Plant Science 176 (2009) 452–460

Contents lists available at ScienceDirect

Plant Science journal homepage: www.elsevier.com/locate/plantsci

Variation in intron length in caffeic acid O-methyltransferase (COMT) in Vanilla species (Orchidaceae) Pascale Besse a,*, Denis Da Silva a, Se´verine Bory a,b, Michel Noirot c, Michel Grisoni b a Universite de la Reunion, UMR PVBMT ‘‘Peuplements ve´ge´taux et bioagresseurs en milieu tropical’’ Universite Reunion–Cirad, 15 avenue Rene Cassin, BP7151, 97715 Saint Denis messag cedex 9, La Reunion, France b CIRAD, UMR PVBMT ‘‘Peuplements ve´ge´taux et bioagresseurs en milieu tropical’’ Universite Reunion–Cirad, Poˆle de Protection des Plantes, 7 chemin de l’IRAT, 97410 Saint Pierre, La Reunion, France c IRD, UMR PVBMT ‘‘Peuplements ve´ge´taux et bioagresseurs en milieu tropical’’ Universite Reunion–Cirad, Poˆle de Protection des Plantes, 7 chemin de l’IRAT, 97410 Saint Pierre, La Reunion, France

A R T I C L E I N F O

A B S T R A C T

Article history: Received 3 October 2008 Received in revised form 16 December 2008 Accepted 19 December 2008 Available online 20 January 2009

Variation in intron length in caffeic acid O-methyltransferase (COMT) in Vanilla was studied and demonstrated that COMT genes in Vanilla are organized with four exons and three introns. At least two to four different versions (either allelic or paralogous) of the COMT multigenic family in the genus Vanilla (in terms of intron sizes) were detected. The three introns were differentially variable, with intron-1 being the most length-polymorphic. Patterns of variations were in accordance with known phylogenetic relationships in the genus obtained with neutral markers. In particular, the genus displayed a strong Old World versus New World differentiation with American fragrant species being characterized by a specific 99 bp intron-1 size-variant and a unique 226 bp intron-3 variant. Conversely, leafless species of the genus displayed unexpected variations in intron lengths. Due to their role in primary (lignin) and secondary (phenolics, e.g., vanillin, alkaloids) metabolisms, COMT genes might not be neutral markers, and represent candidate functional markers for resistance, aromatic or medicinal properties of Vanilla species. Investigating the orthologous/paralogous status of the different genes revealed (in terms of intron size) will allow the evolution of the COMT genes to be studied. ß 2009 Elsevier Ireland Ltd. All rights reserved.

Keywords: COMT Diversity Intron PCR Vanilla

1. Introduction The genus Vanilla Plum ex Miller belongs to the Orchidaceae family, Vanilloidae sub-family, Vanilleae tribe and Vanillinae subtribe [1–4]. It is composed of about 110 species [5,6] distributed throughout tropical America, Asia and Africa, between the 27th North and South parallels. The genus Vanilla is divided in two sections: Foliosae with developed leaves and Aphyllae (18 species), with reduced bract-like leaves [5]. The Foliosae section is further divided in three sub-sections: Papilloseae (thick leaves, labellum with fleshy hairs), Lamellosae (thick leaves and labellum with scaly lamellae) and Membranaceae (thin membraneous to sub-membraneous leaves) [5]. According to Porte`res [5], 18 species are aromatic but Soto Arenas [7] identifies 35 known or expected aromatic species. All are of American origin [7] and fruit aroma could represent an adaptation to fruit dispersal by bats [8] or to sticky seeds fragrance collection and dispersion by bees as observed for the species V. grandiflora Lindl. [9].

* Corresponding author. Tel.: +262 262 938196; fax: +262 262 938119. E-mail address: [email protected] (P. Besse). 0168-9452/$ – see front matter ß 2009 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.plantsci.2008.12.014

V. planifolia Jack. (Foliosae, Lamellosae) is the main cultivated fragrant species. Another related Vanilla species, V. tahitensis J.W. Moore is also cultivated in several Pacific Ocean countries. Some other aromatic species are grown locally or harvested in the wild but have no economical importance. This is the case for example with V. pompona Schiede in the West Indies, V. chamissonis Klotzsch in Brazil and V. odorata C. Presl. in Tropical America [7]. Processed bean aromas of V. planifolia, V. pompona and V. tahitensis are characterized by the presence of vanillin together with other compounds (anisyl alcohol. . .) responsible for specific differences in global aroma [7]. Vanillin, like other phenolic compounds, is believed to be synthesized from phenylpropanoid precursors, and different biosynthetic pathways have been proposed [10]. We targeted the family of genes encoding O-methyltransferase enzymes (OMTs), involved in primary metabolism (e.g., lignin formation) as well as in secondary metabolism (e.g., phenylpropene and alkaloid biosynthesis) [11,12]. The ability to synthesize the cell wall polymer lignin, provides the necessary structural integrity, and also allows plants to defend themselves selectively against pests and pathogens [13–15]. This gene family is therefore a good target to assess the genetic potential for aromatic and medicinal

