication assays confirmed that the presence of 400 μg/ml of PAA completely inhibited oriS-dependent DNA replication (data not shown). The results of the luciferase reporter assays are shown in Fig. 2C and D. The Box A mutation inhibited the expression of ORF62 and ORF63 genes by about 7 and 5-fold, respectively, compared to the wild type level, in the absence of PAA. The Box C mutation inhibited the expression of both ORF62 and ORF63 by about 2fold in the absence of PAA. In contrast, the Box B mutation did not have a significant effect on either ORF62 or ORF63 expression in the absence of PAA. The presence of PAA inhibited the expression of ORF62 and ORF63 genes by about 7 and 5-fold respectively in the experiments using the wild type pLitmus R62/63 F plasmid (Fig. 2C and D). Mutations in any of the origin binding protein Boxes A, C or B had no statistically significant effect on the expression of ORF62 and ORF63 genes compared to the wild type level in the presence of PAA. These results suggest that the effects of the Box A and C mutations on the expression of ORF62 and ORF63 reporter genes are due to their role in oriS-dependent DNA replication, and not because they are part of the promoters of these genes.

M.I. Khalil et al. / Virology 481 (2015) 179–186

181

Fig. 2. The effect of Box A, Box C and Box B mutations on origin-dependent DNA replication and flanking gene expression in the context of VZV-MSP superinfection. (A) A typical Southern blot analysis of the effects on DNA replication of CGC motif mutation in Box A, C and B to AAA. The upper band (R) indicates the position of DpnI resistant DNA resulting from replication in MeWo cells. The lower band (U) indicates the position of unreplicated input plasmid. (B) A histogram summarizing the data from three independent DpnI replication assays analyzed at 48 h post-VZV-MSP superinfection. (C) Results of triplicate assays comparing the effect of the presence of Box A, Box C and Box B mutations on the expression levels of the Renilla luciferase reporter gene present at the position of ORF62 and (D) the firefly luciferase reporter gene present at the position of ORF63. The promoter activities in the presence of VZV-MSP superinfection are represented as RLU/β-Gal units. The black and gray bars represent experiments done in the absence and presence of 400 μg/ml of PAA respectively. Statistical significance was determined by a one-way ANOVA analysis of variance followed by Tukey's post-hoc test.

Influence of the complete deletion of oriS, and origin binding protein box mutations, on VZV growth kinetics in melanoma and HELF cells

were lower than pOka at day 5, while the Box C mutant and ΔoriS mutant viruses were equal to pOka titers at day 5 (Fig. 3B).

Since some of the OBP box mutations affected DNA replication and flanking gene transcription, their contribution to VZV replication was now investigated using mutant viruses. Three mutant viruses, one with the CGC motif mutation in Box C, one with the CGC motif mutation in Box B and the last one with a complete oriS structure deletion (deleting the region between nucleotide 110103–110319 and 119784–120000) were constructed. Transfections including a cosmid containing the CGC motif mutation in Box A did not yield a recombinant virus with this mutation. The growth kinetics of the wild type pOka recombinant virus and the three mutant recombinant viruses were evaluated in melanoma and HELF cells as shown in Fig. 3A and B respectively. In melanoma cells, there was a slight but statistically significant delay in the growth of both Box C and ΔoriS mutant viruses at day 1 post-infection. At day 2, only the Box C mutant virus displayed a significantly slower growth kinetics compared to pOka. The ΔoriS mutant grew as well as the wild type virus at day 2 post-infection. Titers of the Box C and ΔoriS mutant viruses did not differ from pOka from days 3 to 5 post-infection. The titers of the Box B mutant virus were similar to pOka over the 5 days interval (Fig. 3A). In contrast, the three mutant viruses showed impaired growth compared to pOka at day 1 post-infection in HELF cells which was statistically significant. Only the Box C mutant virus had statistically significant inhibition in growth kinetics compared to pOka at day 2 post-infection. Titers were equivalent for the three mutants and pOka at days 3 and 4 post-infection. The Box B mutant titers

IE62 and IE63 expression and VZV genome copies in mutant and pOka infected cells Next, we tested IE62 and IE63 expression levels in melanoma cells using the same mutant viruses and pOka at 36 h postinfection. IE62 and IE63 expression levels were decreased by 2–3 fold in cells infected with the Box C mutant and ΔoriS mutant viruses. In contrast, no significant change in IE62 and IE63 expression levels was detected in melanoma cells infected with the Box B mutant virus compared to pOka (Fig. 3C). VZV genome copies per nanogram of human DNA for the wild type and mutant viruses in melanoma cells were quantified by quantitative PCR. VZV genome copies did not change significantly for any of the three mutant viruses compared to pOka at 36 h postinfection (Fig. 3D).

