CSIRO PUBLISHING
Reproduction, Fertility and Development, 2016, 28, 328–336 http://dx.doi.org/10.1071/RD13277
Variations in epithelial Na1 transport and epithelial sodium channel localisation in the vaginal cul-de-sac of the brushtail possum, Trichosurus vulpecula, during the oestrous cycle T.-A. Alsop A,C, B. J. McLeod B and A. G. Butt A A
Department of Physiology, Otago School of Medical Sciences, University of Otago, PO Box 56, Dunedin 9054, New Zealand. B AgResearch Invermay, Private Bag 50034 Mosgiel 9053, New Zealand. C Corresponding author. Email: [email protected]
Abstract. The fluid in the vaginal cul-de-sac of the brushtail possum, Trichosurus vulpecula, is copious at ovulation when it may be involved in sperm transport or maturation, but is rapidly reabsorbed following ovulation. We have used the Ussing short-circuit current (Isc) technique and measurements of transcript and protein expression of the epithelial Naþ channel (ENaC) to determine if variations in electrogenic Naþ transport are associated with this fluid absorption. Spontaneous Isc (,20 mA cm2 during anoestrus, 60–80 mA cm2 in cycling animals) was inhibited by serosal ouabain. Mucosal amiloride (10 mmol L1), an inhibitor of ENaC, had little effect on follicular Isc but reduced luteal Isc by ,35%. This amiloride-sensitive Isc was dependent on mucosal Naþ and the half-maximal inhibitory concentration (IC50)– amiloride (0.95 mmol L1) was consistent with ENaC-mediated Naþ absorption. Results from polymerase chain reaction with reverse transcription (RT-PCR) indicate that aENaC mRNA is expressed in anoestrous, follicular and luteal phases. However, in follicular animals aENaC immunoreactivity in epithelial cells was distributed throughout the cytoplasm, whereas immunoreactivity was restricted to the apical pole of cells from luteal animals. These data suggest that increased Naþ absorption contributes to fluid absorption during the luteal phase and is regulated by insertion of ENaC into the apical membrane of cul-de-sac epithelial cells. Received 30 August 2013, accepted 27 May 2014, published online 24 July 2014
Introduction The brushtail possum has long been regarded as a major pest species in New Zealand and possum control is an integral part of both conservation and bovine tuberculosis (TB) control strategies (Coleman et al. 2006; Wright 2011). However, the toxins used in possum-control operations are becoming less acceptable to the public (Fitzgerald et al. 2000; Wright 2011). Identifying physiological differences between possums and eutherian mammals (farm and companion animals) and between possums and avian species (native New Zealand birds), which could be manipulated to produce a possum-specific control, is an integral part of studies to identify alternatives to traditional toxin controls. In particular, differences in reproductive physiology are of interest (Fitzgerald et al. 2000). Here we have investigated the epithelial transport properties of the vaginal cul-de-sac, a structure unique to marsupials. The marsupial vaginal complex consists of a single urogenital sinus leading to two lateral canals, which empty into a single vaginal cul-de-sac from which two uteri protrude (TyndaleBiscoe 1966). The function of the cul-de-sac is unknown. However, because extensive tissue remodelling of cul-de-sac Journal compilation Ó CSIRO 2016
epithelial cells and cyclical changes in cul-de-sac fluid volume are maximal around ovulation when mating occurs, it is thought that this structure plays a major role in the reproductive success of possums. Indeed it has been suggested that the cul-de-sac has a function relating to sperm transport, maturation or selection (Taggart 1994). Viscous, mucus-rich luminal fluid initially appears in the cul-de-sac of the possum during the follicular stage of the oestrous cycle and its volume progressively increases, reaching a maximum volume at oestrus (Hughes and Rodger 1971; Legge et al. 1996). Associated with the production of the fluid is a dramatic remodelling of the epithelial cells lining the cul-de-sac (Crawford et al. 1999). During the luteal phase, which follows ovulation, the fluid essentially disappears (Hughes and Rodger 1971) and the epithelial cells regress (Crawford et al. 1999). Similar changes in the volume of avian shell-gland fluid (Gautron et al. 1997; Vetter and O’Grady 2005) and eutherian uterine (Cassle´n 1986; Maier and Kuslis 1988) and cervical fluid (Kopito et al. 1973) occur during the female reproductive cycle. These changes in luminal fluid volume are a consequence of cyclical changes in ion transport properties of the epithelium www.publish.csiro.au/journals/rfd
Epithelial Naþ transport in the possum cul-de-sac
lining these segments of the female tract in both eutherian mammals (Levin and Edwards 1968; Chan et al. 2002; Salleh et al. 2005) and birds (Vetter and O’Grady 2005). In particular, the stimulation of Naþ absorption by progesterone contributes to the decrease in fluid volume during the luteal phase of the oestrous cycle in eutherian mammals (Chan et al. 2002; Naftalin et al. 2002; Yang et al. 2004; Salleh et al. 2005), and suppression of Naþ absorption by oestrogen is associated with the increase in fluid volume around the time of ovulation (Chan et al. 2001). Epithelial Naþ channel (ENaC)-mediated Naþ absorption in eutherians (Smith and Benos 1991; Garty and Palmer 1997) and possums (Butt et al. 2002b) is characterised by apical Naþ dependence (half-maximal effective concentration (EC50) apical Naþ of 15–30 mmol L1 eutherian tissue; Smith and Benos 1991; Garty and Palmer 1997) and sensitivity to the ENaC inhibitor amiloride (IC50 amiloride 0.1–1 mmol L1; Smith and Benos 1991; Garty and Palmer 1997). Similar concentrationdependent responses to amiloride have been measured in native uterine tissue (Vetter and Ogrady 1996) as well as cultured human endometrial cells (Matthews et al. 1998) and the avian shell gland (Vetter and O’Grady 2005). Thus, it is thought that epithelial Naþ absorption in the eutherian uterus and shell gland is similar to the ENaC-mediated Naþ absorption observed in tight absorptive epithelia, such as the renal tubule (Fro¨mter 1988) and distal colon of eutherian mammals (Kunzelmann and Mall 2002). In this process, luminal Naþ diffuses down its electrochemical gradient into the epithelial cells via ENaC and is transported out of the cells across the basolateral membrane by the basolateral Naþ/Kþ–ATPase. Cl and water follow passively with the net result being the absorption of fluid and electrolytes from the lumen (Kunzelmann and Mall 2002). The ENaC channel, which is the rate-limiting step in ENaC-mediated Naþ absorption, typically consists of three separate protein subunits, aENaC, bENaC and gENaC (Canessa et al. 1994), which are thought to be assembled as an a–b–g heterotrimer (Staruschenko et al. 2005; Jasti et al. 2007). The activity of ENaC in the apical membrane is modulated through both genomic mechanisms (e.g. changes in the rate of transcription of ENaC subunits; Asher et al. 1996; Boyd and NarayFejes-Toth 2005) and non-genomic mechanisms (e.g. changes in the rate of channel trafficking to and from the apical membrane; Palmer et al. 1982; Loffing et al. 2001). In eutherian reproductive tissue, it has been suggested that progesterone alters both the rate of ENaC trafficking to and from the apical membrane (Yang et al. 2004; Salleh et al. 2005) and the rates of transcription of the a and g ENaC subunits (Chan et al. 2002; Yang et al. 2004). The patterns of ovarian hormone secretion (Shorey and Hughes 1973; Curlewis et al. 1985) and progesterone receptor expression (Sizemore et al. 2004) during the oestrous cycle in possums are similar to those in eutherians. Therefore, it is possible that ovarian hormones, particularly progesterone, regulate cul-de-sac luminal fluid volume and composition by regulating ENaC-mediated Naþ absorption in a similar way to that seen in the eutherian reproductive tract. The objective of this study was to determine if there are cyclical changes in amiloride-sensitive Naþ absorption and associated changes in the localisation of aENaC in the possum vaginal cul-de-sac.
Reproduction, Fertility and Development
329
Material and methods Animals, tissue collection and tissue preparation This study used wild-caught, reproductively mature ($2.0 kg liveweight) female, Australian common brushtail possums (Trichosurus vulpecula). Animals were group-housed at the AgResearch Invermay possum facility as previously described (McLeod et al. 1997). All experimental procedures were approved by the University of Otago Animal Ethics Committee or the AgResearch Animal Ethics Committee, in accordance with the Animal Welfare Act of New Zealand, 1999. In experiments that compared the epithelial properties of the culde-sac from animals at different stages of the reproductive cycle, animals were randomly selected and their reproductive status determined on the basis of ovarian morphology (Crawford et al. 1997), assessed post mortem. Anoestrous animals were identified by the presence of small (#1.5 mm diameter) antral follicles on their ovaries. Animals with larger healthy follicles were classified as being in the follicular phase, and as being pre-ovulatory if the largest follicle was $5 mm in diameter. Imminent ovulation was identified based on a pre-ovulatory stigmata being present on a large ($5 mm diameter) dominant follicle. Animals were identified as being in the luteal phase by the presence of a large ($5 mm diameter) corpus luteum (CL) with mid luteal and late luteal phases differentiated by the colouration and degree of vascularisation of the CL. For experiments to characterise the amiloride and sodium dose response of cul-de-sac tissue from luteal phase animals, ovulation was synchronised by removal of pouch young and animals were killed between 19 and 21 days later in the predicted mid-luteal phase of the oestrous cycle. Possums were killed by intra-cardiac injection of Euthal (Delta Veterinary Laboratories, Sydney, NSW, Australia) while under halothane-induced anaesthesia. For Ussing chamber experiments the cul-de-sac tissues were transported to the laboratory in ice-cold NaCl–HCO 3 Ringer (the composition of all Ringer solutions used in these experiments is presented in Table 1). For RNA extraction pieces of Table 1. Composition of Ringer solutions used in epithelial transport studies Concentration (mmol L1)
Salt NaCl–HCO 3 NaCl NaGluconate nMDG-Cl KCl NaHCO3 Hepes/Tris CaCl2 MgSO4 Na2HPO4 NaH2PO4 K2HPO4 KH2PO4 Glucose Gas pH
110 0 0 5 25 0 1 0.5 1.8 0.2 0 0 10 95%O2 : 5%CO2 7.4
NaCl–HEPES
nMDG–HEPES
110 25 0 5 0 10 1 0.5 1.8 0.2 0 0 10 100%O2 7.4
0 0 143.8 1.2 0 10 1 0.5 0 0 1.8 0.2 10 100%O2 7.4
330
Reproduction, Fertility and Development
cul-de-sac tissue, ,2 cm2, were snap-frozen in liquid nitrogen immediately after dissection and stored at 808C. For immunohistochemistry cul-de-sac tissues were flushed with NaCl– HCO 3 Ringer and fixed in 4% (w/v) paraformaldehyde (Sigma Aldrich Corp, St Louis, MO, USA) in phosphate-buffered saline (PBS; 137 mmol L1 NaCl, 10 mmol L1 phosphate, 2.7 mmol L1 KCl, pH 7.4) for 24 h at 48C, followed by paraffin embedding. Measurement of epithelial transport Short-circuit current (Isc) was measured as previously described for possum gastrointestinal tract epithelia (Butt et al. 2002a, 2002b). Small sections of cul-de-sac epithelium were mounted, with the underlying muscular and connective tissue intact, between the two halves of an Ussing chamber (aperture 0.5 cm2) and superfused with Ringer solution. Oxygenation and stirring of the solutions was achieved via gas lift with 95% O2 : 5% CO2 when using bicarbonate-buffered Ringer and 100% O2 when using HEPES-buffered Ringer. The tissue and solutions were maintained at 378C by water jackets. Ouabain and amiloride were obtained from Sigma. Stocks of amiloride were prepared in appropriate Ringer and added in small aliquots to the apical side of the tissue to give the specified final concentration. Ouabain was added as aliquots of dry powder directly to the serosal chamber to give a final concentration of 1 mmol L1. Statistics for epithelial transport Results for electrophysiological experiments are presented as mean standard error of the mean (s.e.m.) with n ¼ the number of animals used, or as standard traces of tissues from individual animals. Differences between mean values were tested with an unpaired Student’s t-test or a one-way ANOVA. Where concentration response experiments were performed, data was fitted with the Hill equation and the half-maximal inhibitory concentration (IC50) or half-maximal effective concentration (EC50) and the Hill coefficient were calculated. All analyses were carried out with GraphPad Prism (GraphPad Inc., San Diego, CA, USA). For all statistical analyses P , 0.05 was considered to be significant. RNA isolation and sequencing of possum aENaC Frozen cul-de-sac samples were homogenised (Omni TH tissue homogeniser; Omni International, NW Kennesaw, GA, USA) in 1 mL of TRIzol reagent (Invitrogen Ltd, Auckland, New Zealand) per 50–100 mg tissue at room temperature and total RNA extracted according to the manufacturer’s instructions. Contaminating genomic DNA was removed with the DNA-Free reagent kit (Ambion, Inc., Austin, TX, USA) and purified RNA quantified with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Reverse transcription, to produce cDNA, was performed on 5 mg total RNA using the Superscript III RT and Oligo-DT primer Kit (Invitrogen) according to the manufacturer’s instructions. Oligonucleotide primers for amplification of the aENaC subunit were designed from a partial possum-specific sequence of aENaC (DQ645472). A possum-specific primer for the housekeeping gene b-actin (AF076190; Eckery et al. 2002) was used
T.-A. Alsop et al.