P. Besse et al. / Plant Science 176 (2009) 452–460

properties as well as pest resistance in Vanilla species. OMTs catalyze the transfer of the methyl group from S-adenosylmethionine (SAM) to a hydroxyl group [16] and are separated in two classes [17]. Representative Class I OMTs are CCoAOMT, responsible for the methylation of the lignin precursor caffeoyl-coenzyme A [18]. Caffeic acid O-methyltransferases (COMTs) are typical Class II OMTs. As their preferred substrates are actually caffeoyl aldehyde and 5-hydroxyconiferaldehyde [11] they are also referred to as AldOMTs [19]. COMTs are involved in the synthesis of S-lignin. Other Class II OMTs catalyze the methylation of flavonoids, flavonols, phenylpropenes, and phenolics. A cDNA encoding a multifunctional methyltransferase from V. planifolia tissue cultures was recently isolated and functionally characterized [10]. This COMT catalyzes the conversion of 3,4dihydroxybenzaldehyde to vanillin, but its preferred substrates are caffeoyl aldehyde and 5-hydroxyconiferaldehyde, and it was mainly active in root, stems and leaves (not pods). This suggested this methyltransferase may primarily function in lignin biosynthesis. An additional distinct COMT might be present in the pods capable of catalyzing the conversion of 3,4-dihydroxybenzaldehyde to vanillin as such a strong activity was detected [10]. Three other V. planifolia COMT (Vpomt) sequences were published [20] but have been removed from the NCBI database as they are reported to be actually from Catharanthus roseus [10,16]. In addition, O-methyl transferases (Van-OMT-2 and Van-OMT-3) were recently isolated from V. planifolia [11]. Based on sequence analysis, these enzymes were close to caffeic acid O-methyltransferases (COMTs), but they showed negligible activity with typical COMT substrates. According to phylogenetic analysis, Van-OMT-2 and -3 evolved from the V. planifolia COMT (52% identity) [11]. Enzymes involved in the synthesis of plant secondary metabolites are indeed considered to result from gene duplication followed by mutations or possibly simple allelic divergence of genes coding for enzymes of the primary metabolism, leading to novel substrate preferences [12]. This was demonstrated as well for the Clarkia breweri IEMT gene [12] and the Chrysosplenium americanum FOMT [21]. A large panel of COMT-like enzymes were identified in Arabidopsis thaliana [22] and Populus tremuloı¨des [23], forming at least 4 phylogenetic classes based on cDNA sequence homologies [23]. This demonstrates the genetic complexity of this multigenic family. A genetic study of genomic COMT in sorghum [13] and on sequence homology between sorghum, maize and rice suggested a strong selective pressure on the coding sequence. In contrast, the size of the intron varied considerably between the three species. A genetic study of genomic COMT in maize in 34 inbred lines also revealed indel variations in the intron at the intra-specific level [24]. To maximize genetic diversity information, the present study within the Vanilla genus was therefore focussed on intron-size variation. By using published plant gDNA sequences for the COMT gene, intron locations were predicted in the V. planifolia COMT cDNA sequence published [10], and these introns were PCRamplified to assess their number and size variation in different Vanilla species of American, African and Asian origin. The results were compared to previous studies based on neutral markers used to assess genetic diversity (RAPDs, AFLPs) [25,26] in, and the phylogeny (rbcL, ITS) [6,8,7,27] of, the Vanilla genus. 2. Material and methods 2.1. Plant material The 55 accessions of the genus Vanilla studied (Table 1) are vines maintained in the collection of vanilla genetic resources of CIRAD in Reunion Island (Centre International de Recherche Agronomique pour le De´veloppement) [28]. They represent 21

453

different species of various geographical origin, as well as 18 unidentified species (coded as Vanilla sp.). 2.2. DNA extraction DNA was extracted according to the MATAB protocol developed by Risterucci et al. [29]. DNA concentrations of extracts were visually estimated by comparisons with dilutions of maize DNA samples of known concentration after electrophoresis on agarose gels. 2.3. Intron location prediction in Vanilla COMT cDNA Complete gene sequences for caffeic acid O-methyltransferases were available from the EMBL database for Pinus radiata (accession no. AF119225 [30]), Hordeum vulgare (accession no. U54767 [31]), Nicotiana tabacum (accession no. AF48252 [32]), Populus kitakamiensis (P. sieboldii X P. grandidentata) (accessions nos. D49710 and D49711 [33]), Populus tremuloides (accession no. U13171 [34] and accession no. U50522 [35]), Zea mays (accession no. M73235 [36], accessions nos. AY323272 to AY323305 [24]), Sorghum bicolor (accession no. AY217766 [13]), Saccharum spp. (accession no. AY365419) and Malus  domestica (accessions nos. DQ886018, DQ886019, DQ886020, DQ886021 [37]). Partial gene sequence was also available for Pinus taeda (accession no. AY764767S2 [38]) and Cathaya argyrophylla (accessions nos. DQ424844 and DQ42484 [39]). Among the gDNA OMT sequences published for the model species Arabidopsis thaliana, including FOMT and POMT sequences, we selected accession no. AT1G51990 (chromosome 1 complete sequence NC003070, TAIR8 genome release, Apr 24, 2008) a putative COMT identified as similar to the Malus  domestica COMT. For the model species Oryza sativa, we selected accession no. Os08g0157500 [40] a putative COMT which we identified as the most similar to the Sorghum (83.3% identity), Zea (83.9% identity) and Saccharum (84.2% identity) COMT genes available based on exon sequence similarity. Predicted cDNAs were deduced from these genomic sequences by splicing out the introns, and these sequences were aligned to the 1219 bp V. planifolia caffeic acid O-methyltransferase cDNA (accession no. AY555144 [10]) using the ClustalW function in BioEdit (v.7.0.9.0) software. This allowed the prediction of intron positions within the V. planifolia COMT sequence. PCR primers surrounding the three predicted introns were then designed using the primer 3 software v. 0.4.0 web version (Table 2). The homology of these primers with the corresponding regions of the two other published V. planifolia OMT genes (accessions nos. DQ400399 and DQ400400 [11]) was also verified (Table 2) and they were sufficiently low to ensure that there could be no cross amplification under the stringent PCR conditions used. 2.4. PCR-amplification of COMT introns in Vanilla species PCR reactions were carried out in a reaction volume of 25 ml, containing 10 ng DNA, PCR buffer (ABgene), 2 mM MgCl2 (ABgene), 0,24 mM dNTP (Amersham Pharmacia Biotech), 2U TAQ DNA polymerase (Red Hot DNA Polymerase, ABgene) and 1 mM of each primer. PCR reactions were performed on a GeneAmp PCR System 9700 thermocycler (Applied Biosystems) using the following parameters: 94 8C for 4 min, 34 cycles of 94 8C for 30 s, 60–53 8C for 45 s (annealing temperature was lowered by 0.7 8C per cycle during the 10 first cycles), 72 8C for 1 min, and finally 72 8C for 5 min. PCR products were migrated in a 1.2% agarose gel in TBE (Tris Borate EDTA) buffer, and product sizes were estimated against a 100 bp molecular weight marker using the Gel Compar II v.2.5 software (Applied Maths). PCR-amplification on the whole collection was repeated twice and patterns were highly reproducible.