Discussion Davison and Scott (1985) proposed the presence of a sequence that may be a part of the VZV replication origin within the TRs and IRs repeat regions based on the presence of an AT-rich sequence in a position equivalent to that of HSV oriS. Stow and Davison (1986) subsequently identified the presence of two VZV oriS copies within this repeat region, but when they tested the KpnI e fragment of the VZV genome, which contains the equivalent sequence of HSV oriL, they did not detect the presence of any

182

M.I. Khalil et al. / Virology 481 (2015) 179–186

Fig. 3. The effect of ΔoriS, Box C and Box B mutations on VZV replication in melanoma and HELF cells, and IE62 and IE63 expression levels in melanoma cells. Growth kinetics of the pOka wild type and mutant viruses are shown in (A) melanoma cells and (B) HELF cells. Cells were inoculated at 103 PFU/ml with wild type and mutant viruses and infectious virus yields were determined for 5 days after inoculation. (C) Western blot analyses show the expression levels of IE62, IE63 and α-tubulin. α-tubulin was used as a loading control in the experiments. The blots were scanned by densitometry to obtain quantitative data (in triplicate). (D) A histogram showing the VZV genome copies/ ng of human DNA at 0 and 36 h post-infection of melanoma cells using pOka and mutant viruses. Statistical significance was determined by a one-way ANOVA analysis of variance followed by Tukey's post-hoc test.

equivalent VZV oriL within this sequence. It is possible however, that rearrangement of any origin sequence in the KpnI e fragment of VZV took place during the replication of the plasmid in bacteria, as been seen with HSV oriL. Since this work, no further analysis has been done to search for the presence of additional origin(s) of DNA replication in any other segment of the VZV genome. Here we determined the involvement of the VZV origin binding protein boxes in modulating the expression of flanking genes, as well as oriS-dependent DNA replication and VZV growth in vitro. Mutations were introduced in the CGC motif within Box A, C and B sequences in a plasmid that contains the complete intergenic region between ORF62 and ORF63 genes, since this CGC motif was found to be essential for the binding of the origin binding protein ORF51 to these sites (Stow et al., 1990; Chen and Olivo, 1994). Our results confirmed the previous findings of Stow et al. (1990), done by deleting the 10 nucleotides forming Box A, C and B, that Box A is essential for the oriS-dependent DNA replication and Box C is an enhancer, while Box B is dispensable for any role. We found roles for the three origin binding protein boxes in ORF62 and ORF63 expression equivalent to their roles in oriS-dependent DNA replication. Boxes A and C were found to enhance flanking gene transcription in the experiments done in the absence of PAA while there was no effect in the presence of PAA. In contrast there was no influence of the Box B mutation on either IE62 or IE63 expression in the presence or absence of PAA. These results

suggest that the involvement of Box A and C in flanking gene transcription depends on their role in oriS-dependent DNA replication. It might also suggest that origin-dependent DNA replication and flanking gene transcription are coupled in VZV, which is not the case in HSV (Nguyen-Huynh and Schaffer, 1998; Summers and Leib, 2002). The data gathered on the influence of origin binding protein Boxes A, C and B on VZV origin-dependent DNA replication and flanking gene transcription led us to the following model. At the immediate early phase of the lytic infection, IE62 is expressed. Then at the early phase, IE62 activates expression of early genes, including the seven VZV replication factors (ORF6, 16, 28, 29, 51, 52 and 55). These factors allow origin-dependent DNA replication to start. This DNA replication further enhances ORF62 and ORF63 expression during early and late stages of infection. Thus, we observed that the presence of PAA or Box A and/or C mutations inhibit the expression of ORF62 and ORF63. This may also explain why late gene expression is linked to VZV DNA replication and why the inhibition of VZV DNA replication using PAA inhibits late virus gene expression. That inhibition of origin-dependent DNA replication inhibits the expression of ORF62 is clearly shown in Fig. 2; this likely decreases the amount of IE62 available inside the infected cells. This, in turn, might be the cause of the inhibition of expression of late genes, as they represent about 80% of the total VZV genes.