as a positive control for RNA quality. Primer sequences were as follows: aENaC, forward 50 –CAGGAGAACAACCCTCAGG–30 , reverse 50 –GAATGCTGGTTCATCTTGCC–30 ; possum b actin, forward 50 –TGAGCTCTTCCACCCAGC–30 , reverse 50 –GGATCTTCATGAGGTAGTC–30 . PCR reactions were performed in a 25 mL volume of 1 PCR buffer (Invitrogen) also containing 0.2 mmol L1 deoxynucleotide triphosphate (dNTPs), 0.4 mmol L1 forward and reverse primers, 2.5 U Taq DNA polymerase (Invitrogen), 1.5 mmol L1 MgCl2 and 0.5 mL of cDNA. PCR reactions were run using a PCR thermal cycler (Eppendorf; Mastercycler Gradient, Hamburg, Germany), which had been pre-warmed to 948C. Conditions for PCR were: denaturation at 948C for 45 s, annealing at 558C for 60 s, extension at 728C for 60 s for 30 cycles with a final extension at 728C for 10 min. PCR products were visualised on a 1% agarose gel. Amplification of target cDNA was confirmed by sequencing of PCR products using both the forward and reverse primers (Allan Wilson Centre Genome Sequencing Service, Massey University, Auckland, New Zealand). Immunolocalisation of a ENaC Sections (5 mm) were placed on slides coated with 2% 3-aminopropyliethoxysilane (Sigma), air-dried overnight at 458C and stored at 48C. After dewaxing, antigen retrieval was performed by heating slides in 1 mmol L1 ethylendiamine tetraacetic acid (EDTA) at pH 8.0 to above 958C for 8 min. Sections were blocked with 5% rabbit serum in PBS for 30 min and incubated with chicken anti-aENaC (diluted 1 : 35 in PBS with 5% rabbit serum; gift from S. Kumar, University of Adelaide, SA, Australia) for 2 h. The sections were then washed with PBS and incubated with fluorescein isothiocyanate (FITC)conjugated rabbit anti-chicken IgY (Sigma) for 2 h, washed in PBS and mounted in Vectashield HardSet mounting medium with 40 ,6-diamidino-2-phenylindole (DAPI) nucleic acid stain (Vector Laboratories, Burlingame, CA, USA). Negative controls were performed as for ENaC-specific immunostaining, but with affinity-purified non-immune chicken IgY (Sigma; 1 : 200 in PBS with 5% rabbit serum) used in place of the ENaC-specific primary antibody. Sections were examined and photographed using a confocal scanning laser system (Zeiss 510 LSM; Carl Zeiss, Jena, Germany) with care taken to photograph treatment and control tissue pairs using the same optical settings. Tissue samples collected from animals in each of the follicular, luteal and anoestrous stages were examined. Results Electrogenic ion transport in the cul-de-sac epithelium Spontaneous Isc and transepithelial resistance (Rt) were compared in cul-de-sac tissues collected from anoestrous- (n ¼ 9), follicular- (n ¼ 7) and luteal- (n ¼ 11) stage animals and bathed in NaCl–HCO 3 Ringer. Cycling animals had a spontaneous Isc of 58.1 18.9 mA cm2 and 67.0 8.8 mA cm2 in the follicular and luteal stages, respectively (Fig. 1a–d). Anoestrous animals had a significantly (P , 0.01) lower Isc of only 17.3 3.1 mA cm2. Serosal ouabain (1 mmol L1) inhibited ,80% of the
Epithelial Naþ transport in the possum cul-de-sac
(a)
Reproduction, Fertility and Development
(d)
20
∗∗
100 ∗∗∗
Control Ouabain
Isc (μA.cm⫺2)
Ouabain 10 Control
Isc (μA.cm⫺2)
75 15
50 25
5
0 10 min
⫺25
0
(b)
331
(e)
100
Anoestrus
Follicular
Luteal
Anoestrus
Follicular
Luteal
200
Ouabain 150
Control 50
Rt (Ω.cm⫺2)
Isc (μA.cm⫺2)
75
100
50
25
0
10 min
0
(c) 100
Ouabain
Isc (μA.cm⫺2)
75
Control 50
25
0
10 min
Fig. 1. A comparison of spontaneous short-circuit current (Isc) and response to ouabain (1 mmol L1 serosal) in cul-de-sac tissue from animals in the follicular, luteal and anoestrous stages of the ovulatory cycle. Representative results from cul-de-sac tissue collected from animals in (a) anoestrous, (b) follicular and (c) luteal stage of the oestrous cycle and bathed in NaCl–HCO 3 Ringer. (d) Mean ( s.e.m.) spontaneous Isc and Isc after ouabain (1 mmol L1 serosal) and (e) transepithelial resistance (Rt) from cul-de-sac tissue collected from animals in the anoestrous (n ¼ 9), follicular (n ¼ 7) and luteal (n ¼ 11) stages. Significant difference (**P , 0.01; ***P , 0.001) from anoestrous values, one-way ANOVA with Dunnett’s post hoc test.
spontaneous Isc in all three stages (Fig. 1), indicating that the spontaneous Isc was due to active electrogenic ion transport. There was no significant difference in Rt (,150 Ocm2) in either stage of the oestrous cycle or in anoestrous tissues (Fig. 1e). In the eutherian female reproductive tract there is an increase in ENaC-mediated electrogenic Naþ absorption in the luteal phase, which plays a major role in regulating luminal fluid volume (Naftalin et al. 2002; Salleh et al. 2005). Mucosal amiloride (10 mmol L1), a selective inhibitor of ENaC (Garty and Palmer 1997), significantly (P , 0.001) reduced the spontaneous Isc in cul-de-sac tissue from luteal-phase animals from 82.4 11.3 mA cm2 to 51.9 6.9 mA cm2 (n ¼ 11), but had little effect on the spontaneous Isc of tissue from follicular-phase animals (DIsc 5.5 2.2 mA cm2, n ¼ 7, Fig. 2).
The concentration dependence of the inhibition of Isc by amiloride in cul-de-sac tissue from luteal-phase animals (IC50 ¼ 0.95, Hill Coefficient ¼ 0.901; Fig. 3) is consistent with the absorption of Naþ via ENaC in eutherian tissues (Garty and Palmer 1997) and possum colon (Butt et al. 2002b). However, the highest concentration of amiloride (100 mmol L1) added to the cul-de-sac only inhibited ,50% of the Isc, indicating that there is a significant amiloride-insensitive component to electrogenic ion transport in the possum cul-de-sac. To confirm that the amiloride-sensitive Isc seen in cul-de-sac tissue from luteal-phase animals was dependent upon Naþ, the effect of replacing mucosal Naþ with the impermeant cation n-methyl-D-glucamine (nMDG) on the total and amiloridesensitive component of the Isc was investigated. In this series
Isc (μA.cm⫺2)
(a)
Reproduction, Fertility and Development
T.-A. Alsop et al.
(a) 150
150 Amiloride
Ouabain
Ouabain
Isc (μA.cm⫺2)
332
100
50 Control
100
50 0.001
0.01
0.1
1
10 100
5 min 0
(b)
5 min
0
(b) 120
Amiloride Ouabain
150
100 Control
80 60 40
50
20 0
0.001 0.01
0.1
1
10
100
1000
[Mucosal amiloride] (μmol L⫺1) ∗∗
⫺10 Amiloride
⫺20
Control ⫺30 ⫺40
Amiloride Vehicle
0
5 min
(c) 10 ΔIsc (μA.cm⫺2)
% initial Isc
Isc (μA.cm⫺2)
100
Follicular
Fig. 3. Cumulative inhibition of spontaneous short-circuit current (Isc) of cul-de-sac tissue from animals in the luteal phase bathed in NaCl–HCO 3 Ringer in response to increasing concentrations of mucosal amiloride (0.001–100 mmol L1). (a) Representative trace (Isc) and (b) cumulative concentration response curve (% initial Isc) comparing the effect of amiloride (J) with equivalent volumes of vehicle added to the control tissues (W); n ¼ 3 animals. A modified Hill function was fitted to the dataset; IC50 amiloride was 0.95 mmol L1 and the Hill coefficient 0.901.
Luteal
Fig. 2. Mucosal amiloride inhibits the spontaneous short-circuit current (Isc) in the cul-de-sac. The effect of 10 mmol L1 mucosal amiloride on Isc of cul-de-sac tissue from animals in (a) the follicular stage of the reproductive cycle (n ¼ 7) and (b) the luteal stage (n ¼ 11), both bathed in NaCl–HCO 3 Ringer. (c) Mean ( s.e.m.) change in the spontaneous short-circuit current (DIsc) in cul-de-sac tissue in response to 10 mmol L1 mucosal amiloride. Significant difference (*P , 0.05; **P , 0.01) from control value, unpaired Student’s t-test.
of experiments, it was necessary to replace HCO 3 with HEPES and Cl (nMDG–HEPES Ringer, Table 1) and gas the tissues with 100% O2. However, the spontaneous Isc of cul-de-sac tissue collected from animals in the luteal phase and bathed in NaCl– HEPES Ringer (67.0 8.8 mA cm2, n ¼ 7; Fig. 4) was similar to that seen in NaCl–HCO3 Ringer (Fig. 1), indicating that differences seen in the amiloride-sensitive Isc on substitution of þ Naþ were not due to the removal of HCO 3 . Substitution of Na in the mucosal solution with nMDG reduced the spontaneous Isc in tissues from luteal-phase animals from 78.4 14.3 mA cm2 to 23.9 6.7 mA cm2 (Fig. 4b) and essentially eliminated the amiloride-sensitive Isc (DIsc amiloride ¼ 36.5 9.9 mA cm2 in NaCl–HEPES Ringer solution and 0.1 0.3 mA cm2 in nMDG–HEPES Ringer solution; Fig. 4c). Cumulative, isosmotic additions of Naþ to an initially þ Na -free mucosal bathing solution induced an increase in Isc
in cul-de-sac tissue (Fig. 4a). However, consistent with the presence of an amiloride-insensitive Isc in the cul-de-sac, pretreatment of tissue with mucosal amiloride (100 mmol L1) did not completely eliminate the induction of Isc by Naþ (Fig. 4a). Consequently, following the addition of 50 and 100 mmol L1 mucosal Naþ to the amiloride-pre-treated tissues, the Isc increased by 6.5 2.3 mA cm2 and 12.0 2.2 mA cm2 (n ¼ 7), respectively. This effect was not due to a reversal of inhibition of amiloride, as the NaCl–HEPES Ringer solution used for the re-addition of Naþ also contained 100 mmol L1 amiloride. The Naþ dependence of the amiloride-sensitive component of the spontaneous Isc had an EC50 of 13.25 mmol L1 apical Naþ (Fig. 4b). The amiloride-insensitive, Naþ-dependent current was sensitive to ouabain, suggesting that a second, Naþ-dependent, electrogenic transport mechanism is present in the cul-de-sac. Localisation of aENaC in the cul-de-sac epithelium Functional ENaC channels usually require the assembly of a heterotrimer consisting of the a, b and g ENaC subunits in the apical cell membrane (Staruschenko et al. 2005). Consequently, Naþ transport can be regulated by either altering the localisation (Loffing et al. 2001; Snyder et al. 2002; Bhalla et al. 2006) or transcription (Asher et al. 1996) of any one of the three ENaC subunits, although in eutherian reproductive tissues
Epithelial Naþ transport in the possum cul-de-sac
(a)
Reproduction, Fertility and Development
β-Actin
Amiloride
333
α-ENaC
200
Isc (μA.cm⫺2)
Na⫹ mmol L⫺1 150
100
680 bp 446 bp
5 1.0 0.5
50
Ouabain
50 10
% maximum Iscamiloride
120 100
60 40 20 0
100
1
10
[Na⫹] (mmol L⫺1)
∗∗
100
1000
Before amiloride After amiloride
80
Isc (μA.cm⫺2)
L
A DC -ve F
FRNA L
LRNA A ARNA
80
⫺20
(c)
F
Fig. 5. Representative RT-PCR of aENaC (446 bp) and b-actin (loading control, 680 bp) from cDNA made from distal colon control tissue (DC) and cul-de-sac tissue collected from animals in either the follicular (F), luteal (L) or anoestrous (A) phase of the oestrous cycle. Negative controls were milli-Q water (–ve), follicular RNA (FRNA), luteal RNA (LRNA) and anoestrous RNA (ARNA). Results representative of reactions from three animals from each stage of the oestrous cycle.