P. Besse et al. / Plant Science 176 (2009) 452–460

454

Table 1 Sample code (for DNA analysis), voucher number (accession number in the CIRAD collection), species names, geographical origin (continent and region), and section (A = Aphyllae, F = Foliosae) and Foliosae sub-sections (L = Lamellosae, M = Membranaceae, P = Papillosae) of the Vanilla accessions studied [5]. Sample code

1 2 3 4 54 5 7 45 9 46 55 44 12 13 14 57 41 47 10 18 19 20 21 23 24 25 26 53 27 28 22 29 32 33 52 34 35 37 11 15 16 36 17 39 40 43 56 6 8 38 42 48 49 50 51

Voucher number

CR0108 CR0179 CR0141 CR0142 CR0694 CR0146 CR0061 CR0103 CR0065 CR0106 CR0696 CR0102 CR0104 CR0105 CR0156 CR0698 CR0091 CR0107 CR0067 CR0700 CR0707 CR0071 CR0072 CR0666 CR0667 CR0702 CR0174 CR0693 CR0109 CR0686 CR0701 CR0577 CR0046 CR0163 CR0682 CR0083 CR0093 CR0068 CR0705 CR0058 CR0154 CR0059 CR0145 CR0088 CR0089 CR0101 CR0697 CR0171 CR0115 CR0082 CR0100 CR0119 CR0153 CR0155 CR0177

Vanilla species

humblotii humblotii madagascariensis madagascariensis madagascariensis phalaenopsis roscheri africana crenulata crenulata crenulata crenulata imperialis imperialis imperialis polylepis crenulata sp sp bahiana bahiana bahiana bahiana chamissonis chamissonis chamissonis ensifolia grandiflora leprieuri odorata planifolia planifolia pompona tahitensis sp palmarum sp sp sp albida albida albida aphylla sp sp sp sp sp sp sp sp sp sp sp sp

Geographical origin Continent

Region of collection

Section (sub-section)

Africa Africa Africa Africa Africa Africa Africa Africa Africa Africa Africa Africa Africa Africa Africa Africa Africa Africa Africa America America America America America America America America America America America America America America America America America America America America Asia Asia Asia Asia Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown

Comoros Mayotte Madagascar Madagascar

A A A A A A A F(L) F(L) F(L) F(L) F(L) F(P) F(P) F(P) F(L) F(L) F F F(L) F(L) F(L) F(L) F(L) F(L) F(L) F(L) F(L) F(L) F(L) F(L) F(L) F(L) F(L) F(M) F(M) F F(L) F F(L) F(L) F(L) A A A A A F F F

Seychelles West Africa West Africa West Africa West Africa West Africa West Africa West Africa West Africa Central Africa West Africa Central Africa Brazil Brazil Brazil Brazil Brazil Brazil Brazil Fr Guyana Fr Guyana Fr Guyana

Costa Rica

F F F

2.5. Data analysis

Table 2 Sequences of the primers designed from the COMT cDNA sequence from Pak et al. [10] and used for PCR-amplification of the three putative COMT introns in Vanilla species. The % homology of these primers with the corresponding sequences in the published OMTs Van-OMT-2 and Van-OMT-3 from V. planifolia is indicated. COMT

Forward primer 50 –30

Van-OMT

Reverse primer 50 –30

Van-OMT

Intron-1 Intron-2 Intron-3

gctcaccagctactccatcc tgatgttggtggtggaattg ttgaaagtgtccccattggt

68.75% 55% 45%

ccaccatttgtcactgcatc accaatggggacactttcaa aaaggtgcatcgggaagaat

58.8% 45% 55% + 3 nt del

Bands were coded for presence (1) and absence (0) and an Unweighted Neighbor Joining Tree was generated with 1000 bootstraps from the Dice distance matrix using the DARwin 5.0 software [41]. 3. Results 3.1. Intron amplification in Vanilla planifolia genomic COMT A comparison of published complete gene sequences of the COMT genes in different species, revealed an important variation in

P. Besse et al. / Plant Science 176 (2009) 452–460

455

Fig. 1. COMT genomic DNA structure inferred from published EMBL sequences from different species (see references and EMBL accession numbers in Section 2) and alignments between exon sequences using ClustalW.

the number of introns (and consequently of exons) present (Fig. 1): A. thaliana, H. vulgare, P. kitakamiensis, P. tremuloides and Malus  domestica displayed three introns, N. tabacum and P. radiata both exhibited two introns and Z. mays, S. bicolor, O. sativa and Saccharum sp. had only one intron (Fig. 1). Sequence alignment of the different exons was performed using ClustalW (data not shown) and suggested a reduction in the number of exons corresponding actually to the absence of some introns for some species: for example exon 2 in maize could be aligned to exons (2 + 3 + 4) from Populus and Hordeum species (with 61.56% and 57.76% sequence identity, respectively) (Fig. 1). The amino acid sequence of the COMT cDNA from V. planifolia (monocot, Asparagales) showed a similar level of divergence from the other monocot OMTs (Poales) as from the dicot OMTs [10]. Furthermore, within the monocot sequences available, different patterns of intron numbers were revealed as shown in Fig. 1. Based on these observations, and within the plant genomic DNA COMT sequences available in the databases, intron number in Vanilla could fit any of the above described situations (one to three introns). The V. planifolia cDNA was aligned with the Populus/ Hordeum genomic DNA sequences from which introns were

removed and primer pairs were designed (Table 2, Fig. 2) to amplify in V. planifolia the three maximum COMT introns so far identified in plant COMT genes. For each of the three pairs of primers, PCR-amplifications revealed products with sizes always exceeding the sizes expected without introns (Fig. 3), therefore confirming the presence of three putative introns. Furthermore, intra-individual size variations were revealed (Fig. 3), suggesting a multigenic family. Four different intron-1 sizes (99, 219, 229 and 299 bp), two different intron-2 sizes (87 and 147 bp) and one intron-3 size (226 bp) coexist in V. planifolia (Fig. 3). Consequently, the length of COMT genomic DNA would be comprised between 1578 and 1838 bp. 3.2. Intron amplification and size variations in different Vanilla species COMT genes might exist as a multigenic family in all Vanilla species, as witnessed by intra-individual coexistences of one to four size-variants for intron-1, two size-variants for intron-2 and one to two size-variants for intron-3 (Fig. 4). For intron-2 all species exhibited the same pattern as V. planifolia (sample 22 in

Fig. 2. Predicted positions of the four putative exons (boxes) in the cDNA (1219 bp) from V. planifolia (accession no. AY555144 [10]) and location of the primers (in bold) designed to PCR-amplify the introns from the gDNA.