M.I. Khalil et al. / Virology 481 (2015) 179–186

183

Fig. 4. Schematic of the VZV genome indicating the distribution of short AT-rich sequences (7–10 nucleotides length) and partial OBP sites (80–90% identity). The sequence of the 80% partial OBP site that is in proximity to a short AT-rich stretch appears under the schematic. The partial OBP site is in bold italics and the short AT-rich stretch is in bold underlined.

The ability of ΔoriS virus to grow in melanoma and HELF cells and the lack of a significant influence of this deletion on the VZV genome copies in melanoma cells suggest the presence of one or more origin(s) of DNA replication within the VZV genome outside of the intergenic region between ORF62 and ORF63 genes. This would be analogous to the ability of HSV to replicate in the absence of the two oriS origins (Igarashi et al., 1993). Taking this finding together with the observation that a Box A mutation was not compatible with VZV replication in melanoma cells, we can conclude that this origin requires the origin binding protein ORF51 and an alternative origin binding protein box in order to be functional. The fact that the Box A mutation was lethal for replication might be attributed to the absence of any other identical OBP box in the genome except for the three present in each copy of the VZV oriS. In addition, the presence of wild type Box C and B sequences in the Box A mutant virus may act as competitors for binding of ORF51 to any other partial OBP site in any alternative origin of DNA replication. Stow et al. (1990) and Chen and Olivo (1994) showed that ORF51 binds to the wild type Boxes A, C and B with high affinity and more than to any mutant sequence. Analysis of the whole genome (125 kb) of VZV pOka indicates that it does not have any other copy of an origin binding protein box identical to the VZV oriS structure. However, we have found one partial OBP site with 90% identity to Boxes B and C, between nucleotides 43424 and 43432. In addition, there are 51 partial OBP sites in VZV with 80% identity to either Box A or (B and C), as shown in Fig. 4. We did not go beyond 80% because the partial OBP site in the downstream region of VZV oriS, which we called Box D, is 70% identical to Box A, and was shown by Stow et al. (1990) and Chen and Olivo (1994), to be incapable of binding ORF51. Another important factor in the minimum VZV origin of DNA replication is the presence of an AT-rich stretch. Stow and Davison (1986) showed that deletion of 20 nucleotides in the AT-rich stretch of oriS in VZV Dumas did not eliminate the ability to replicate. This finding may suggest that the presence of a short ATrich stretch proximal to a partial OBP site can act as a nucleus for forming an alternative VZV origin of replication, compensating for the absence of the two oriS copies in the mutant virus. Sequence analysis of the VZV genome showed the presence of 38 short AT-rich stretches, ranging from 7 to 10 nucleotides, outside of the two VZV oriS structures as shown in Fig. 4.

The last important point is the distance between a partial OBP site and an AT-rich stretch. Box A is 7 nucleotides from the AT-rich stretch and Box C is 68 nucleotides from the AT-rich stretch. Box C and B are not able to compensate for the absence of a functional Box A (due either to point mutations in the CGC motif or to deletion of the entire region), although the distance between Box C and AT-rich sequence is only 68 nucleotides. In our analysis of the VZV genome, all partial OBP sites are distant from the nearest short AT-rich sequence by at least 100 nucleotides except for one. That is located between nucleotides 69184 and 69193, in the coding sequence of ORF38, and is upstream from the nearest short AT-rich sequence by 18 nucleotides, similar to the three OBP sites in the two copies of VZV oriS. This sequence might be an alternative origin of DNA replication that compensates for the absence of the two copies of oriS in our studies. Another possibility that Stow and Davison (1986) have discussed, is the presence of a non-canonical origin(s) that is different from the VZV or HSV oriS and perhaps similar to EBV oriP (Yates et al., 1984). The EBV oriP does not contain either an AT-rich region or OBP sequences similar to that of HSV and VZV. This is the first report that indicates the possibility of the presence of another origin of DNA replication within the VZV genome. Future studies will involve further analysis of the VZV genome to seek to identify and characterize potential new origins of replication. The relevance of the likely additional origin of DNA replication to VZV infection in vivo remains unknown.