10 min
0 Amiloride
(b)
DC -ve
100
60 40 20 0 Control
Mucosal Na⫹free
Fig. 4. Apical Naþ dependence of the Isc of cul-de-sac tissue. (a) A representative experiment showing the cumulative increase in Isc in response to the isosmotic addition of increasing concentrations of Naþ to the mucosal solution of cul-de-sac tissues with or without 100 mmol L1 amiloride in the mucosal bathing solution. (b) Shows mean s.e.m. increase in Isc in response to cumulative isosmotic additions of increasing concentrations of Naþ expressed as a percentage of the maximum amiloride-sensitive Isc (% maximum Iamiloride ); n ¼ 7 animals. A modified Hill function was fitted to sc the dataset; EC50 Naþ ¼ 13.25 mmol L1, the Hill coefficient ¼ –1.23. (c) The effect of 10 mmol L1 mucosal amiloride on the Isc of cul-de-sac tissues from animals in the luteal phase bathed in either NaCl–HEPES Ringer (containing Naþ) or nMDG–HEPES (Naþ free) Ringer solution (all values mean s.e.m.). Significant difference (**P , 0.01) from the Isc before amiloride, paired Student’s t-test, (n ¼ 7).
progesterone modulates Naþ transport primarily through regulation of the a or gENaC subunits (Sweezey et al. 1998; Chan et al. 2002; Salleh et al. 2005; Salker et al. 2011). Polymerase chain reaction with reverse transcription (RT-PCR) on cDNA from cul-de-sac tissue of animals in the luteal, follicular and anoestrous phases (Fig. 5) using possumspecific primers for aENaC, suggested that transcript for this subunit was present in cul-de-sac tissue at all three reproductive
stages. However, immunofluorescence for aENaC showed that variations in the localisation of aENaC within the cul-de-sac epithelium occurred during the oestrous cycle. Sections from cul-de-sac tissues collected from animals in the follicular (Fig. 6a) and luteal (Fig. 6e) stage, stained with haematoxylin and eosin (H&E), demonstrate the difference in epithelial cell size and structure between the two stages of the oestrous cycle. In tissue from the follicular phase (Fig. 6b, c), aENaC immunoreactivity (green) was diffusely spread throughout the cytoplasm, whereas in tissues from the luteal phase aENaC immunoreactivity was localised in the region of the apical membrane (Fig. 6f, g). Control treatment with non-immune chicken IgY demonstrated that some of the cytoplasmic staining in the tissues from the follicular stage was non-specific (Fig. 6d), which may reflect non-specific binding of antibodies to the large number of mucus vesicles seen in the cytoplasm of cul-de-sac epithelial cells in follicular-phase animals (Crawford et al. 1999). Discussion The epithelial structure (Crawford et al. 1999) and luminal-fluid volume (Hughes and Rodger 1971) of the possum vaginal cul-de-sac vary extensively with the ovulatory cycle, as they do in the eutherian female uterus and cervix (Kopito et al. 1973; Cassle´n 1986; Maier and Kuslis 1988). Cyclical changes in the luminal fluid in the eutherian female reproductive tract are known to involve cyclical changes in epithelial Naþ absorption (Naftalin et al. 2002; Yang et al. 2004; Salleh et al. 2005), which are linked to cyclical changes in both the expression (Chan et al. 2002; Yang et al. 2004) and degree of apical localisation (Yang et al. 2004; Salleh et al. 2005) of the a and g ENaC subunits. This study has identified for the first time that there are cyclical changes in ENaC-mediated Naþ absorption and related changes in the localisation of aENaC in the possum cul-de-sac that coincide with cyclical changes in luminal-fluid volume and epithelial structure. Cyclical changes in ion transport occur in the vaginal cul-de-sac In the cul-de-sac of animals in the anoestrous phase of the oestrous cycle there was very little active ion transport compared with that in cycling animals. There are no data on
334
Reproduction, Fertility and Development
T.-A. Alsop et al.
(a)
(b)
(c)
(d )
(e)
(f )
(g)
(h)
Fig. 6. Variation in the localisation of aENaC within the epithelial cells of cul-de-sac tissue collected from animals in the follicular and luteal phases of the oestrous cycle. (a, e) Hematoxylin and eosin (H&E)-stained sections for cul-de-sac tissue from follicular- and luteal-phase animals, respectively, show the larger epithelial cell volume in the follicular phase compared with the luteal phase and serve as a comparison for the immune-stained sections. Immunolocalisation of aENaC (green) in cul-de-sac tissue from (b, c) follicular- and ( f, g) luteal-phase animals, compared with negative controls (d, follicular and g, luteal) probed with non-immune IgY. Nucleic acid stained with DAPI (blue). Representative of measurements from three animals at each stage.
ion-transport patterns in the reproductive tracts of eutherian mammals during seasonal anoestrus that would allow comparisons with the possum cul-de-sac. Therefore, the anoestrous data was compared with published data from tissues from ovariectomised eutherian animals, which would be devoid of steroid reproductive hormones. Similar to the cul-de-sac from possums during anoestrus, the uteri of ovariectomised rats have reduced fluid volume compared with intact animals or ovariectomised animals treated with exogenous ovarian hormones (Salleh et al. 2005). The data presented in this study indicate that the cul-desac is in a quiescent state during anoestrus, which is consistent with previous histological data that showed the epithelial cells lining the cul-de-sac of anoestrous animals are inactive (Crawford et al. 1999). Despite the fact that cul-de-sac tissue from animals in the both follicular and luteal phases has a similar Isc, cul-de-sac tissue from follicular-phase animals had essentially no amiloride-sensitive Isc (5.6 2.5% of total Isc), whereas 36.1 3.2% of the total Isc in cul-de-sac tissue from animals in the luteal phase of the oestrous cycle was amiloride sensitive. This finding indicates that electrogenic, ENaC-mediated, Naþ absorption is greatest in the luteal stage, when there is known to be a decrease in luminal-fluid volume (Hughes and Rodger 1971), and electrogenic Naþ absorption is minimal in cul-de-sac tissue from follicular-stage animals, coinciding with the highest volume of luminal fluid (Hughes and Rodger 1971). The presence of a large amiloride-insensitive Isc in cul-de-sac tissue from follicularstage animals could be indicative of a secretory process involved in the formation of cul-de-sac luminal fluid. In summary, these concentration-response experiments indicate that the amiloridesensitive component of the Isc from luteal-phase animals is consistent with Naþ absorption mediated by ENaC.
The IC50 for amiloride (0.95 mmol L1) in cul-de-sac tissue from luteal-phase animals is comparable with typical values for ENaC-mediated Naþ absorption in eutherian mammals, which range from 0.1 to 1 mmol L1 (Smith and Benos 1991; Garty and Palmer 1997) and also the possum colon (Butt et al. 2002b). The EC50 for mucosal Naþ in this tissue was lower than, but not dissimilar to, typical eutherians values for ENaC (Smith and Benos 1991; Garty and Palmer 1997). ENaC activity can be inhibited by rapid increases in external Naþ concentrations, a process known as Naþ self-inhibition (Van Driessche and Lindemann 1979; Chraı¨bi and Horisberger 2002). It is possible that Naþ self-inhibition occurred in cul-de-sac tissue when mucosal Naþ was increased to 50 and 100 mmol L1 (Chraı¨bi and Horisberger 2002), and thus may have decreased the EC50 Naþ values obtained. The concentration-response experiments identified an apical Naþ-dependent, amiloride-insensitive component to the Isc in the cul-de-sac of luteal-phase animals, indicated by the fact that in the presence of 100 mmol L1 mucosal amiloride the isosmotic addition of 50 and 100 mmol L1 mucosal Naþ increased Isc by 6.5 2.3 mA cm2 and 12.0 2.2 mA cm2, respectively. This may indicate the presence of a small population of ENaC channels with an atypical stoichiometry, as many of these have reduced sensitivity to amiloride (McNicholas and Canessa 1997), or it could be an unrelated Naþ-dependent transport process. Cyclical changes in aENaC localisation There were clear differences in the location of the aENaC during the oestrous cycle. In cul-de-sac tissue from animals in the luteal phase, which has the highest level of amiloride-sensitive Isc and the lowest luminal-fluid volume (Hughes and Rodger 1971),
Epithelial Naþ transport in the possum cul-de-sac
immunoreactivity for aENaC was concentrated at the apical pole of epithelial cells and very little reactivity was seen in the cytoplasm. In contrast, tissue from follicular-stage animals had aENaC immunoreactivity throughout the cytoplasm. These data suggest the difference in the Isc of the cul-de-sac from animals in the luteal and follicular stages are, in part, regulated by altering the amount of ENaC present at the apical membrane by changing the rate of ENaC trafficking to or from the cell surface, in a similar way to that observed in eutherian mammals (Palmer et al. 1982; Loffing et al. 2001; Snyder et al. 2002). However, the possibility that changes in the activity, rather than the amount or localisation of ENaC, contribute to cyclical changes in amiloride-sensitive Isc in the cul-de-sac cannot be excluded. It is also possible that the activity of other transporters may modulate ENaC transport; for example, in the eutherian tract there is evidence that ENaC activity decreases in the follicular phase due to interactions with the cystic fibrosis transmembrane conductance regulator (CFTR), the activity of which is thought to be increased by oestrogen (Rochwerger and Buchwald 1993; Chan et al. 2002). Potential manipulation of epithelial Na1 absorption in the cul-de-sac as a contraceptive or sterilant Possum control is an integral part of both conservation and TB-control strategies in New Zealand (Coleman et al. 2006; Wright 2011). However, the toxins used in possum control operations, in particular sodium monofluoroacetate (1080), are becoming less acceptable to the public (Fitzgerald et al. 2000; Wright 2011). For this reason, much research in recent years has focused on the development of alternatives to these toxins. Of all actual and hypothetical alternatives to toxins, contraceptives and sterilants are viewed most favourably by the public (Fitzgerald et al. 2000). Diseases that alter the epithelial iontransport mechanisms involved in driving fluid secretion or modulating luminal-fluid composition in the eutherian female reproductive tract can cause infertility. For example, the infertility seen in women with cystic fibrosis is related to the absence of HCO 3 secretion via the anion channel CFTR (Chan et al. 2009; Muchekehu and Quinton 2010). Data presented in this paper suggest that aENaC subunits are present in the cytoplasm of cul-de-sac epithelial cells in the follicular phase and are inserted into the apical membrane in the luteal phase under the influence of progesterone, thus contributing to the regulation of luminal-fluid reabsorption after ovulation. This implies that stimulation of the insertion of ENaC channels into the apical membrane during the follicular phase could result in early absorption of the luminal fluid and a reduction in reproductive success. However, further research is required to determine how ENaC trafficking is regulated in the possum cul-de-sac and, in particular, whether there are any significant differences from eutherians that could be exploited. Acknowledgements We thank Euan Thompson for the collection and maintenance of the possums and assistance with collection of cul-de-sac tissues. This work was supported by grants from the Foundation for Research Science and Technology, the Animal Health Board NZ Inc. and the National Research
Reproduction, Fertility and Development
335
Centre for Possum Biocontrol. Toni-Ann Alsop was supported by The Graduate Research Committee of the University of Otago through the provision of a University of Otago Postgraduate Publishing Bursary and by the Fanny Evans Postgraduate Scholarship for Woman.