456

P. Besse et al. / Plant Science 176 (2009) 452–460

as V. imperialis and V. polylepis (samples 12–17 in Fig. 4), and Aphyllae species of Asian and unknown origin (sample 17 V. aphylla, and samples 40 and 43 not shown). On the other hand, both types were simultaneously present in Aphyllae African species V. humblotii, V. madagascariensis and V. phalaenopsis (samples 1–7 on Fig. 4 and samples 39 and 54 not shown), the unknown Central African CR0067 accession (sample 10 in Fig. 4) and West African species such as V. crenulata (e.g., sample 9 in Fig. 4) and V. africana (not shown). 3.3. Species clustering using pattern variation in the genus Vanilla

Fig. 3. COMT cDNA and corresponding genomic DNA in V. planifolia (accessions CR0701 and CR0577 giving the same patterns, only accession CR0701 is shown): (A) expected PCR-product sizes from the cDNA sequence, (B) PCR-amplifications for the 3 expected introns (first lane is 100 bp ladder and sizes in bp are indicated) and (C) PCR products and deduced gDNA intron sizes. All sizes are in bp.

Fig. 4). Conversely, size-variant patterns for intron-1 and intron-3 were revealed between and within species (Fig. 4). Intron-1 sizes varied between 99 and 299 bp (300 and 450 bp PCR-product sizes) (Fig. 4) and eleven size-variants were revealed in the Vanilla genus. The 99 bp intron-1 variant (300 bp PCR product) is noteworthy. It was specific to all American species (samples 18–27 in Fig. 4), except for V. palmarum (CR00083) and the unknown species CR0682 for which it was absent (data not shown). It was always absent in all the Asian and African species tested (e.g., samples 1–17 in Fig. 4). For intron-3, two patterns were revealed. A unique 226 bp intron (410 bp PCR product) was present in all American species tested (such as samples 18–27 in Fig. 4), and a unique 266 bp intron (450 bp PCR product) in the Asian species V. albida (samples 15 and 16 in Fig. 4 and sample 36 not shown), African species such

These pattern variations in intron-1 and intron-3 were scored to compute the NJ tree presented in Fig. 5. The low bootstrap values are due to the limited number of variables computed (14 variables). Nevertheless, a strong differentiation between American and African–Asian species in the genus was still revealed. American species possessing the 99 bp intron-1 variant and the 226 bp intron-3 size-variant were divided into four groups according to additional size-variants observed in intron-1: (1) a group composed of the main cultivated species V. planifolia and V. tahitensis, (2) a group comprising V. chamissonis and V. leprieuri and other unidentified species, (3) a group comprising V. pompona, V. odorata, V. grandiflora, V. ensifolia and other unidentified species; and finally (4) a group composed of the species V. bahiana. The unknown accession CR0682 and V. palmarum were different from the rest of the American species studied as both lacked the 99 bp American-specific intron-1 variant. In African and Asian species, five groups were defined. Group (1) was composed of West African Lamellosae species (V. crenulata, V. africana) and group (2) of Asian species (V. albida), the Papillosae African species V. imperialis, and the Lamellosae Central African species V. polylepis. The Asian Aphyllae species V. aphylla was close to group (2). African Aphyllae species appeared very variable. V. roscheri was included within the West African species group (1). The remaining species (V. humblotii, V. madagascariensis, V. phalaenopsis and other unidentified leafless species) were variable

Fig. 4. Examples of PCR-amplification of COMT intron-1 (top image), intron-2 (middle image) and -3 (bottom image) for different Vanilla species. Sample codes, as listed in Table 1, are indicated above each lane (sample 22 is V. planifolia). First and last lanes are 100 bp ladder (sizes in bp are indicated).

P. Besse et al. / Plant Science 176 (2009) 452–460

457

Fig. 5. Unweighted neighbor joining analysis of intron-1 and -3 size variations in different Vanilla species (% bootstrap values >50 are indicated). Species name followed by accession number is indicated (plus sample code in parenthesis). Foliosae and Aphyllae species are indicated by a circle and a triangle, respectively.

and defined groups (3)–(5) within which the species V. madagascariensis was encountered, as it showed intron-1 size variations at the intra-specific level. 4. Discussion 4.1. Structure of the COMT genes in the genus Vanilla and comparison with other plant species In Vanilla species, the COMT genes are structured with four exons and three introns, matching the situation found for A. thaliana, H. vulgare, Malus  domestica and Populus species (Fig. 1). The genomic structure of COMT genes therefore seems to be very complex in the plant kingdom. From published sequences (Fig. 1), the presence of intron-1 might be a common feature of angiosperms (as it is absent in gymnosperms, e.g., P. radiata). For the other introns, the situation is very complex, particularly within the monocots. The Poaceae family shows two situations: one intron only in sub-families Panicoideae (Zea, Sorghum, Saccharum) and Oryzoideae (Oryza) and three introns in the sub-family Pooideae (Hordeum) (Fig. 1 and Table 3). Intron structure in Vanilla (Orchidaceae) is the same as Hordeum (Pooideae) with three introns. Interestingly, three introns are also present within the dicots in the Salicaceae (Populus genus), Brassicaceae (Arabidopsis) and Rosaceae (Malus) families, whereas Nicotiana tabacum, a Brassicaceae, is characterized by the lack of intron-3 (Fig. 1 and Table 3). The three introns feature is therefore present in different phylogenetic clades in the angiosperms and this could represent an ancestral state. The family of COMT genes in Vanilla might be represented by a minimum of two genes, as witnessed by species such as V.