Conclusion The effect of the origin binding protein Boxes A, C and B mutation on origin-dependent DNA replication and transcription of the flanking genes in VZV suggests a possible coupling between DNA replication and gene transcription in VZV. In contrast, neither the oriS nor oriL of HSV have any influence over the transcription of flanking genes. That the ΔoriS virus is able to grow in melanoma and HELF cells suggests the presence of one or more origins of DNA replication outside of the region between ORF62 and ORF63 genes in VZV. This is the first report that indicates the possible presence of other origins of DNA replication in VZV.

184

M.I. Khalil et al. / Virology 481 (2015) 179–186

Materials and methods Cells and viruses MeWo cells, a human melanoma cell line, and primary human embryonic lung fibroblasts (HELF), were grown in Eagle's minimal essential medium supplemented with 10% fetal bovine serum (Spengler et al., 2000). VZV strains MSP and pOka were propagated in MeWo cell and HELF cell monolayers as previously described (Lynch et al., 2002; Peng et al., 2003). Immunoblot analysis Whole cell lysates of VZV infected MeWo cells were prepared in lysis buffer (50 mM Tris–HCl, pH 7.5, 0.15 M NaCl, 1 mM EDTA, 0.1% Triton X-100 and protease inhibitor cocktail (Roche, Mannheim, GE, added per the manufacturer's instructions)) and analyzed for IE62 and IE63 expression by immunoblot as previously described (Yang et al., 2004) using rabbit antisera against full-length IE62 (Spengler et al., 2000) and IE63 (Zuranski et al., 2005). Mouse monoclonal antibody against α-tubulin was obtained from SigmaAldrich (St. Louis, MO). Quantification of the relative amounts of IE62, IE63 and α-tubulin was done using a BioRad GS700 Imaging Densitometer (BioRad Hercules, CA). Statistical significance was determined by one-way ANOVA analysis of variance followed by Tukey's post-hoc test. Plasmids The plasmid pLitmus R62/63 F contains the complete 1.5 kb intergenic region of VZV DNA between ORF62 and ORF63 genes of strain pOka, including the VZV oriS structure, inserted between genes encoding Renilla and firefly luciferases (Promega), respectively, so that the luciferase genes acted as reporters of ORF62 and ORF63 transcription (Fig. 1C) (Jones et al., 2006). Plasmids containing Box A, C and B site-specific mutations within the oriS region were generated by mutating wild-type pLitmus R62/ 63 F plasmids using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) and the following primer sets: 50 GGCATGTGTCCAACCACCGTTAAAACTTTCTTTCTATA TATATAT-30 and 50 -ATATATATATAGAAAGAAAGTTTTAACGGTGGTTGGACACA TGCC-30 for the Box A mutation; and the following primer sets: 50 TACACTCTTTTA ATCTGCATTAAAACTTCCCGTTTTTTCACTGTA-30 and 50 -TACAGTGAAAAAACG GGAAGTTTTAATGC AGATTAAAAGAGTGTA30 for the Box C mutation; and the following primer sets: 50 -TC TGAGGCATGTAAACCCATTAAAACTTCCTGGGGTG GAATGGGG-30 and 50 -CCCCATTCCACCCCAGGAAGTTTTAATGGGTTTACATGC CTCAGA-30 for the Box B mutation. The mutated nucleotides are indicated in bold. All primers were synthesized by Integrated DNA Technologies (Coralville, IA). The mutations were verified by sequencing at the Roswell Park Cancer Institute sequencing facility, Buffalo NY. DpnI replication assays MeWo cells were transfected with Lipofectamine reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. 4 μl of Lipofectamine reagent was used per μg of transfected DNA in each transfection. Transfections were performed in 100mm-diameter dishes, with 2.1  106 MeWo cells per dish seeded in 12 ml of complete growth medium. The medium was replaced three hours before transfection and cells were 80% confluent at the time of transfection. Origin-dependent DNA replication experiments were performed as described previously (Khalil et al., 2008). The cells were transfected with 5 μg of wild-type or mutant pLitmus R62/63 F plasmids. At 6 h posttransfection, cells were superinfected with VZV strain MSP (Grose et al., 2004) by adding