References Asher, C., Wald, H., Rossier, B. C., and Garty, H. (1996). Aldosteroneinduced increase in the abundance of Naþ channel subunits. Am. J. Physiol. Cell Physiol. 271, C605–C611. Bhalla, V., Soundararajan, R., Pao, A. C., Li, H. Y., and Pearce, D. (2006). Disinhibitory pathways for control of sodium transport: regulation of ENaC by SGK1 and GILZ. Am. J. Physiol. Renal Physiol. 291, F714–F721. doi:10.1152/AJPRENAL.00061.2006 Boyd, C., and Naray-Fejes-Toth, A. (2005). Gene regulation of ENaC subunits by serum- and glucocorticoid-inducible kinase-1. Am. J. Physiol. Renal Physiol. 288, F505–F512. doi:10.1152/AJPRENAL.00242.2004 Butt, A. G., Mathieson, S. E., and McLeod, B. J. (2002a). Aldosterone does not regulate amiloride-sensitive Naþ transport in the colon of the Australian common brushtail possum, Trichosurus vulpecula. J. Comp. Physiol. B 172, 519–527. doi:10.1007/S00360-002-0278-8 Butt, A. G., Mathieson, S. E., and McLeod, B. J. (2002b). Electrogenic ion transport in the intestine of the Australian common brushtail possum, Trichosurus vulpecula: indications of novel transport patterns in a marsupial. J. Comp. Physiol. B 172, 495–502. doi:10.1007/S00360002-0275-Y Canessa, C. M., Schild, L., Buell, G., Thorens, B., Gautschi, I., Horisberger, J. D., and Rossier, B. C. (1994). Amiloride-sensitive epithelial Naþ channel is made of 3 homologous subunits. Nature 367, 463–467. doi:10.1038/367463A0 Cassle´n, B. (1986). Uterine fluid volume. Cyclical variations and possible extrauterine contributions. J. Reprod. Med. 31, 506–510. Chan, L. N., Wang, X. F., Tsang, L. L., So, S. C., Chung, Y. W., Liu, C. Q., and Chan, H. C. (2001). Inhibition of amiloride-sensitive Naþ absorption by activation of CFTR in mouse endometrial epithelium. Pflugers Arch. 443, S132–S136. doi:10.1007/S004240100660 Chan, L. N., Tsang, L. L., Rowlands, D. K., Rochelle, L. G., Boucher, R. C., Liu, C. Q., and Chan, H. C. (2002). Distribution and regulation of ENaC subunit and CFTR mRNA expression in murine female reproductive tract. J. Membr. Biol. 185, 165–176. doi:10.1007/S00232-001-0117-Y Chan, H. C., Ruan, Y. C., He, Q., Chen, M. H., Chen, H., Xu, W. M., Chen, W. Y., Xie, C., Zhang, X. H., and Zhou, Z. (2009). The cystic fibrosis transmembrane conductance regulator in reproductive health and disease. J. Physiol. 587, 2187–2195. doi:10.1113/JPHYSIOL.2008.164970 Chraı¨bi, A., and Horisberger, J.-D. (2002). Na self-inhibition of human epithelial Na channel: temperature dependence and effect of extracellular proteases. J. Gen. Physiol. 120, 133–145. Coleman, J. D., Coleman, M. C., and Warburton, B. (2006). Trends in the incidence of tuberculosis in possums and livestock, associated with differing control intensities applied to possum populations. N. Z. Vet. J. 54, 52–60. doi:10.1080/00480169.2006.36612 Crawford, J. L., Shackell, G. H., Thompson, E. G., McLeod, B. J., and Hurst, P. R. (1997). Preovulatory follicle development and ovulation in the brushtail possum (Trichosurus vulpecula) monitored by repeated laparoscopy. J. Reprod. Fertil. 110, 361–370. doi:10.1530/JRF.0.1100361 Crawford, J. L., McLeod, B. J., and Hurst, P. R. (1999). Cyclical changes in epithelial cells of the vaginal cul-de-sac of brushtail possums (Trichosurus vulpecula). Anat. Rec. 254, 307–321. doi:10.1002/(SICI)10970185(19990301)254:3,307::AID-AR1.3.0.CO;2-U Curlewis, J. D., Axelson, M., and Stone, G. M. (1985). Identification of the major steroids in ovarian and adrenal venous plasma of the brush-tail possum (Trichosurus, vulpecula) and changes in the peripheral plasma levels of oestradiol and progesterone during the reproductive cycle. J. Endocrinol. 105, 53–62. doi:10.1677/JOE.0.1050053
336
Reproduction, Fertility and Development
T.-A. Alsop et al.
Eckery, D. C., Whale, L. J., Lawrence, S. B., Wylde, K. A., McNatty, K. P., and Juengel, J. L. (2002). Expression of mRNA encoding growth differentiation factor 9 and bone morphogenetic protein 15 during follicular formation and growth in a marsupial, the brushtail possum (Trichosurus vulpecula). Mol. Cell. Endocrinol. 192, 115–126. doi:10.1016/S0303-7207(02)00085-0 Fitzgerald, G., Wilkinson, R., and Saunders, L. (2000) Public perceptions and issues in possum control. In ‘The Brushtail Possum’. (Ed. TL Montague.) pp. 187–197. (Manaaki Whenua Press: Lincon, Canterbury.) Fro¨mter, E. (1988). Mechanisms and regulations of ion transport in the renal collecting duct. Comp. Biochem. Physiol. A 90, 701–707. doi:10.1016/ 0300-9629(88)90687-1 Garty, H., and Palmer, L. G. (1997). Epithelial sodium channels: function, structure and regulation. Physiol. Rev. 77, 359–396. Gautron, J., Hincke, M. T., and Nys, Y. (1997). Precursor matrix proteins in the uterine fluid change with stages of eggshell formation in hens. Connect. Tissue Res. 36, 195–210. doi:10.3109/03008209709160220 Hughes, R. L., and Rodger, J. C. (1971). Studies on the vaginal mucus of the marsupial Trichosurus vulpecula. Aust. J. Zool. 19, 19–33. doi:10.1071/ ZO9710019 Jasti, J., Furukawa, H., Gonzales, E., and Gouaux, E. (2007). Structure of ˚ resolution and low pH. Nature 449, acid-sensing ion channel 1 at 1.9 A 316–323. doi:10.1038/NATURE06163 Kopito, L. E., Kosasky, H. J., and Shwachman, H. (1973). Water and electrolytes in cervical mucus from patients with cystic fibrosis. Fertil. Steril. 24, 512–516. Kunzelmann, K., and Mall, M. (2002). Electrolyte transport in the mammalian colon: mechanisms and implications for disease. Physiol. Rev. 82, 245–289. Legge, M., Hill, B. L., Shackell, G. H., and McLeod, B. J. (1996). Glycosaminoglycans of the uterine and vaginal cul-de-sac tissue in the brushtail possum (Trichosurus vulpecula). Reprod. Fertil. Dev. 8, 819–823. doi:10.1071/RD9960819 Levin, R. J., and Edwards, F. (1968). Transuterine endometrial potential difference, its variation during oestrous cycle and its relation to uterine secretion. Life Sci. 7, 1019–1036. doi:10.1016/0024-3205(68) 90208-7 Loffing, J., Zecevic, M., Feraille, E., Kaissling, B., Asher, C., Rossier, B. C., Firestone, G. L., Pearce, D., and Verrey, F. (2001). Aldosterone induces rapid apical translocation of ENaC in early portion of renal collecting system: possible role of SGK. Am. J. Physiol. Renal Physiol. 280, F675–F682. Maier, D. B., and Kuslis, S. T. (1988). Human uterine luminal fluid volumes and prolactin levels in normal menstrual cycles. Am. J. Obstet. Gynecol. 159, 434–439. doi:10.1016/S0002-9378(88)80102-9 Matthews, C. J., McEwan, G. T. A., Redfern, C. P. F., Thomas, E. J., and Hirst, B. H. (1998). Absorptive apical amiloride-sensitive Naþ conductance in human endometrial epithelium. J. Physiol. 513, 443–452. doi:10.1111/J.1469-7793.1998.443BB.X McLeod, B. J., Thompson, E. G., Crawford, J. L., and Shackell, G. H. (1997). Successful group housing of wild-caught brushtail possums (Trichosurus vulpecula). Anim. Welf. 6, 67–76. McNicholas, C. M., and Canessa, C. M. (1997). Diversity of channels generated by different combinations of epithelial sodium channel subunits. J. Gen. Physiol. 109, 681–692. doi:10.1085/JGP.109.6.681 Muchekehu, R. W., and Quinton, P. M. (2010). A new role for bicarbonate secretion in cervico–uterine mucus release. J. Physiol. 588, 2329–2342. doi:10.1113/JPHYSIOL.2010.187237 Naftalin, R. J., Thiagarajah, J. R., Pedley, K. C., Pocock, V. J., and Milligan, S. R. (2002). Progesterone stimulation of fluid absorption by the rat uterine gland. Reproduction 123, 633–638. doi:10.1530/REP.0.1230633
Palmer, L. G., Li, J. H. Y., Lindemann, B., and Edelman, I. S. (1982). Aldosterone control of the density of sodium channels in the toad urinary-bladder. J. Membr. Biol. 64, 91–102. doi:10.1007/BF01870771 Rochwerger, L., and Buchwald, M. (1993). Stimulation of the cystic fibrosis transmembrane regulator expression by oestrogen in vivo. Endocrinology 133(2), 921–930. Salker, M. S., Christian, M., Steel, J. H., Nautiyal, J., Lavery, S., Trew, G., Webster, Z., Al-Sabbagh, M., Puchchakayala, G., Foller, M., Landles, C., Sharkey, A. M., Quenby, S., Aplin, J. D., Regan, L., Lang, F., and Brosens, J. J. (2011). Deregulation of the serum and glucocorticoidinducible kinase SGK1 in the endometrium causes reproductive failure. Nat. Med. 17, 1509–1513. doi:10.1038/NM.2498 Salleh, N., Baines, D. L., Naftalin, R. J., and Milligan, S. R. (2005). The hormonal control of uterine luminal-fluid secretion and absorption. J. Membr. Biol. 206, 17–28. doi:10.1007/S00232-005-0770-7 Shorey, C. D., and Hughes, R. L. (1973). Cyclical changes in the uterine endometrium and peripheral plasma concentration of progesterone in the Marsupial Trichosurus vulpecula. Aust. J. Zool. 21, 1–19. doi:10.1071/ ZO9730001 Sizemore, R. J., Hurst, P. R., and McLeod, B. J. (2004). Effect of steroid hormones on tissue remodelling and progesterone receptors in the uterus of seasonally anoestrous brushtail possums (Trichosurus vulpecula). Reproduction 127, 255–264. doi:10.1530/REP.1.00091 Smith, P. R., and Benos, D. J. (1991). Epithelial Naþ channels. Annu. Rev. Physiol. 53, 509–530. doi:10.1146/ANNUREV.PH.53.030191.002453 Snyder, P. M., Olson, D. R., and Thomas, B. C. (2002). Serum and glucocorticoid-regulated kinase modulates Nedd4–2-mediated inhibition of the epithelial Naþ channel. J. Biol. Chem. 277, 5–8. doi:10.1074/ JBC.C100623200 Staruschenko, A., Adams, E., Booth, R. E., and Stockand, J. D. (2005). Epithelial Naþ channel subunit stoichiometry. Biophys. J. 88, 3966– 3975. doi:10.1529/BIOPHYSJ.104.056804 Sweezey, N., Tchepichev, S., Gagnon, S., Fertuck, K., and O’Brodovich, H. (1998). Female gender hormones regulate mRNA levels and function of the rat lung epithelial Naþ channel. Am. J. Physiol. 274, C379–C386. Taggart, D. A. (1994). A comparison of sperm and embryo transport in the female reproductive tract of marsupial and eutherian mammals. Reprod. Fertil. Dev. 6, 451–472. doi:10.1071/RD9940451 Tyndale-Biscoe, C. H. (1966) The marsupial birth canal. In ‘Comparative Biology of Reproduction in Mammals. Symposia of the Zoological Society of London. Vol. 15’. (Ed. I. W. Rowlands.) pp. 233–250. (Academic Press: London.) Van Driessche, W., and Lindemann, B. (1979). Concentration dependence of currents through single sodium-selective pores in frog skin. Nature 282, 519–520. doi:10.1038/282519A0 Vetter, A. E., and O’Grady, S. M. (1996). Mechanisms of electrolyte transport across the endometrium. I. Regulation by PGF2 alpha and cAMP. Am. J. Physiol. Cell Physiol. 270, C663–C672. Vetter, A. E., and O’Grady, S. M. (2005). Sodium and anion transport across the avian uterine (shell gland) epithelium. J. Exp. Biol. 208, 479–486. doi:10.1242/JEB.01409 Wright, J. (2011). Evaluating the use of 1080: predators, poisons and silent forests. (Parliamentary Commissioner for the Environment: Wellington, New Zealand.) Available at http://www.pce.parliament.nz/publications/ all-publications/evaluating-the-use-of-1080-predators-poisons-and-silentforests [Verified 17 June 2014]. Yang, J. Z., Ajonuma, L. C., Tsang, L. L., Lam, S. Y., Rowlands, D. K., Ho, L. S., Zhou, C. X., Chung, Y. W., and Chan, H. C. (2004). Differential expression and localization of CFTR and ENaC in mouse endometrium during pre-implantation. Cell Biol. Int. 28, 433–439. doi:10.1016/ J.CELLBI.2004.03.011
www.publish.csiro.au/journals/rfd
Reproduction, Fertility and Development, 2016, 28, 328–336 http://dx.doi.org/10.1071/RD13277
Variations in epithelial Na1 transport and epithelial sodium channel localisation in the vaginal cul-de-sac of the brushtail possum, Trichosurus vulpecula, during the oestrous cycle T.-A. Alsop A,C, B. J. McLeod B and A. G. Butt A A
Department of Physiology, Otago School of Medical Sciences, University of Otago, PO Box 56, Dunedin 9054, New Zealand. B AgResearch Invermay, Private Bag 50034 Mosgiel 9053, New Zealand. C Corresponding author. Email: [email protected]