imperialis and V. albida (samples 12–16 in Fig. 4) with a single intron-1 size-variant, the double size-variant intron-2 and a single size-variant intron-3, revealed by PCR-amplification. For other species, there could be at least four COMT genes, as witnessed by species such as V. bahiana (samples 18–21 in Fig. 4) with four length variants for intron-1, two variants for intron-2 and a single variant for intron-3. However, as some of these variants could be allelic variants, there should exist at least two to four different versions (either allelic or paralogous) of the COMT gene in the genus Vanilla (in terms of intron sizes). In all species including Vanilla, the length of the exons are highly conserved (1047–1151 bp) and length variations in the COMT genes are due to intron-size variations (Table 3). The deduced genomic DNA length (from 1578 to 1838 bp) is in accordance with other sizes that can be deduced from published sequences (Table 3) although higher sizes were reported in Sorghum, Populus, Malus  domestica, Oryza and Nicotiana (up to 3229 bp). 4.2. Each COMT intron is differentially variable in Vanilla Intron-2 displayed two sizes, but the pattern was invariant across all Vanilla species studied. Consequently, this intron might be under high selection constraint in the genus. Similarly, intron-3 displayed two sizes, one specific for Asian/African species, the other for American species, with the two found together in Indian Ocean Aphyllae and West African leafy species. This intron seems to follow a phylogeographical trend in relation with species evolution (see below) and might as well be under selective constraint as it is conserved between closely related Vanilla species. By contrast, intron-1 was highly variable and seems to be prone to the accumulation of length variations, making it vary from

P. Besse et al. / Plant Science 176 (2009) 452–460

458

Table 3 Size variations in COMT exons (in bold) and introns sizes in published EMBL sequenced genomic DNA (see Section 2 for references of the EMBL accessions). Putative exon sizes for Vanilla sp. are also indicated (from accession AY555144 and this work). Species

EMBL

EXON-1

INTRON-1

EXON-2

INTRON-2

EXON-3

INTRON-3

EXON-4

TOTAL

EXONS

INTRONS

P. tremuloides P. tremuloides P. kitakamiensis P. kitakamiensis H. vulgare A. thaliana Mxdomestica Mxdomestica Mxdomestica Mxdomestica Vanilla sp Z. mays Z. mays S. bicolor Saccharum O. sativa N. tabacum P. radiata

U13171 U50522 D49710 D49711 U54767 AT1G51990 DQ886018 DQ886019 DQ886020 DQ886021

419 416 419 416 452 410 419 419 419 419 374 422 422 410 416 431 422 760

1102 359 1077 261 194 102 1422 1448 1398 1438 99–299 916 764–916 1384 923 1691 1352

311 311 311 311 314 314 311 311 311 311 312

130 145 126 145 196 289 175 175 175 175 87 and 147

150 260 178 317 520 236 124 124 124 124 226 and 246

303 303 303 303 300 303 303 303 303 303 297

311

782 248

65 65 65 65 65 65 65 65 65 65 64 673 673 679 673 676 362 65

2480 1859 2479 1818 2041 1719 2819 2845 2795 2835 1578–1838 2011 1859–2011 2473 2012 2798 3229 1487

1098 1095 1098 1095 1131 1092 1098 1098 1098 1098 1047 1095 1095 1089 1089 1107 1095 1151

1382 764 1381 723 910 627 1721 1747 1697 1737 412–692 916 764–916 1384 923 1691 2134 336

M73235 AY323272 to AY323305 AY217766 AY365419 Os08g0157500 AF484252 AF119225

99 to 299 bp. Intron-1 also appeared to be the most variable at the intra-individual level as up to four different size-variants were detected for some accessions such as the species V. planifolia and V. bahiana. Such a characteristic is also displayed in P. tremuloides, P. kitakamiensis and Malus  domestica (Table 3). 4.3. Genetic patterns of COMT intron-size variations versus neutral markers COMT intron-size variations revealed a pattern of Old World versus New World differentiation in the Vanilla genus. This was particularly due to intron-3 size variations and to the 99 bp intron1 size-variant. Differentiation between American and Asia/African species was suggested from morphological observations [5], and it was also the case for neutral molecular markers such as SSR markers [42], rbcL [7] and ITS [27]. Recent historical biogeographical studies based on phylogeny data [43,44] suggested that the Vanillinae lineage evolved in South America, then Vanilla species migrated to the Old World (in Africa, then Asia). The length variation patterns in COMT introns revealed are consistent with this scenario. The 99 bp intron-1 size-variant is found only in American species (except V. palmarum). A single intron-3 variant (226 bp) is present in all American species, and a longer 266 bp variant is found only in African and Asian species. Both variants are simultaneously present in Indian Ocean leafless species, the West African Group (1) species (V. crenulata, V. africana) and the unknown species CR0067. This is very interesting on an evolutionary point of view as these species could represent a bridge between American species on one hand and the remaining African (central African species V. polylepis and the Papillosae V. imperialis) and Asian species from Group (2) on the other hand. Patterns of species relationships revealed are globally in accordance with what was known from neutral nuclear markers such as AFLP [26], SSR [42], ITS [27] or cytoplasmic rbcL markers [7]. V. palmarum was described as an early diverging species in the American group based either on rbcL or ITS studies [8,27]. This was confirmed by COMT intron length variations showing that this species was very different from the other American species (Fig. 5). Within American species, V. tahitensis and V. planifolia were described as closely related species using different markers [6] and they displayed identical COMT length variants (Figs. 4 and 5). Similarly, the species V. pompona and V. grandiflora were also grouped using ITS sequencing [27]. In Africa, the West African Lamellosae species (V. crenulata, V. africana) were different from