0.4 infected cells per 1 uninfected cell to each monolayer. Total cellular DNA was prepared at 48 h after superinfection, and the DNA was isolated by phenol–chloroform extraction followed by ethanol precipitation. The DNA was digested with DpnI and EcoRI (Stow and Davison, 1986), and analyzed by Southern blot hybridization. The blots were probed with a 476-bp PCR product prepared from pLitmus R62/63 F by using primers 50 -TAGGCCACCACTTCAAGAACTCTGT-30 and 50 -AGCAAAAGGCCAGCAAAAGG CCAGG-30 ; the probe was end labeled with [α-32 P] ATP by using T4 kinase (Invitrogen, Carlsbad, CA). The resulting bands were quantified by PhosphorImager (Molecular Dynamics, Sunnyvale, CA) analysis. The ratio of replicated plasmid to input plasmid represents the replication efficiency of the test plasmid. The data from representative experiments are presented as the means of data from triplicate DpnI replication assays. Statistical significance was determined by a one-way ANOVA followed by Tukey's post-hoc test. Reporter gene assays Luciferase reporter gene assay experiments were performed in MeWo cells as previously described (Yang et al., 2004). Transfections were performed using 12-well plates with 2  105 MeWo cells seeded in each well 24 h before transfection. Cells were transfected with 1 μg of each reporter vector (pLitmus R62/63 F) using Lipofectamine reagent (Invitrogen, Carlsbad, CA), along with 0.4 μg of β-galactosidase (β-Gal)-expressing plasmid (Invitrogen, Carlsbad, CA) as a control of transfection efficiency. The cells were super infected with VZV MSP 24 h post-transfection using 0.4 infected cells per 1 uninfected cell. The cells were lysed 48 h post-transfection or super-infection in 250 μl of lysis buffer (50 mM HEPES, pH 7.4, 250 mM NaCl, 1% NP-40, 1 mM EDTA). Control experiments without VZV infection were done for each plasmid to determine basal expression levels. Dual-luciferase assays were performed using dual-luciferase reporter kit (Promega) according to the manufacturer's instruction. Transfection experiments were repeated a minimum of three times. Generation and growth kinetics of pOka recombinant viruses with mutations in the oriS structure Recombinant viruses were generated using cosmids derived from parental Oka (Niizuma et al., 2003). The entire pOka genome is included in four overlapping cosmids, designated Fsp73 (pOka nucleotides [nt] 1–33128), Spe14 (pOka nt 21795–61868), Pme2 (pOka nt 53755–96035), and Spe23 (pOka nt 94055–125124). The oriS is located in the internal repeat sequence/terminal repeat sequence (IRs/TRs) regions in cosmid Spe23. Four primers were designed to amplify a  4.5 kb fragment in two PCR products and to ligate the fragments together with the pLitmus(ORF59-65) in a three PCR product ligation reaction. The primer sequences to amplify these PCR products for Box B mutant viruses are as follows: for the first PCR product which contains CGC motif mutation in Box B, 50 -CCAGGA AGTTTTAATGGGTTTACATGCCTCAG-30 and 50 -ACAGTAGATCAGGTTAATCAG CGCGCGGTACTGTC-30 , and for the second PCR product 50 -GGTGGAATGGGG TGGGGTGGGGGGGTG -30 and 50 -CGCGGATGCATTTATTATCGGGCGACAAT CC-30 . The primer sequences to amplify these PCR products for Box C mutant viruses are as follows: for the first PCR product which contains CGC motif mutation in Box C, 50 ACGGGAAGTTTTAATGCAGATTAAAAGAGTGTATC-30 and 50 -ACA GTAGATCAGGTTAATCAGCGCGCGGTACTGTC-30 , and for the second PCR product 50 -TTTTTCACTGTATGGGTTTTCATGTTTTGGCATG-30 and 50 -CGCGG ATGCATTTATTATCGGGCGACAATCC-30 . The primer sequences to amplify these PCR products for ΔoriS mutant viruses are as follows: for the first PCR product, 50 -GAGAGAGAGA-