Abstract. The fluid in the vaginal cul-de-sac of the brushtail possum, Trichosurus vulpecula, is copious at ovulation when it may be involved in sperm transport or maturation, but is rapidly reabsorbed following ovulation. We have used the Ussing short-circuit current (Isc) technique and measurements of transcript and protein expression of the epithelial Naþ channel (ENaC) to determine if variations in electrogenic Naþ transport are associated with this fluid absorption. Spontaneous Isc (,20 mA cm2 during anoestrus, 60–80 mA cm2 in cycling animals) was inhibited by serosal ouabain. Mucosal amiloride (10 mmol L1), an inhibitor of ENaC, had little effect on follicular Isc but reduced luteal Isc by ,35%. This amiloride-sensitive Isc was dependent on mucosal Naþ and the half-maximal inhibitory concentration (IC50)– amiloride (0.95 mmol L1) was consistent with ENaC-mediated Naþ absorption. Results from polymerase chain reaction with reverse transcription (RT-PCR) indicate that aENaC mRNA is expressed in anoestrous, follicular and luteal phases. However, in follicular animals aENaC immunoreactivity in epithelial cells was distributed throughout the cytoplasm, whereas immunoreactivity was restricted to the apical pole of cells from luteal animals. These data suggest that increased Naþ absorption contributes to fluid absorption during the luteal phase and is regulated by insertion of ENaC into the apical membrane of cul-de-sac epithelial cells. Received 30 August 2013, accepted 27 May 2014, published online 24 July 2014
Introduction The brushtail possum has long been regarded as a major pest species in New Zealand and possum control is an integral part of both conservation and bovine tuberculosis (TB) control strategies (Coleman et al. 2006; Wright 2011). However, the toxins used in possum-control operations are becoming less acceptable to the public (Fitzgerald et al. 2000; Wright 2011). Identifying physiological differences between possums and eutherian mammals (farm and companion animals) and between possums and avian species (native New Zealand birds), which could be manipulated to produce a possum-specific control, is an integral part of studies to identify alternatives to traditional toxin controls. In particular, differences in reproductive physiology are of interest (Fitzgerald et al. 2000). Here we have investigated the epithelial transport properties of the vaginal cul-de-sac, a structure unique to marsupials. The marsupial vaginal complex consists of a single urogenital sinus leading to two lateral canals, which empty into a single vaginal cul-de-sac from which two uteri protrude (TyndaleBiscoe 1966). The function of the cul-de-sac is unknown. However, because extensive tissue remodelling of cul-de-sac Journal compilation Ó CSIRO 2016
epithelial cells and cyclical changes in cul-de-sac fluid volume are maximal around ovulation when mating occurs, it is thought that this structure plays a major role in the reproductive success of possums. Indeed it has been suggested that the cul-de-sac has a function relating to sperm transport, maturation or selection (Taggart 1994). Viscous, mucus-rich luminal fluid initially appears in the cul-de-sac of the possum during the follicular stage of the oestrous cycle and its volume progressively increases, reaching a maximum volume at oestrus (Hughes and Rodger 1971; Legge et al. 1996). Associated with the production of the fluid is a dramatic remodelling of the epithelial cells lining the cul-de-sac (Crawford et al. 1999). During the luteal phase, which follows ovulation, the fluid essentially disappears (Hughes and Rodger 1971) and the epithelial cells regress (Crawford et al. 1999). Similar changes in the volume of avian shell-gland fluid (Gautron et al. 1997; Vetter and O’Grady 2005) and eutherian uterine (Cassle´n 1986; Maier and Kuslis 1988) and cervical fluid (Kopito et al. 1973) occur during the female reproductive cycle. These changes in luminal fluid volume are a consequence of cyclical changes in ion transport properties of the epithelium www.publish.csiro.au/journals/rfd
Epithelial Naþ transport in the possum cul-de-sac
lining these segments of the female tract in both eutherian mammals (Levin and Edwards 1968; Chan et al. 2002; Salleh et al. 2005) and birds (Vetter and O’Grady 2005). In particular, the stimulation of Naþ absorption by progesterone contributes to the decrease in fluid volume during the luteal phase of the oestrous cycle in eutherian mammals (Chan et al. 2002; Naftalin et al. 2002; Yang et al. 2004; Salleh et al. 2005), and suppression of Naþ absorption by oestrogen is associated with the increase in fluid volume around the time of ovulation (Chan et al. 2001). Epithelial Naþ channel (ENaC)-mediated Naþ absorption in eutherians (Smith and Benos 1991; Garty and Palmer 1997) and possums (Butt et al. 2002b) is characterised by apical Naþ dependence (half-maximal effective concentration (EC50) apical Naþ of 15–30 mmol L1 eutherian tissue; Smith and Benos 1991; Garty and Palmer 1997) and sensitivity to the ENaC inhibitor amiloride (IC50 amiloride 0.1–1 mmol L1; Smith and Benos 1991; Garty and Palmer 1997). Similar concentrationdependent responses to amiloride have been measured in native uterine tissue (Vetter and Ogrady 1996) as well as cultured human endometrial cells (Matthews et al. 1998) and the avian shell gland (Vetter and O’Grady 2005). Thus, it is thought that epithelial Naþ absorption in the eutherian uterus and shell gland is similar to the ENaC-mediated Naþ absorption observed in tight absorptive epithelia, such as the renal tubule (Fro¨mter 1988) and distal colon of eutherian mammals (Kunzelmann and Mall 2002). In this process, luminal Naþ diffuses down its electrochemical gradient into the epithelial cells via ENaC and is transported out of the cells across the basolateral membrane by the basolateral Naþ/Kþ–ATPase. Cl and water follow passively with the net result being the absorption of fluid and electrolytes from the lumen (Kunzelmann and Mall 2002). The ENaC channel, which is the rate-limiting step in ENaC-mediated Naþ absorption, typically consists of three separate protein subunits, aENaC, bENaC and gENaC (Canessa et al. 1994), which are thought to be assembled as an a–b–g heterotrimer (Staruschenko et al. 2005; Jasti et al. 2007). The activity of ENaC in the apical membrane is modulated through both genomic mechanisms (e.g. changes in the rate of transcription of ENaC subunits; Asher et al. 1996; Boyd and NarayFejes-Toth 2005) and non-genomic mechanisms (e.g. changes in the rate of channel trafficking to and from the apical membrane; Palmer et al. 1982; Loffing et al. 2001). In eutherian reproductive tissue, it has been suggested that progesterone alters both the rate of ENaC trafficking to and from the apical membrane (Yang et al. 2004; Salleh et al. 2005) and the rates of transcription of the a and g ENaC subunits (Chan et al. 2002; Yang et al. 2004). The patterns of ovarian hormone secretion (Shorey and Hughes 1973; Curlewis et al. 1985) and progesterone receptor expression (Sizemore et al. 2004) during the oestrous cycle in possums are similar to those in eutherians. Therefore, it is possible that ovarian hormones, particularly progesterone, regulate cul-de-sac luminal fluid volume and composition by regulating ENaC-mediated Naþ absorption in a similar way to that seen in the eutherian reproductive tract. The objective of this study was to determine if there are cyclical changes in amiloride-sensitive Naþ absorption and associated changes in the localisation of aENaC in the possum vaginal cul-de-sac.
Reproduction, Fertility and Development
329
Material and methods Animals, tissue collection and tissue preparation This study used wild-caught, reproductively mature ($2.0 kg liveweight) female, Australian common brushtail possums (Trichosurus vulpecula). Animals were group-housed at the AgResearch Invermay possum facility as previously described (McLeod et al. 1997). All experimental procedures were approved by the University of Otago Animal Ethics Committee or the AgResearch Animal Ethics Committee, in accordance with the Animal Welfare Act of New Zealand, 1999. In experiments that compared the epithelial properties of the culde-sac from animals at different stages of the reproductive cycle, animals were randomly selected and their reproductive status determined on the basis of ovarian morphology (Crawford et al. 1997), assessed post mortem. Anoestrous animals were identified by the presence of small (#1.5 mm diameter) antral follicles on their ovaries. Animals with larger healthy follicles were classified as being in the follicular phase, and as being pre-ovulatory if the largest follicle was $5 mm in diameter. Imminent ovulation was identified based on a pre-ovulatory stigmata being present on a large ($5 mm diameter) dominant follicle. Animals were identified as being in the luteal phase by the presence of a large ($5 mm diameter) corpus luteum (CL) with mid luteal and late luteal phases differentiated by the colouration and degree of vascularisation of the CL. For experiments to characterise the amiloride and sodium dose response of cul-de-sac tissue from luteal phase animals, ovulation was synchronised by removal of pouch young and animals were killed between 19 and 21 days later in the predicted mid-luteal phase of the oestrous cycle. Possums were killed by intra-cardiac injection of Euthal (Delta Veterinary Laboratories, Sydney, NSW, Australia) while under halothane-induced anaesthesia. For Ussing chamber experiments the cul-de-sac tissues were transported to the laboratory in ice-cold NaCl–HCO 3 Ringer (the composition of all Ringer solutions used in these experiments is presented in Table 1). For RNA extraction pieces of Table 1. Composition of Ringer solutions used in epithelial transport studies Concentration (mmol L1)
Salt NaCl–HCO 3 NaCl NaGluconate nMDG-Cl KCl NaHCO3 Hepes/Tris CaCl2 MgSO4 Na2HPO4 NaH2PO4 K2HPO4 KH2PO4 Glucose Gas pH
110 0 0 5 25 0 1 0.5 1.8 0.2 0 0 10 95%O2 : 5%CO2 7.4
NaCl–HEPES
nMDG–HEPES
110 25 0 5 0 10 1 0.5 1.8 0.2 0 0 10 100%O2 7.4
0 0 143.8 1.2 0 10 1 0.5 0 0 1.8 0.2 10 100%O2 7.4
330
Reproduction, Fertility and Development
cul-de-sac tissue, ,2 cm2, were snap-frozen in liquid nitrogen immediately after dissection and stored at 808C. For immunohistochemistry cul-de-sac tissues were flushed with NaCl– HCO 3 Ringer and fixed in 4% (w/v) paraformaldehyde (Sigma Aldrich Corp, St Louis, MO, USA) in phosphate-buffered saline (PBS; 137 mmol L1 NaCl, 10 mmol L1 phosphate, 2.7 mmol L1 KCl, pH 7.4) for 24 h at 48C, followed by paraffin embedding. Measurement of epithelial transport Short-circuit current (Isc) was measured as previously described for possum gastrointestinal tract epithelia (Butt et al. 2002a, 2002b). Small sections of cul-de-sac epithelium were mounted, with the underlying muscular and connective tissue intact, between the two halves of an Ussing chamber (aperture 0.5 cm2) and superfused with Ringer solution. Oxygenation and stirring of the solutions was achieved via gas lift with 95% O2 : 5% CO2 when using bicarbonate-buffered Ringer and 100% O2 when using HEPES-buffered Ringer. The tissue and solutions were maintained at 378C by water jackets. Ouabain and amiloride were obtained from Sigma. Stocks of amiloride were prepared in appropriate Ringer and added in small aliquots to the apical side of the tissue to give the specified final concentration. Ouabain was added as aliquots of dry powder directly to the serosal chamber to give a final concentration of 1 mmol L1. Statistics for epithelial transport Results for electrophysiological experiments are presented as mean standard error of the mean (s.e.m.) with n ¼ the number of animals used, or as standard traces of tissues from individual animals. Differences between mean values were tested with an unpaired Student’s t-test or a one-way ANOVA. Where concentration response experiments were performed, data was fitted with the Hill equation and the half-maximal inhibitory concentration (IC50) or half-maximal effective concentration (EC50) and the Hill coefficient were calculated. All analyses were carried out with GraphPad Prism (GraphPad Inc., San Diego, CA, USA). For all statistical analyses P , 0.05 was considered to be significant. RNA isolation and sequencing of possum aENaC Frozen cul-de-sac samples were homogenised (Omni TH tissue homogeniser; Omni International, NW Kennesaw, GA, USA) in 1 mL of TRIzol reagent (Invitrogen Ltd, Auckland, New Zealand) per 50–100 mg tissue at room temperature and total RNA extracted according to the manufacturer’s instructions. Contaminating genomic DNA was removed with the DNA-Free reagent kit (Ambion, Inc., Austin, TX, USA) and purified RNA quantified with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Reverse transcription, to produce cDNA, was performed on 5 mg total RNA using the Superscript III RT and Oligo-DT primer Kit (Invitrogen) according to the manufacturer’s instructions. Oligonucleotide primers for amplification of the aENaC subunit were designed from a partial possum-specific sequence of aENaC (DQ645472). A possum-specific primer for the housekeeping gene b-actin (AF076190; Eckery et al. 2002) was used
T.-A. Alsop et al.