88

324

the central African Lamellosae species (V. polylepis) which was grouped with the Papillosae species V. imperialis using ITS markers [27], similarly to Groups (1) and (2) revealed here (Fig. 5). These results are also congruent with floral morphology observations [5] for these African species. But some discrepancies do also appear: V. pompona was related to V. chamissonis but distant from V. odorata using ITS [27], the opposite situation was found here (Fig. 5). The major discrepancy between neutral markers and COMT intron-size variations was observed for the section Aphyllae species of the genus. These leafless species are very original with an almost exclusive insular distribution [5]. They are found in the West Indies (six species), in the Indian Ocean (seven species) and in Indonesia (five species). Leafless species of the genus appeared as polyphyletic using rbcL [7] and ITS [27] markers, but they formed monophyletic clades on each continent (America, Africa and Asia). Evolution of section Aphyllae species seems to have been driven by a convergent adaptation on each continent to xeric conditions [45]. The African leafless species studied were surprisingly polymorphic at the COMT intron-1 and -3 size level and they were not monophyletic. Moreover, COMT intron sizes were variable even at the intraspecific level in V. madagascariensis. This might be related to the large natural distribution area of this species in Madagascar (Besse P., com pers [5]). The COMT intron-size groups revealed bear no relationships with the morphological variations in these leafless species (data not shown) nor with their geographical origin (Table 1). This reflects the fact that intron size of the COMT genes evolve much faster than the previously surveyed neutral markers. Two contrasted hypothesis can be emitted: 1/this witnesses a neutral accumulation of random mutations in intron-1 and -3, 2/COMT genes being involved in primary and secondary metabolisms, they could be under high selective pressures and consequently evolving rapidly. Finally, the case of the species V. roscheri is noteworthy. It is the only leafless species of the Indian Ocean area to have a geographical distribution that is not exclusively insular. It was described on the islands of Zanzibar and Pemba [5] but records of this species are also found in coastal areas from Tanzania [46], Mozambique [47] to South Africa near Lake Sibaya [48]. The affinity of this species with the group (1) of West African leafy species might indicate that they have a common origin. However, in a study using ITS markers [27], African leafless species (including V. roscheri) were related to the central African species V. polylepis and the Papillosae V. imperialis corresponding to Group (2).

P. Besse et al. / Plant Science 176 (2009) 452–460

5. Conclusion Due to their role in primary (lignin) and secondary (phenolics, e.g., vanillin, alkaloids) metabolisms, COMT genes might not be neutral markers, and this could be responsible for the differences observed between the phylogenies constructed using neutral markers and COMT intron length variation. COMT intron-size variations may be evidence of the occurrence of COMT genes or alleles with different substrate specificities putatively involved in pest resistance and aromatic or medicinal properties, shared between some Vanilla species. It was indeed suggested that not only paralogous but also orthologous divergence may be responsible for the evolution of genes involved in secondary metabolism [12]. Interestingly, all American species, described as being aromatic [7] as opposed to Asian and African species, displayed specific intron-size-variants (99 bp intron-1 and 226 bp intron-3). Similarly, leafless species displayed original COMT intron patterns. These species develop very thick and large stems (larger than most leafy species) representing the main body of the plant and taking over the photosynthetic role [49], and some, such as the Asian V. aphylla, are described as a source of resistance to Fusarium oxysporum [50]. Moreover, many of these leafless Vanilla species allegedly exhibit medicinal properties [51]. The developed markers might therefore be good candidates towards the development of functional markers (FMs) [52] to explore the genetic basis of aromatic or medicinal properties and pest resistance in Vanilla species through a gene mapping and QTL approach or association studies. Such strategies proved successful using CCoAOMT and COMT genes in maize [24,52,53] or PAL and CCoAOMT in coffee [54,55]. Using segregating progenies would enable the number of genes present in the Vanilla COMT family and the map location of specific genes or alleles, as defined by intron length, to be determined. Sequencing of the introns would allow the molecular basis of the observed length variation to be determined, and to examine possible insertion of transposable elements as reported in sorghum [13]. Finally, targeting putative introns by PCR-amplification using published cDNA sequences in different plant species within the angiosperms and gymnosperms could assist in unravelling the evolution of the COMT gene family in terms of intron numbers, as this feature was shown to be highly variable. Acknowledgements The authors thank all partners who provided biological material, particularly M. Wong and S. Andrzejewski (Etablissement Vanille de Tahiti, French Polynesia), M. Pignal (Museum National d’ Histoire Naturelle, Paris), A. Rongier (Jardin Botanique, Cherbourg), P. Bertaux (Jardin du Luxembourg, Se´nat, Paris), D. Scherberich (Parc de la Teˆte d’Or, Lyon), L. Bray (Serres d’Auteuil, Paris), C. Figureau (Jardin des Plantes, Nantes), E. Spick (Jardin des Plantes, Montpellier), P. Malaxechevarria (Royal Botanical Garden, Kew), P. Martin (FFAO), B. Coˆme (Coope´rative Provanille, Re´union), E. Marinot (Floribis, Madagascar), J.-L. Pradon (French Guyana), F. Le Bellec (CIRAD Guadeloupe) and T. Pailler (Univ. Re´union). The authors thank Pr. M. Dron (IBP, Univ. Paris XI), Dr. P. Feldmann and Dr. M-F Duval (CIRAD) for their interest and support to this work. References [1] K.M. Cameron, Vanilloideae, in: A.M. Pridgeon, P.J. Cribb, M.W. Chase, F.N. Rasmussen (Eds.), Genera Orchidacearum: Orchidoideae, Oxford University Press, USA, 2003, pp. 281–285. [2] K.M. Cameron, Utility of plastid psaB gene sequences for investigating intrafamilial relationships within Orchidaceae, Mol. Phylogenet. Evol. 31 (2004) 1157– 1180.