M.I. Khalil et al. / Virology 481 (2015) 179–186

GAGAGAGAGAGGGAGAGAGTTTC-30 and 50 -CGCGGATGCATT TATTATCGGGCGACAATCC-30 , and for the second PCR product 50 GGTTTACAT GCCTCAGATATGAAGTTCTTCGAC-30 and 50 -ACAGTAGATCAGGTTAATCAGC GCGCGGTACTGTC-30 . The first PCR product was digested with EcoRV and the second PCR product was digested with AatII. The digested PCR products were cloned into EcoRV/AatII, digested pLitmus(ORF59-65) and the SphI fragment was transferred from pLitmus(ORF59-65) to pLitmus(ORF66-71). Box C and B mutations and ΔoriS deletion were first introduced into pLitmus(ORF59-65) and pLitmus(ORF66-71) and were sequenced to verify the mutations. To insert these mutations into the pSpe23 cosmid, an NheI/AvrII fragment was excised from the pLitmus(ORF59-65) plasmid and ligated into pSpe23. In the final step, to insert the mutation into the other copy of the origin, an AscI/AvrII fragment from plasmid pLitmus(ORF66-71) was ligated into the corresponding mutant pSpe23 cosmid. Recombinant viruses were isolated by the transfection of melanoma cells with the wild type or the mutated Spe23 cosmid and the other three intact cosmids, Fsp73, Spe14, and Pme2. To confirm the targeted mutations in the oriS sequence, genomic DNA was extracted from virus-infected melanoma cells with DNAzol reagent (Invitrogen, Carlsbad, CA). A PCR fragment covering the mutated region was amplified from genomic DNA by using Pfu polymerase (Stratagene, La Jolla, CA), gel purified with a QIAquick gel extraction kit (Qiagen, Inc., Valencia, CA), and sequenced (Elim Biopharm, Inc., Hayward, CA). The preservation of the mutation after replication in HELF was documented by DNA sequencing. The replication kinetics of recombinant viruses were assessed by an infectious focus assay with immunostaining to detect plaques (Chaudhuri et al., 2008; Moffat et al., 1995). Briefly, 6well assay plates and 24-well titer plates were seeded with MeWo cells. Assay plates were incubated for variable times, and several dilutions of the samples were taken for infectious focus assay. Titer plates were incubated for 4 days then fixed with 4% paraformaldehyde for immunohistochemical staining using anti-VZV monoclonal antibody (Meridian) and plaques were counted. Statistical differences in growth kinetics based on plaque numbers were determined by Student's t test. Quantification of VZV genome copies in melanoma cells DNA was extracted from VZV infected melanoma cells by phenol– chloroform extraction followed by ethanol precipitation. Sso Advanced PCR mix (Bio-Rad) was used to amplify partial regions for the human β-actin gene using this set of primers, 50 -TTTGAGACCTTCA ACACCCCAGCC-30 and 50 -AATGTCACGCACGATTTCCCGC30 , or VZV ORF31 using this set of primers, 50 -ATGAAAACACTTTCTACCACG-30 and 50 -AGAGTTTT GAAGTATAATGCG-30 using a C1000 thermal cycler with the CFX384 Real-Time system (Bio-Rad) controlled by CFX Manager software version 1.6 (Bio-Rad) as described by Oliver et al. (2013). The parameters for thermocycling were as following: initial denaturation at 98 1C for 2 min followed by 39 cycles of denaturation at 98 1C for 5 s, annealing at 55 1C for 30 s, and extension at 68 1C for 30 s. Melting-curve analysis was performed to determine that single PCR products of the correct size were generated for all samples. For the quantification of the human and VZV DNA, two standards were used, β-actin gene was cloned into the PCR4.0 vector (Life Technologies) and VZV ORF31 into the pcDNA vector.

Acknowledgments This work was supported by Grants AI018449, AI053846 and AI020459 from the National Institutes of Health, and Grants from

185

the John R. Oishei Foundation and the National Shingles Foundation. We thank Stefan Oliver, Ph.D. for assistance with this work.