as a positive control for RNA quality. Primer sequences were as follows: aENaC, forward 50 –CAGGAGAACAACCCTCAGG–30 , reverse 50 –GAATGCTGGTTCATCTTGCC–30 ; possum b actin, forward 50 –TGAGCTCTTCCACCCAGC–30 , reverse 50 –GGATCTTCATGAGGTAGTC–30 . PCR reactions were performed in a 25 mL volume of 1 PCR buffer (Invitrogen) also containing 0.2 mmol L1 deoxynucleotide triphosphate (dNTPs), 0.4 mmol L1 forward and reverse primers, 2.5 U Taq DNA polymerase (Invitrogen), 1.5 mmol L1 MgCl2 and 0.5 mL of cDNA. PCR reactions were run using a PCR thermal cycler (Eppendorf; Mastercycler Gradient, Hamburg, Germany), which had been pre-warmed to 948C. Conditions for PCR were: denaturation at 948C for 45 s, annealing at 558C for 60 s, extension at 728C for 60 s for 30 cycles with a final extension at 728C for 10 min. PCR products were visualised on a 1% agarose gel. Amplification of target cDNA was confirmed by sequencing of PCR products using both the forward and reverse primers (Allan Wilson Centre Genome Sequencing Service, Massey University, Auckland, New Zealand). Immunolocalisation of a ENaC Sections (5 mm) were placed on slides coated with 2% 3-aminopropyliethoxysilane (Sigma), air-dried overnight at 458C and stored at 48C. After dewaxing, antigen retrieval was performed by heating slides in 1 mmol L1 ethylendiamine tetraacetic acid (EDTA) at pH 8.0 to above 958C for 8 min. Sections were blocked with 5% rabbit serum in PBS for 30 min and incubated with chicken anti-aENaC (diluted 1 : 35 in PBS with 5% rabbit serum; gift from S. Kumar, University of Adelaide, SA, Australia) for 2 h. The sections were then washed with PBS and incubated with fluorescein isothiocyanate (FITC)conjugated rabbit anti-chicken IgY (Sigma) for 2 h, washed in PBS and mounted in Vectashield HardSet mounting medium with 40 ,6-diamidino-2-phenylindole (DAPI) nucleic acid stain (Vector Laboratories, Burlingame, CA, USA). Negative controls were performed as for ENaC-specific immunostaining, but with affinity-purified non-immune chicken IgY (Sigma; 1 : 200 in PBS with 5% rabbit serum) used in place of the ENaC-specific primary antibody. Sections were examined and photographed using a confocal scanning laser system (Zeiss 510 LSM; Carl Zeiss, Jena, Germany) with care taken to photograph treatment and control tissue pairs using the same optical settings. Tissue samples collected from animals in each of the follicular, luteal and anoestrous stages were examined. Results Electrogenic ion transport in the cul-de-sac epithelium Spontaneous Isc and transepithelial resistance (Rt) were compared in cul-de-sac tissues collected from anoestrous- (n ¼ 9), follicular- (n ¼ 7) and luteal- (n ¼ 11) stage animals and bathed in NaCl–HCO 3 Ringer. Cycling animals had a spontaneous Isc of 58.1 18.9 mA cm2 and 67.0 8.8 mA cm2 in the follicular and luteal stages, respectively (Fig. 1a–d). Anoestrous animals had a significantly (P , 0.01) lower Isc of only 17.3 3.1 mA cm2. Serosal ouabain (1 mmol L1) inhibited ,80% of the
Epithelial Naþ transport in the possum cul-de-sac
(a)
Reproduction, Fertility and Development
(d)
20
∗∗
100 ∗∗∗
Control Ouabain
Isc (μA.cm⫺2)
Ouabain 10 Control
Isc (μA.cm⫺2)
75 15
50 25
5
0 10 min
⫺25
0
(b)
331
(e)
100
Anoestrus
Follicular
Luteal
Anoestrus
Follicular
Luteal
200
Ouabain 150
Control 50
Rt (Ω.cm⫺2)
Isc (μA.cm⫺2)
75
100
50
25
0
10 min
0
(c) 100
Ouabain
Isc (μA.cm⫺2)
75
Control 50
25
0
10 min
Fig. 1. A comparison of spontaneous short-circuit current (Isc) and response to ouabain (1 mmol L1 serosal) in cul-de-sac tissue from animals in the follicular, luteal and anoestrous stages of the ovulatory cycle. Representative results from cul-de-sac tissue collected from animals in (a) anoestrous, (b) follicular and (c) luteal stage of the oestrous cycle and bathed in NaCl–HCO 3 Ringer. (d) Mean ( s.e.m.) spontaneous Isc and Isc after ouabain (1 mmol L1 serosal) and (e) transepithelial resistance (Rt) from cul-de-sac tissue collected from animals in the anoestrous (n ¼ 9), follicular (n ¼ 7) and luteal (n ¼ 11) stages. Significant difference (**P , 0.01; ***P , 0.001) from anoestrous values, one-way ANOVA with Dunnett’s post hoc test.
spontaneous Isc in all three stages (Fig. 1), indicating that the spontaneous Isc was due to active electrogenic ion transport. There was no significant difference in Rt (,150 Ocm2) in either stage of the oestrous cycle or in anoestrous tissues (Fig. 1e). In the eutherian female reproductive tract there is an increase in ENaC-mediated electrogenic Naþ absorption in the luteal phase, which plays a major role in regulating luminal fluid volume (Naftalin et al. 2002; Salleh et al. 2005). Mucosal amiloride (10 mmol L1), a selective inhibitor of ENaC (Garty and Palmer 1997), significantly (P , 0.001) reduced the spontaneous Isc in cul-de-sac tissue from luteal-phase animals from 82.4 11.3 mA cm2 to 51.9 6.9 mA cm2 (n ¼ 11), but had little effect on the spontaneous Isc of tissue from follicular-phase animals (DIsc 5.5 2.2 mA cm2, n ¼ 7, Fig. 2).
The concentration dependence of the inhibition of Isc by amiloride in cul-de-sac tissue from luteal-phase animals (IC50 ¼ 0.95, Hill Coefficient ¼ 0.901; Fig. 3) is consistent with the absorption of Naþ via ENaC in eutherian tissues (Garty and Palmer 1997) and possum colon (Butt et al. 2002b). However, the highest concentration of amiloride (100 mmol L1) added to the cul-de-sac only inhibited ,50% of the Isc, indicating that there is a significant amiloride-insensitive component to electrogenic ion transport in the possum cul-de-sac. To confirm that the amiloride-sensitive Isc seen in cul-de-sac tissue from luteal-phase animals was dependent upon Naþ, the effect of replacing mucosal Naþ with the impermeant cation n-methyl-D-glucamine (nMDG) on the total and amiloridesensitive component of the Isc was investigated. In this series
Isc (μA.cm⫺2)
(a)
Reproduction, Fertility and Development
T.-A. Alsop et al.
(a) 150
150 Amiloride
Ouabain
Ouabain
Isc (μA.cm⫺2)
332
100
50 Control
100
50 0.001
0.01
0.1
1
10 100
5 min 0
(b)
5 min
0
(b) 120
Amiloride Ouabain
150
100 Control
80 60 40
50
20 0
0.001 0.01
0.1
1
10
100
1000
[Mucosal amiloride] (μmol L⫺1) ∗∗
⫺10 Amiloride
⫺20
Control ⫺30 ⫺40
Amiloride Vehicle
0
5 min
(c) 10 ΔIsc (μA.cm⫺2)
% initial Isc
Isc (μA.cm⫺2)
100
Follicular
Fig. 3. Cumulative inhibition of spontaneous short-circuit current (Isc) of cul-de-sac tissue from animals in the luteal phase bathed in NaCl–HCO 3 Ringer in response to increasing concentrations of mucosal amiloride (0.001–100 mmol L1). (a) Representative trace (Isc) and (b) cumulative concentration response curve (% initial Isc) comparing the effect of amiloride (J) with equivalent volumes of vehicle added to the control tissues (W); n ¼ 3 animals. A modified Hill function was fitted to the dataset; IC50 amiloride was 0.95 mmol L1 and the Hill coefficient 0.901.
Luteal
Fig. 2. Mucosal amiloride inhibits the spontaneous short-circuit current (Isc) in the cul-de-sac. The effect of 10 mmol L1 mucosal amiloride on Isc of cul-de-sac tissue from animals in (a) the follicular stage of the reproductive cycle (n ¼ 7) and (b) the luteal stage (n ¼ 11), both bathed in NaCl–HCO 3 Ringer. (c) Mean ( s.e.m.) change in the spontaneous short-circuit current (DIsc) in cul-de-sac tissue in response to 10 mmol L1 mucosal amiloride. Significant difference (*P , 0.05; **P , 0.01) from control value, unpaired Student’s t-test.
of experiments, it was necessary to replace HCO 3 with HEPES and Cl (nMDG–HEPES Ringer, Table 1) and gas the tissues with 100% O2. However, the spontaneous Isc of cul-de-sac tissue collected from animals in the luteal phase and bathed in NaCl– HEPES Ringer (67.0 8.8 mA cm2, n ¼ 7; Fig. 4) was similar to that seen in NaCl–HCO3 Ringer (Fig. 1), indicating that differences seen in the amiloride-sensitive Isc on substitution of þ Naþ were not due to the removal of HCO 3 . Substitution of Na in the mucosal solution with nMDG reduced the spontaneous Isc in tissues from luteal-phase animals from 78.4 14.3 mA cm2 to 23.9 6.7 mA cm2 (Fig. 4b) and essentially eliminated the amiloride-sensitive Isc (DIsc amiloride ¼ 36.5 9.9 mA cm2 in NaCl–HEPES Ringer solution and 0.1 0.3 mA cm2 in nMDG–HEPES Ringer solution; Fig. 4c). Cumulative, isosmotic additions of Naþ to an initially þ Na -free mucosal bathing solution induced an increase in Isc
in cul-de-sac tissue (Fig. 4a). However, consistent with the presence of an amiloride-insensitive Isc in the cul-de-sac, pretreatment of tissue with mucosal amiloride (100 mmol L1) did not completely eliminate the induction of Isc by Naþ (Fig. 4a). Consequently, following the addition of 50 and 100 mmol L1 mucosal Naþ to the amiloride-pre-treated tissues, the Isc increased by 6.5 2.3 mA cm2 and 12.0 2.2 mA cm2 (n ¼ 7), respectively. This effect was not due to a reversal of inhibition of amiloride, as the NaCl–HEPES Ringer solution used for the re-addition of Naþ also contained 100 mmol L1 amiloride. The Naþ dependence of the amiloride-sensitive component of the spontaneous Isc had an EC50 of 13.25 mmol L1 apical Naþ (Fig. 4b). The amiloride-insensitive, Naþ-dependent current was sensitive to ouabain, suggesting that a second, Naþ-dependent, electrogenic transport mechanism is present in the cul-de-sac. Localisation of aENaC in the cul-de-sac epithelium Functional ENaC channels usually require the assembly of a heterotrimer consisting of the a, b and g ENaC subunits in the apical cell membrane (Staruschenko et al. 2005). Consequently, Naþ transport can be regulated by either altering the localisation (Loffing et al. 2001; Snyder et al. 2002; Bhalla et al. 2006) or transcription (Asher et al. 1996) of any one of the three ENaC subunits, although in eutherian reproductive tissues
Epithelial Naþ transport in the possum cul-de-sac
(a)
Reproduction, Fertility and Development
β-Actin
Amiloride
333
α-ENaC
200
Isc (μA.cm⫺2)
Na⫹ mmol L⫺1 150
100
680 bp 446 bp
5 1.0 0.5
50
Ouabain
50 10
% maximum Iscamiloride
120 100
60 40 20 0
100
1
10
[Na⫹] (mmol L⫺1)
∗∗
100
1000
Before amiloride After amiloride
80
Isc (μA.cm⫺2)
L
A DC -ve F
FRNA L
LRNA A ARNA
80
⫺20
(c)
F
Fig. 5. Representative RT-PCR of aENaC (446 bp) and b-actin (loading control, 680 bp) from cDNA made from distal colon control tissue (DC) and cul-de-sac tissue collected from animals in either the follicular (F), luteal (L) or anoestrous (A) phase of the oestrous cycle. Negative controls were milli-Q water (–ve), follicular RNA (FRNA), luteal RNA (LRNA) and anoestrous RNA (ARNA). Results representative of reactions from three animals from each stage of the oestrous cycle.