459

[3] K.M. Cameron, M.W. Chase, W.M. Whitten, P.J. Kores, D.C. Jarrell, V.A. Albert, T. Yukawa, H.G. Hills, D.H. Goldman, A phylogenetic analysis of the Orchidaceae: evidence from rbcL nucleotide sequences, Am. J. Bot. 86 (1999) 208–224. [4] K.M. Cameron, M.C. Molina, Photosystem II gene sequences of psbB and psbC clarify the phylogenetic position of Vanilla (Vanilloideae, Orchidaceae), Cladistics 22 (2006) 239–248. [5] R. Porte`res, Le genre Vanilla et ses espe`ces, in: P. Lechevalier (Ed.), Le vanillier et la vanille dans le monde Paris, 1954, pp. 94–290. [6] S. Bory, M. Grisoni, M.-F. Duval, P. Besse, Biodiversity and preservation of vanilla: present state of knowledge, Genet. Resour. Crop Ev. 55 (2008) 551–571. [7] M.A. Soto Arenas, Vanilla, in: A.M. Pridgeon, P.J. Cribb, M.W. Chase, F.N. Rasmussen (Eds.), Genera Orchidacearum: Orchidoideae, Oxford University Press, USA, 2003, pp. 321–334. [8] M.A. Soto Arenas, Filogeografia y recursos gene´ticos de las vainillas de Me´xico. Vol. 2004. Me´xico: Herbario de la Asociacio´n Mexicana de Orquideologı´a, 1999, pp. 102. [9] P. Lubinsky, M. Van Dam, A. Van Dam, Pollination of Vanilla and evolution in Orchidaceae, Orchids 75 (2006) 926–929. [10] F.E. Pak, S. Gropper, W.D. Dai, D. Havkin-Frenkel, F.C. Belanger, Characterization of a multifunctional methyltransferase from the orchid Vanilla planifolia, Plant Cell Rep. 22 (2004) 959–966. [11] H.M. Li, D. Rotter, T.G. Hartman, F.E. Pak, D. Havkin-Frenkel, F.C. Belanger, Evolution of novel O-methyltransferases from the Vanilla planifolia caffeic acid O-methyltransferase, Plant Mol. Biol. 61 (2006) 537–552. [12] E. Pichersky, D.R. Gang, Genetics and biochemistry of secondary metabolites in plants: an evolutionary perspective, Trends Plant Sci. 5 (2000) 439–445. [13] S. Bout, W. Vermerris, A candidate-gene approach to clone the sorghum Brown midrib gene encoding caffeic acid O-methyltransferase, Mol. Genet. Genom. 269 (2003) 205–214. [14] M.M. Campbell, R.R. Sedero, Variation in lignin content and composition, Plant Physiol. 110 (1996) 3–13. [15] P. Kenrick, P.R. Crane, The origin and early evolution of plants on land, Nature 389 (1997) 33–39. [16] G. Schro¨der, E. Wehinger, J. Schro¨der, Predicting the substrates of cloned plant Omethyltransferases, Phytochemistry 59 (2002) 1–8. [17] C.P. Joshi, V.L. Chiang, Conserved sequence motifs in plant S-adenosyl-L-methionine-dependent methyltransferases, Plant Mol. Biol. 37 (1998) 663–674. [18] J.M. Humphreys, C. Chapple, Rewriting the lignin roadmap, Curr. Opin. Plant Biol. 5 (2002) 224–229. [19] W. Boerjan, J. Ralph, M. Baucher, Lignin biosynthesis, Annu. Rev. Plant Biol. 54 (2003) 519–546. [20] Z.T. Xue, P.E. Brodelius, Kinetin-induced caffeic acid Omethyltransferases in cell suspension cultures of Vanilla planifolia Andr. and isolation of caffeic acid Omethyltransferase, Plant Physiol. Biochem. 36 (1998) 779–788. [21] A. Gauthier, P.J. Gulick, R.K. Ibrahim, Characterization of two cDNA clones which encode O-methyltransferases for the methylation of both flavonoid and phenylpropanoid compounds, Arch. Biochem. Biophys. 351 (1998) 243–249. [22] J. Raes, A. Rohde, J.H. Christensen, Y. Van de Peer, W. Boerjan, Genome-wide characterization of the lignification toolbox in Arabidopsis, Plant Physiol. 133 (2003) 1051–1071. [23] C.J. Tsai, S.A. Harding, T.J. Tschaplinski, R.L. Lindroth, Y. Yuan, Genome-wide analysis of the structural genes regulating defense phenylpropanoid metabolism in Populus, New Phytol. 172 (2006) 47–62. [24] C. Guillet-Claude, C. Birolleau-Touchard, D. Manicacci, M. Fourmann, S. Barraud, V. Carret, J.P. Martinant, Y. Barrie`re, Genetic diversity associated with variation in silage corn digestibility for three O-methyltransferase genes involved in lignin biosynthesis, Theor. Appl. Genet. 110 (2004) 126–135. [25] P. Besse, D. Da Silva, S. Bory, M. Grisoni, F. Le Bellec, M.F. Duval, RAPD genetic diversity in cultivated vanilla: Vanilla planifolia, and relationships with V. tahitensis and V. pompona, Plant Sci. 167 (2004) 379–385. [26] S. Bory, P. Lubinsky, A.M. Risterucci, J.L. Noyer, M. Grisoni, M.-F. Duval, P. Besse, Patterns of introduction and diversification of Vanilla planifolia (Orchidaceae) in Reunion Island (Indian Ocean), Am. J. Bot. 95 (2008) 1–11. [27] M.A. Soto Arenas, Vainilla: los retos de un cultivo basado en una especie amenazada con una historia de vida compleja, Congreso Internacional de Productores de Vainilla, Consejo Veracruzano de la Vainilla, Papantla, Veracruz, Mexico, 2006. [28] M. Grisoni, M. Moles, P. Besse, S. Bory, M.-F. Duval, R. Kahane, Towards an international plant collection to maintain and characterize the endangered genetic resources of vanilla, Acta Hort. (ISHS) 760 (2007) 83–91. [29] A.M. Risterucci, L. Grivet, J.A.K. N’Goran, I. Pieretti, M.H. Flament, C. Lanaud, A high density linkage map of Theobroma cacao L., Theor. Appl. Genet. 101 (2000) 948–955. [30] R.L. Moyle, A. Wagner, C. Walter, Nucleotide sequence of a caffeic acid Omethyltransferase (cOMT) gene (Accession No. AF119225) from Pinus radiata (PGR99-026), Plant Physiol. 119 (1999) 1147–11147. [31] J.E. Lee, A. Kleinhofs, A. Graner, S. Wegener, B. Parthier, M. Loebler, Genomic sequence and mapping of a methyljasmonate-induced O-methyltransferase from barley, DNA Seq. 7 (1997) 357–363. [32] V. Toquin, B. Grausem, P. Geoffroy, M. Legrand, Structure of the tobacco caffeic acid O-methyltransferase (COMT) II gene: identification of promoter sequences involved in gene inducibility by various stimuli, Plant Mol. Biol. 52 (2003) 495–509. [33] T. Hayakawa, K. Nanto, S. Kawai, Y. Katayamaba, N. Morohoshi, Molecular cloning and tissue-specific expression of two genes that encode caffeic acid