References Arvin, A.M., Gilden, D., 2013. Varicella-zoster virus. In: Howley, P.M., Knipe, D.M. (Eds.), Fields Virology, 2. Philadelphia, Lippincott Williams and Wilkins Press, pp. 2015–22184. Balliet, J.W., Min, J.C., Cabatingan, M.S., Schaffer, P.A., 2005. Site-directed mutagenesis of large DNA palindromes: construction and in vitro characterization of herpes simplex virus type 1 mutants containing point mutations that eliminate the oriL or oriS initiation function. J. Virol. 79, 12783–12797. Balliet, J.W., Schaffer, P.A., 2006. Point mutations in herpes simplex virus type 1 oriL, but not in oriS, reduce pathogenesis during acute infection of mice and impair reactivation from latency. J. Virol. 80 (1), 440–450. Chaudhuri, V., Sommer, M., Rajamani, J., Zerboni, L., Arvin, A.M., 2008. Functions of varicella-zoster virus ORF23 capsid protein in viral replication and the pathogenesis of skin infection. J. Virol. 82, 10231–10246. Chen, D., Olivo, P.D., 1994. Expression of the variella-zoster virus origin-binding protein and analysis of its site-specific DNA-binding properties. J. Virol. 68, 3841–3849. Davison, A.J., Scott, J.E., 1985. DNA sequence of the major inverted repeat in the varicella-zoster virus genome. J. Gen. Virol. 66, 207–220. Davison, A.J., Scott, J.E., 1986. The complete DNA sequence of varicella-zoster virus. J. Gen. Virol. 67, 1759–1816. Deb, S., Doelberg, M., 1988. A 67-base-pair segment from the Ori-S region of herpes simplex virus type 1 encodes origin function. J. Virol. 62, 2516–2519. Grose, C., Tyler, S., Peters, G., Hiebert, J., Stephens, G., Ruyechan, W., Jackson, W., Storlie, J., Tipples, G., 2004. Complete DNA sequence analyses of the first two varicella-zoster virus glycoprotein E (D150N) mutant viruses found in North America: evolution of genotypes with an accelerated cell spread phenotype. J. Virol. 78, 6799–6807. Hay, J., Ruyechan, W.T., 2007. Alphaherpesvirus DNA replication. In: Arvin, A., Campadelli-Fiume, G., Mocarski, E., Moore, P.S., Roizman, B, Whitley, R., Yamanishi, K. (Eds.), Human Herpesviruses: Biology, Therapy, and Immunoprophylaxis, 1. Cambridge University Press, Cambridge, pp. 138–143. Hernandez, T.R., Dutch, R.E., Lehman, I.R., Gustafsson, C., Elias, P., 1991. Mutations in a herpes simplex virus type 1 origin that inhibit interaction with origin-binding protein also inhibit DNA replication. J. Virol. 65, 1649–1652. Igarashi, K., Fawl, R., Roller, R.J., Roizman, B., 1993. Construction and properties of a recombinant herpes simplex virus 1 lacking both S-component origins of DNA synthesis. J. Virol. 67, 2123–2132. Jones, J.O., Sommer, M., Stamatis, S., Arvin, A.M., 2006. Mutational analysis of the varicella-zoster virus ORF62/63 intergenic region. J. Virol. 80, 3116–3121. Khalil, M.I., Hay, J., Ruyechan, W.T., 2008. The cellular transcription factors Sp1 and Sp3 suppress varicella zoster virus origin-dependent DNA replication. J. Virol. 82, 11723–11733. Khalil, M.I., Arvin, A., Jones, J., Ruyechan, W.T., 2011. A sequence within the varicella-zoster virus (VZV) OriS is a negative regulator of DNA replication and is bound by a protein complex containing the VZV ORF29 protein. J. Virol. 85, 12188–12200. Khalil, M.I., Robinson, M., Sommer, M., Arvin, A., Hay, J., Ruyechan, W.T., 2012. An Sp1/Sp3 site in the downstream region of varicella zoster virus oriS influences origin-dependent DNA replication and flanking gene transcription and is important for VZV replication in vitro and in human skin. J. Virol. 86, 13070–13080. Lynch, J.M., Kenyon, T.K., Grose, C., Hay, J., Ruyechan, W.T., 2002. Physical and functional interaction between the varicella zoster virus IE63 and IE62 proteins. Virology 302, 71–82. Martin, D.W., Deb, S.P., Klauer, J.S., Deb, S., 1991. Analysis of the herpes simplex virus type 1 OriS sequence: mapping of functional domains. J. Virol. 65, 4359–4369. Meier, J.L., Straus, S.E., 1993. Varicella-zoster virus DNA polymerase and major DNA-binding protein genes have overlapping divergent promoters. J. Virol. 67, 7573–7581. Moffat, J.F., Stein, M.D., Kaneshima, H., Arvin, A.M., 1995. Tropism of varicella-zoster virus for human CD4 þ and CD8 þ T lymphocytes and epidermal cells in SCIDhu mice. J. Virol. 69, 5236–5242. Nguyen-Huynh, A.T., Schaffer, P.A., 1998. Cellular transcription factors enhance herpes simplex virus type 1 oriS-dependent DNA replication. J. Virol. 72, 3635–3645. Niizuma, T., Zerboni, L., Sommer, M.H., Ito, H., Hinchliffe, S., Arvin, A.M., 2003. Construction of varicella-zoster virus recombinants from parent Oka cosmids and demonstration that ORF65 protein is dispensable for infection of human skin and T cells in the SCID-hu mouse model. J. Virol. 77, 6062–6065. Oliver, S.L., Brady, J.J., Sommer, M.H., Reichelt, M., Sung, P., Blau, H.M., Arvin, A.M., 2013. An immunoreceptor tyrosine-based inhibition motif in varicella-zoster virus glycoprotein B regulates cell fusion and skin pathogenesis. Proc. Natl. Acad. Sci. USA 110, 1911–1916. Olsson, M., Tang, K.W., Persson, C., Wilhelmsson, L.M., Billeter, M., Elias, P., 2009. Stepwise evolution of the herpes simplex virus origin binding protein and origin of replication. J. Biol. Chem. 284, 16246–16255.