10 min
0 Amiloride
(b)
DC -ve
100
60 40 20 0 Control
Mucosal Na⫹free
Fig. 4. Apical Naþ dependence of the Isc of cul-de-sac tissue. (a) A representative experiment showing the cumulative increase in Isc in response to the isosmotic addition of increasing concentrations of Naþ to the mucosal solution of cul-de-sac tissues with or without 100 mmol L1 amiloride in the mucosal bathing solution. (b) Shows mean s.e.m. increase in Isc in response to cumulative isosmotic additions of increasing concentrations of Naþ expressed as a percentage of the maximum amiloride-sensitive Isc (% maximum Iamiloride ); n ¼ 7 animals. A modified Hill function was fitted to sc the dataset; EC50 Naþ ¼ 13.25 mmol L1, the Hill coefficient ¼ –1.23. (c) The effect of 10 mmol L1 mucosal amiloride on the Isc of cul-de-sac tissues from animals in the luteal phase bathed in either NaCl–HEPES Ringer (containing Naþ) or nMDG–HEPES (Naþ free) Ringer solution (all values mean s.e.m.). Significant difference (**P , 0.01) from the Isc before amiloride, paired Student’s t-test, (n ¼ 7).
progesterone modulates Naþ transport primarily through regulation of the a or gENaC subunits (Sweezey et al. 1998; Chan et al. 2002; Salleh et al. 2005; Salker et al. 2011). Polymerase chain reaction with reverse transcription (RT-PCR) on cDNA from cul-de-sac tissue of animals in the luteal, follicular and anoestrous phases (Fig. 5) using possumspecific primers for aENaC, suggested that transcript for this subunit was present in cul-de-sac tissue at all three reproductive
stages. However, immunofluorescence for aENaC showed that variations in the localisation of aENaC within the cul-de-sac epithelium occurred during the oestrous cycle. Sections from cul-de-sac tissues collected from animals in the follicular (Fig. 6a) and luteal (Fig. 6e) stage, stained with haematoxylin and eosin (H&E), demonstrate the difference in epithelial cell size and structure between the two stages of the oestrous cycle. In tissue from the follicular phase (Fig. 6b, c), aENaC immunoreactivity (green) was diffusely spread throughout the cytoplasm, whereas in tissues from the luteal phase aENaC immunoreactivity was localised in the region of the apical membrane (Fig. 6f, g). Control treatment with non-immune chicken IgY demonstrated that some of the cytoplasmic staining in the tissues from the follicular stage was non-specific (Fig. 6d), which may reflect non-specific binding of antibodies to the large number of mucus vesicles seen in the cytoplasm of cul-de-sac epithelial cells in follicular-phase animals (Crawford et al. 1999). Discussion The epithelial structure (Crawford et al. 1999) and luminal-fluid volume (Hughes and Rodger 1971) of the possum vaginal cul-de-sac vary extensively with the ovulatory cycle, as they do in the eutherian female uterus and cervix (Kopito et al. 1973; Cassle´n 1986; Maier and Kuslis 1988). Cyclical changes in the luminal fluid in the eutherian female reproductive tract are known to involve cyclical changes in epithelial Naþ absorption (Naftalin et al. 2002; Yang et al. 2004; Salleh et al. 2005), which are linked to cyclical changes in both the expression (Chan et al. 2002; Yang et al. 2004) and degree of apical localisation (Yang et al. 2004; Salleh et al. 2005) of the a and g ENaC subunits. This study has identified for the first time that there are cyclical changes in ENaC-mediated Naþ absorption and related changes in the localisation of aENaC in the possum cul-de-sac that coincide with cyclical changes in luminal-fluid volume and epithelial structure. Cyclical changes in ion transport occur in the vaginal cul-de-sac In the cul-de-sac of animals in the anoestrous phase of the oestrous cycle there was very little active ion transport compared with that in cycling animals. There are no data on
334
Reproduction, Fertility and Development
T.-A. Alsop et al.
(a)
(b)
(c)
(d )
(e)
(f )
(g)
(h)
Fig. 6. Variation in the localisation of aENaC within the epithelial cells of cul-de-sac tissue collected from animals in the follicular and luteal phases of the oestrous cycle. (a, e) Hematoxylin and eosin (H&E)-stained sections for cul-de-sac tissue from follicular- and luteal-phase animals, respectively, show the larger epithelial cell volume in the follicular phase compared with the luteal phase and serve as a comparison for the immune-stained sections. Immunolocalisation of aENaC (green) in cul-de-sac tissue from (b, c) follicular- and ( f, g) luteal-phase animals, compared with negative controls (d, follicular and g, luteal) probed with non-immune IgY. Nucleic acid stained with DAPI (blue). Representative of measurements from three animals at each stage.
ion-transport patterns in the reproductive tracts of eutherian mammals during seasonal anoestrus that would allow comparisons with the possum cul-de-sac. Therefore, the anoestrous data was compared with published data from tissues from ovariectomised eutherian animals, which would be devoid of steroid reproductive hormones. Similar to the cul-de-sac from possums during anoestrus, the uteri of ovariectomised rats have reduced fluid volume compared with intact animals or ovariectomised animals treated with exogenous ovarian hormones (Salleh et al. 2005). The data presented in this study indicate that the cul-desac is in a quiescent state during anoestrus, which is consistent with previous histological data that showed the epithelial cells lining the cul-de-sac of anoestrous animals are inactive (Crawford et al. 1999). Despite the fact that cul-de-sac tissue from animals in the both follicular and luteal phases has a similar Isc, cul-de-sac tissue from follicular-phase animals had essentially no amiloride-sensitive Isc (5.6 2.5% of total Isc), whereas 36.1 3.2% of the total Isc in cul-de-sac tissue from animals in the luteal phase of the oestrous cycle was amiloride sensitive. This finding indicates that electrogenic, ENaC-mediated, Naþ absorption is greatest in the luteal stage, when there is known to be a decrease in luminal-fluid volume (Hughes and Rodger 1971), and electrogenic Naþ absorption is minimal in cul-de-sac tissue from follicular-stage animals, coinciding with the highest volume of luminal fluid (Hughes and Rodger 1971). The presence of a large amiloride-insensitive Isc in cul-de-sac tissue from follicularstage animals could be indicative of a secretory process involved in the formation of cul-de-sac luminal fluid. In summary, these concentration-response experiments indicate that the amiloridesensitive component of the Isc from luteal-phase animals is consistent with Naþ absorption mediated by ENaC.
The IC50 for amiloride (0.95 mmol L1) in cul-de-sac tissue from luteal-phase animals is comparable with typical values for ENaC-mediated Naþ absorption in eutherian mammals, which range from 0.1 to 1 mmol L1 (Smith and Benos 1991; Garty and Palmer 1997) and also the possum colon (Butt et al. 2002b). The EC50 for mucosal Naþ in this tissue was lower than, but not dissimilar to, typical eutherians values for ENaC (Smith and Benos 1991; Garty and Palmer 1997). ENaC activity can be inhibited by rapid increases in external Naþ concentrations, a process known as Naþ self-inhibition (Van Driessche and Lindemann 1979; Chraı¨bi and Horisberger 2002). It is possible that Naþ self-inhibition occurred in cul-de-sac tissue when mucosal Naþ was increased to 50 and 100 mmol L1 (Chraı¨bi and Horisberger 2002), and thus may have decreased the EC50 Naþ values obtained. The concentration-response experiments identified an apical Naþ-dependent, amiloride-insensitive component to the Isc in the cul-de-sac of luteal-phase animals, indicated by the fact that in the presence of 100 mmol L1 mucosal amiloride the isosmotic addition of 50 and 100 mmol L1 mucosal Naþ increased Isc by 6.5 2.3 mA cm2 and 12.0 2.2 mA cm2, respectively. This may indicate the presence of a small population of ENaC channels with an atypical stoichiometry, as many of these have reduced sensitivity to amiloride (McNicholas and Canessa 1997), or it could be an unrelated Naþ-dependent transport process. Cyclical changes in aENaC localisation There were clear differences in the location of the aENaC during the oestrous cycle. In cul-de-sac tissue from animals in the luteal phase, which has the highest level of amiloride-sensitive Isc and the lowest luminal-fluid volume (Hughes and Rodger 1971),
Epithelial Naþ transport in the possum cul-de-sac
immunoreactivity for aENaC was concentrated at the apical pole of epithelial cells and very little reactivity was seen in the cytoplasm. In contrast, tissue from follicular-stage animals had aENaC immunoreactivity throughout the cytoplasm. These data suggest the difference in the Isc of the cul-de-sac from animals in the luteal and follicular stages are, in part, regulated by altering the amount of ENaC present at the apical membrane by changing the rate of ENaC trafficking to or from the cell surface, in a similar way to that observed in eutherian mammals (Palmer et al. 1982; Loffing et al. 2001; Snyder et al. 2002). However, the possibility that changes in the activity, rather than the amount or localisation of ENaC, contribute to cyclical changes in amiloride-sensitive Isc in the cul-de-sac cannot be excluded. It is also possible that the activity of other transporters may modulate ENaC transport; for example, in the eutherian tract there is evidence that ENaC activity decreases in the follicular phase due to interactions with the cystic fibrosis transmembrane conductance regulator (CFTR), the activity of which is thought to be increased by oestrogen (Rochwerger and Buchwald 1993; Chan et al. 2002). Potential manipulation of epithelial Na1 absorption in the cul-de-sac as a contraceptive or sterilant Possum control is an integral part of both conservation and TB-control strategies in New Zealand (Coleman et al. 2006; Wright 2011). However, the toxins used in possum control operations, in particular sodium monofluoroacetate (1080), are becoming less acceptable to the public (Fitzgerald et al. 2000; Wright 2011). For this reason, much research in recent years has focused on the development of alternatives to these toxins. Of all actual and hypothetical alternatives to toxins, contraceptives and sterilants are viewed most favourably by the public (Fitzgerald et al. 2000). Diseases that alter the epithelial iontransport mechanisms involved in driving fluid secretion or modulating luminal-fluid composition in the eutherian female reproductive tract can cause infertility. For example, the infertility seen in women with cystic fibrosis is related to the absence of HCO 3 secretion via the anion channel CFTR (Chan et al. 2009; Muchekehu and Quinton 2010). Data presented in this paper suggest that aENaC subunits are present in the cytoplasm of cul-de-sac epithelial cells in the follicular phase and are inserted into the apical membrane in the luteal phase under the influence of progesterone, thus contributing to the regulation of luminal-fluid reabsorption after ovulation. This implies that stimulation of the insertion of ENaC channels into the apical membrane during the follicular phase could result in early absorption of the luminal fluid and a reduction in reproductive success. However, further research is required to determine how ENaC trafficking is regulated in the possum cul-de-sac and, in particular, whether there are any significant differences from eutherians that could be exploited. Acknowledgements We thank Euan Thompson for the collection and maintenance of the possums and assistance with collection of cul-de-sac tissues. This work was supported by grants from the Foundation for Research Science and Technology, the Animal Health Board NZ Inc. and the National Research
Reproduction, Fertility and Development
335
Centre for Possum Biocontrol. Toni-Ann Alsop was supported by The Graduate Research Committee of the University of Otago through the provision of a University of Otago Postgraduate Publishing Bursary and by the Fanny Evans Postgraduate Scholarship for Woman.