460

[34]

[35]

[36]

[37] [38]

[39]

[40]

[41]

[42]

[43] [44]

P. Besse et al. / Plant Science 176 (2009) 452–460 O-methyltransferases from Populus kitakamiensis, Plant Sci. 113 (1996) 157–165. C.J. Tsai, G.K. Podila, V.L. Chiang, Nucleotide sequence of a Populus tremuloides gene encoding bispecific caffeic acid/5-hydroxyferulic acid O-methyltransferase, Plant Physiol. 107 (1995) 1459–11459. W.J. Hu, V.L. Chiang, Nucleotide sequence of an additional member of bispecific caffeic acid/5-hydroxyferulic acid O-methyltransferase gene family in Populus tremuloides (accession no. U50522) (PGR97-035), Plant Physiol. 113 (1997) 1003–11003. P. Collazo, L. Montoliu, P. Puigdomenech, J. Rigau, Structure and expression of the lignin O-methyltransferase gene from Zea mays L., Plant Mol. Biol. 20 (1992) 857–867. Y. Han, S.S. Korban, Spring:, A novel family of miniature inverted-repeat transposable elements is associated with genes in apple, Genomics 90 (2007) 195–200. G.R. Brown, G.P. Gill, R.J. Kuntz, C.H. Langley, D.B. Neale, Nucleotide diversity and linkage disequilibrium in loblolly pine, Proc. Natl. Acad. Sci. U.S.A. 101 (2004) 15255–15260. H.W. Wang, S. Ge, Phylogeography of the endangered Cathaya argyrophylla (Pinaceae) inferred from sequence variation of mitochondrial and nuclear DNA, Mol. Ecol. 15 (2006) 4109–4122. H. Ohyanagi, T. Tanaka, H. Sakai, Y. Shigemoto, K. Yamaguchi, T. Habara, Y. Fujii, B.A. Antonio, Y. Nagamura, T. Imanishi, K. Ikeo, T. Itoh, T. Gojobori, T. Sasaki, The rice annotation project database (RAP-DB): hub for Oryza sativa ssp. japonica genome information, Nucleic Acids Res. 34 (2006) D741–D744 (DATABASE ISSUE). X. Perrier, A. Flori, F. Bonnot, Data analysis methods, in: P. Hamon, M. Seguin, X. Perrier, J.C. Glaszmann (Eds.), Genetic Diversity of Cultivated Tropical Plants, Science Publishers Montpellier, Enfield, 2003, pp. 43–76. S. Bory, D. Da Silva, A.M. Risterucci, M. Grisoni, P. Besse, M.-F. Duval, Development of microsatellite markers in cultivated Vanilla: polymorphism and transferability to other Vanilla species, Sci. Hort. 115 (2008) 420–425. K.M. Cameron, Biogeography of Vanilloideae (Orchidaceae), in: XVI International Botanical Congress, St. Louis, Missouri, (1999), pp. 25–26. K.M. Cameron, Gondwanan biogeography of Vanilloideae (Orchidaceae), in: 3rd Southern Connection Congress Lincoln University, Canterbury, New Zealand, 17– 22 January 2000, (2000), p. 749.

[45] R. Porte`res, Le proble`me des migrations ve´ge´tales transpacifiques d’Asie en Ame´rique a` l’Epoque Tertiaire et la distribution des espe`ces de Vanilliers, Revue Internationale de Botanique Applique´e et d’Agriculture Tropicale (1951) 290–294. [46] G.M. Mitawa, W.Y.F. Marandu, Tanzania: country report to the FAO international technical conference on plant genetic resources (Leipzig 1996) 1996, pp. 80. [47] M.C. da Silva, S. Izidine, A.B. Amude, A preliminary checklist of the vascular plants of Mozambique, Southern African Botanical Diversity Network Report No. 30, 2004, pp. 183. [48] A.S. Combrink, R. Kyle, A handbook on the rare, threatened & endemic species of the greater St Lucia Wetland Park, A product of the Greater St Lucia Wetland Park Rare, Threatened & Endemic Species Project: St Lucia Greater Wetland Park Authority, 2006, pp. 191. [49] B.S. Carlsward, W.M. Whitten, N.H. Williams, B. Bytebier, Molecular phylogenetics of Vandeae (Orchidaceae) and the evolution of leaflessness, Am. J. Bot. 93 (2006) 770–786. [50] M. Divakaran, K. Nirmal Babu, P.N. Ravindran, K.V. Peter, Interspecific hybridization in vanilla and molecular characterization of hybrids and selfed progenies using RAPD and AFLP markers, Sci. Hort. 108 (2006) 414–422. [51] L.J. Lawler, Ethnobotany of the Orchidaceae, in: J. Arditti (Ed.), Orchid Biology: Reviews and Perspectives, Cornell University Press, Ithaca New York, 1984, pp. 52–62. [52] T. Lu¨bberstedt, I. Zein, J.R. Andersen, G. Wenzel, B. Kru¨tzfeldt, J. Eder, M. Ouzunova, S. Chun, Development and application of functional markers in maize, Euphytica 146 (2005) 101–108. [53] V. Me´chin, O. Argillier, Y. He´bert, E. Guingo, L. Moreau, A. Charcosset, Y. Barrie`re, Genetic analysis and QTL mapping of cell wall digestibility and lignification in silage maize, Crop Sci. 41 (2001) 690–697. [54] C. Campa, M. Noirot, M. Bourgeois, M. Pervent, C.L. Ky, H. Chrestin, S. Hamon, A. De Kochko, Genetic mapping of a caffeoyl-coenzymeA 3-O-methyltransferase gene in coffee trees. Impact on chlorogenic acid content, Theor. Appl. Genet. 107 (2003) 751–756. [55] V. Mahesh, J.J. Rakotomalala, L. Le Gal, H. Vigne, A. de Kochko, S. Hamon, M. Noirot, C. Campa, Isolation and genetic mapping of a Coffea canephoraphenylalanine ammonia-lyase gene (CcPAL1) and its involvement in the accumulation of caffeoyl quinic acids, Plant Cell Rep. 25 (2006) 986–992.