186

M.I. Khalil et al. / Virology 481 (2015) 179–186

Peng, H., He, H., Hay, J., Ruyechan, W.T., 2003. Interaction between the varicella zoster virus IE62 major transactivator and cellular transcription factor Sp1. J. Biol. Chem. 278, 38068–38075. Spengler, M.L., Ruyechan, W.T., Hay, J., 2000. Physical interaction between two varicella zoster virus gene regulatory proteins, IE4 and IE62. Virology 272, 375–381. Stow, N.D., 1982. Localization of an origin of DNA replication within the TRS/IRS repeated region of the herpes simplex virus type 1 genome. EMBO J. 1, 863–867. Stow, N.D., Davison, A.J., 1986. Identification of a varicella-zoster virus origin of DNA replication and its activation by herpes simplex virus type 1 gene products. J. Gen. Virol. 67, 1613–1623. Stow, N.D., McMonagle, E.C., 1983. Characterization of the TRS/IRS origin of DNA replication of herpes simplex virus type 1. Virology 130, 427–438. Stow, N.D., Weir, H.M., Stow, E.C., 1990. Analysis of the binding sites for the varicella-zoster virus gene 51 product within the viral origin of DNA replication. Virology 177, 570–577. Straus, S.E., Owens, J., Ruyechan, W.T., Takiff, H.E., Casey, T.A., Vande Woude, G.F., Hay, J., 1982. Molecular cloning and physical mapping of varicella-zoster virus DNA. Proc. Natl. Acad. Sci. USA 79, 993–997.

Summers, B.C., Leib, D.A., 2002. Herpes simplex virus type 1 origins of DNA replication play no role in the regulation of flanking promoters. J. Virol. 76, 7020–7029. Weir, H.M., Stow, N.D., 1990. Two binding sites for the herpes simplex virus type 1 UL9 protein are required for efficient activity of the oriS replication origin. J. Gen. Virol. 71, 1379–1385. Weller, S.K., Spadaro, A., Schaffer, J.E., Murray, A., Maxam, A.M., Schaffer, P.A., 1985. Cloning, sequencing, and functional analysis of oriL, a herpes simplex virus type 1 origin of DNA synthesis. Mol. Cell. Biol. 5, 930–942. Yang, M., Hay, J., Ruyechan, W.T., 2004. The DNA element controlling expression of the varicella-zoster virus open reading frame 28 and 29 genes consists of two divergent unidirectional promoters which have a common USF site. J. Virol. 78, 10939–10952. Yates, J., Warren, N., Reisman, D., Sugden, B., 1984. A cis-acting element from the Epstein-Barr viral genome that permits stable replication of recombinant plasmids in latently infected cells. Proc. Natl. Acad. Sci. USA 81, 3806–3810. Zuranski, T., Nawar, H., Czechowski, D., Lynch, J.M., Arvin, A., Hay, J., Ruyechan, W.T., 2005. Cell-type-dependent activation of the cellular EF-1alpha promoter by the varicella-zoster virus IE63 protein. Virology 338, 35–42.