References Asher, C., Wald, H., Rossier, B. C., and Garty, H. (1996). Aldosteroneinduced increase in the abundance of Naþ channel subunits. Am. J. Physiol. Cell Physiol. 271, C605–C611. Bhalla, V., Soundararajan, R., Pao, A. C., Li, H. Y., and Pearce, D. (2006). Disinhibitory pathways for control of sodium transport: regulation of ENaC by SGK1 and GILZ. Am. J. Physiol. Renal Physiol. 291, F714–F721. doi:10.1152/AJPRENAL.00061.2006 Boyd, C., and Naray-Fejes-Toth, A. (2005). Gene regulation of ENaC subunits by serum- and glucocorticoid-inducible kinase-1. Am. J. Physiol. Renal Physiol. 288, F505–F512. doi:10.1152/AJPRENAL.00242.2004 Butt, A. G., Mathieson, S. E., and McLeod, B. J. (2002a). Aldosterone does not regulate amiloride-sensitive Naþ transport in the colon of the Australian common brushtail possum, Trichosurus vulpecula. J. Comp. Physiol. B 172, 519–527. doi:10.1007/S00360-002-0278-8 Butt, A. G., Mathieson, S. E., and McLeod, B. J. (2002b). Electrogenic ion transport in the intestine of the Australian common brushtail possum, Trichosurus vulpecula: indications of novel transport patterns in a marsupial. J. Comp. Physiol. B 172, 495–502. doi:10.1007/S00360002-0275-Y Canessa, C. M., Schild, L., Buell, G., Thorens, B., Gautschi, I., Horisberger, J. D., and Rossier, B. C. (1994). Amiloride-sensitive epithelial Naþ channel is made of 3 homologous subunits. Nature 367, 463–467. doi:10.1038/367463A0 Cassle´n, B. (1986). Uterine fluid volume. Cyclical variations and possible extrauterine contributions. J. Reprod. Med. 31, 506–510. Chan, L. N., Wang, X. F., Tsang, L. L., So, S. C., Chung, Y. W., Liu, C. Q., and Chan, H. C. (2001). Inhibition of amiloride-sensitive Naþ absorption by activation of CFTR in mouse endometrial epithelium. Pflugers Arch. 443, S132–S136. doi:10.1007/S004240100660 Chan, L. N., Tsang, L. L., Rowlands, D. K., Rochelle, L. G., Boucher, R. C., Liu, C. Q., and Chan, H. C. (2002). Distribution and regulation of ENaC subunit and CFTR mRNA expression in murine female reproductive tract. J. Membr. Biol. 185, 165–176. doi:10.1007/S00232-001-0117-Y Chan, H. C., Ruan, Y. C., He, Q., Chen, M. H., Chen, H., Xu, W. M., Chen, W. Y., Xie, C., Zhang, X. H., and Zhou, Z. (2009). The cystic fibrosis transmembrane conductance regulator in reproductive health and disease. J. Physiol. 587, 2187–2195. doi:10.1113/JPHYSIOL.2008.164970 Chraı¨bi, A., and Horisberger, J.-D. (2002). Na self-inhibition of human epithelial Na channel: temperature dependence and effect of extracellular proteases. J. Gen. Physiol. 120, 133–145. Coleman, J. D., Coleman, M. C., and Warburton, B. (2006). Trends in the incidence of tuberculosis in possums and livestock, associated with differing control intensities applied to possum populations. N. Z. Vet. J. 54, 52–60. doi:10.1080/00480169.2006.36612 Crawford, J. L., Shackell, G. H., Thompson, E. G., McLeod, B. J., and Hurst, P. R. (1997). Preovulatory follicle development and ovulation in the brushtail possum (Trichosurus vulpecula) monitored by repeated laparoscopy. J. Reprod. Fertil. 110, 361–370. doi:10.1530/JRF.0.1100361 Crawford, J. L., McLeod, B. J., and Hurst, P. R. (1999). Cyclical changes in epithelial cells of the vaginal cul-de-sac of brushtail possums (Trichosurus vulpecula). Anat. Rec. 254, 307–321. doi:10.1002/(SICI)10970185(19990301)254:3,307::AID-AR1.3.0.CO;2-U Curlewis, J. D., Axelson, M., and Stone, G. M. (1985). Identification of the major steroids in ovarian and adrenal venous plasma of the brush-tail possum (Trichosurus, vulpecula) and changes in the peripheral plasma levels of oestradiol and progesterone during the reproductive cycle. J. Endocrinol. 105, 53–62. doi:10.1677/JOE.0.1050053
336
Reproduction, Fertility and Development
T.-A. Alsop et al.
Eckery, D. C., Whale, L. J., Lawrence, S. B., Wylde, K. A., McNatty, K. P., and Juengel, J. L. (2002). Expression of mRNA encoding growth differentiation factor 9 and bone morphogenetic protein 15 during follicular formation and growth in a marsupial, the brushtail possum (Trichosurus vulpecula). Mol. Cell. Endocrinol. 192, 115–126. doi:10.1016/S0303-7207(02)00085-0 Fitzgerald, G., Wilkinson, R., and Saunders, L. (2000) Public perceptions and issues in possum control. In ‘The Brushtail Possum’. (Ed. TL Montague.) pp. 187–197. (Manaaki Whenua Press: Lincon, Canterbury.) Fro¨mter, E. (1988). Mechanisms and regulations of ion transport in the renal collecting duct. Comp. Biochem. Physiol. A 90, 701–707. doi:10.1016/ 0300-9629(88)90687-1 Garty, H., and Palmer, L. G. (1997). Epithelial sodium channels: function, structure and regulation. Physiol. Rev. 77, 359–396. Gautron, J., Hincke, M. T., and Nys, Y. (1997). Precursor matrix proteins in the uterine fluid change with stages of eggshell formation in hens. Connect. Tissue Res. 36, 195–210. doi:10.3109/03008209709160220 Hughes, R. L., and Rodger, J. C. (1971). Studies on the vaginal mucus of the marsupial Trichosurus vulpecula. Aust. J. Zool. 19, 19–33. doi:10.1071/ ZO9710019 Jasti, J., Furukawa, H., Gonzales, E., and Gouaux, E. (2007). Structure of ˚ resolution and low pH. Nature 449, acid-sensing ion channel 1 at 1.9 A 316–323. doi:10.1038/NATURE06163 Kopito, L. E., Kosasky, H. J., and Shwachman, H. (1973). Water and electrolytes in cervical mucus from patients with cystic fibrosis. Fertil. Steril. 24, 512–516. Kunzelmann, K., and Mall, M. (2002). Electrolyte transport in the mammalian colon: mechanisms and implications for disease. Physiol. Rev. 82, 245–289. Legge, M., Hill, B. L., Shackell, G. H., and McLeod, B. J. (1996). Glycosaminoglycans of the uterine and vaginal cul-de-sac tissue in the brushtail possum (Trichosurus vulpecula). Reprod. Fertil. Dev. 8, 819–823. doi:10.1071/RD9960819 Levin, R. J., and Edwards, F. (1968). Transuterine endometrial potential difference, its variation during oestrous cycle and its relation to uterine secretion. Life Sci. 7, 1019–1036. doi:10.1016/0024-3205(68) 90208-7 Loffing, J., Zecevic, M., Feraille, E., Kaissling, B., Asher, C., Rossier, B. C., Firestone, G. L., Pearce, D., and Verrey, F. (2001). Aldosterone induces rapid apical translocation of ENaC in early portion of renal collecting system: possible role of SGK. Am. J. Physiol. Renal Physiol. 280, F675–F682. Maier, D. B., and Kuslis, S. T. (1988). Human uterine luminal fluid volumes and prolactin levels in normal menstrual cycles. Am. J. Obstet. Gynecol. 159, 434–439. doi:10.1016/S0002-9378(88)80102-9 Matthews, C. J., McEwan, G. T. A., Redfern, C. P. F., Thomas, E. J., and Hirst, B. H. (1998). Absorptive apical amiloride-sensitive Naþ conductance in human endometrial epithelium. J. Physiol. 513, 443–452. doi:10.1111/J.1469-7793.1998.443BB.X McLeod, B. J., Thompson, E. G., Crawford, J. L., and Shackell, G. H. (1997). Successful group housing of wild-caught brushtail possums (Trichosurus vulpecula). Anim. Welf. 6, 67–76. McNicholas, C. M., and Canessa, C. M. (1997). Diversity of channels generated by different combinations of epithelial sodium channel subunits. J. Gen. Physiol. 109, 681–692. doi:10.1085/JGP.109.6.681 Muchekehu, R. W., and Quinton, P. M. (2010). A new role for bicarbonate secretion in cervico–uterine mucus release. J. Physiol. 588, 2329–2342. doi:10.1113/JPHYSIOL.2010.187237 Naftalin, R. J., Thiagarajah, J. R., Pedley, K. C., Pocock, V. J., and Milligan, S. R. (2002). Progesterone stimulation of fluid absorption by the rat uterine gland. Reproduction 123, 633–638. doi:10.1530/REP.0.1230633
Palmer, L. G., Li, J. H. Y., Lindemann, B., and Edelman, I. S. (1982). Aldosterone control of the density of sodium channels in the toad urinary-bladder. J. Membr. Biol. 64, 91–102. doi:10.1007/BF01870771 Rochwerger, L., and Buchwald, M. (1993). Stimulation of the cystic fibrosis transmembrane regulator expression by oestrogen in vivo. Endocrinology 133(2), 921–930. Salker, M. S., Christian, M., Steel, J. H., Nautiyal, J., Lavery, S., Trew, G., Webster, Z., Al-Sabbagh, M., Puchchakayala, G., Foller, M., Landles, C., Sharkey, A. M., Quenby, S., Aplin, J. D., Regan, L., Lang, F., and Brosens, J. J. (2011). Deregulation of the serum and glucocorticoidinducible kinase SGK1 in the endometrium causes reproductive failure. Nat. Med. 17, 1509–1513. doi:10.1038/NM.2498 Salleh, N., Baines, D. L., Naftalin, R. J., and Milligan, S. R. (2005). The hormonal control of uterine luminal-fluid secretion and absorption. J. Membr. Biol. 206, 17–28. doi:10.1007/S00232-005-0770-7 Shorey, C. D., and Hughes, R. L. (1973). Cyclical changes in the uterine endometrium and peripheral plasma concentration of progesterone in the Marsupial Trichosurus vulpecula. Aust. J. Zool. 21, 1–19. doi:10.1071/ ZO9730001 Sizemore, R. J., Hurst, P. R., and McLeod, B. J. (2004). Effect of steroid hormones on tissue remodelling and progesterone receptors in the uterus of seasonally anoestrous brushtail possums (Trichosurus vulpecula). Reproduction 127, 255–264. doi:10.1530/REP.1.00091 Smith, P. R., and Benos, D. J. (1991). Epithelial Naþ channels. Annu. Rev. Physiol. 53, 509–530. doi:10.1146/ANNUREV.PH.53.030191.002453 Snyder, P. M., Olson, D. R., and Thomas, B. C. (2002). Serum and glucocorticoid-regulated kinase modulates Nedd4–2-mediated inhibition of the epithelial Naþ channel. J. Biol. Chem. 277, 5–8. doi:10.1074/ JBC.C100623200 Staruschenko, A., Adams, E., Booth, R. E., and Stockand, J. D. (2005). Epithelial Naþ channel subunit stoichiometry. Biophys. J. 88, 3966– 3975. doi:10.1529/BIOPHYSJ.104.056804 Sweezey, N., Tchepichev, S., Gagnon, S., Fertuck, K., and O’Brodovich, H. (1998). Female gender hormones regulate mRNA levels and function of the rat lung epithelial Naþ channel. Am. J. Physiol. 274, C379–C386. Taggart, D. A. (1994). A comparison of sperm and embryo transport in the female reproductive tract of marsupial and eutherian mammals. Reprod. Fertil. Dev. 6, 451–472. doi:10.1071/RD9940451 Tyndale-Biscoe, C. H. (1966) The marsupial birth canal. In ‘Comparative Biology of Reproduction in Mammals. Symposia of the Zoological Society of London. Vol. 15’. (Ed. I. W. Rowlands.) pp. 233–250. (Academic Press: London.) Van Driessche, W., and Lindemann, B. (1979). Concentration dependence of currents through single sodium-selective pores in frog skin. Nature 282, 519–520. doi:10.1038/282519A0 Vetter, A. E., and O’Grady, S. M. (1996). Mechanisms of electrolyte transport across the endometrium. I. Regulation by PGF2 alpha and cAMP. Am. J. Physiol. Cell Physiol. 270, C663–C672. Vetter, A. E., and O’Grady, S. M. (2005). Sodium and anion transport across the avian uterine (shell gland) epithelium. J. Exp. Biol. 208, 479–486. doi:10.1242/JEB.01409 Wright, J. (2011). Evaluating the use of 1080: predators, poisons and silent forests. (Parliamentary Commissioner for the Environment: Wellington, New Zealand.) Available at http://www.pce.parliament.nz/publications/ all-publications/evaluating-the-use-of-1080-predators-poisons-and-silentforests [Verified 17 June 2014]. Yang, J. Z., Ajonuma, L. C., Tsang, L. L., Lam, S. Y., Rowlands, D. K., Ho, L. S., Zhou, C. X., Chung, Y. W., and Chan, H. C. (2004). Differential expression and localization of CFTR and ENaC in mouse endometrium during pre-implantation. Cell Biol. Int. 28, 433–439. doi:10.1016/ J.CELLBI.2004.03.011
www.publish.csiro.au/journals/rfd
