FEMS Pathogens and Disease, 73, 2015, ftv023 doi: 10.1093/femspd/ftv023 Advance Access Publication Date: 9 April 2015 Research Article
RESEARCH ARTICLE
Vaccination with non-toxic mutant toxic shock syndrome toxin-1 induces IL-17-dependent protection against Staphylococcus aureus infection Kouji Narita1,2 , Dong-Liang Hu1,3 , Krisana Asano1 and Akio Nakane1,∗ 1
Department of Microbiology and Immunology, Hirosaki University Graduate School of Medicine, Hirosaki, Aomori 036-8562, Japan, 2 Institute for Animal Experimentation, Hirosaki University Graduate School of Medicine, Hirosaki, Aomori 036-8562, Japan and 3 Laboratory of Zoonoses, Kitasato University School of Veterinary Medicine, Towada, Aomori 034-8628, Japan ∗ Corresponding author: Department of Microbiology and Immunology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, Aomori 036-8562, Japan. Tel: +81-172-39-5032; Fax: +81-172-39-5034; E-mail: [email protected] One sentence summary: Non-toxic mutant toxic shock syndrome toxin-1-vaccination establishes the IL-17A-dependent host defense against Staphylococcus aureus infection by promoting chemokine-mediated infiltration of phagocytes at infectious foci. Editor: Willem van Eden
ABSTRACT Toxic shock syndrome toxin–1 (TSST-1) is one of superantigens produced by Staphylococcus aureus. We have previously demonstrated that vaccination with non-toxic mutant TSST-1 (mTSST-1) develops host protection to lethal S. aureus infection in mice. However, the detailed mechanism underlying this protection is necessary to elucidate because the passive transfer of antibodies against TSST-1 fails to provide complete protection against S. aureus infection. In this study, the results showed that interleukin-17A (IL-17A)-producing cells were increased in the spleen cells of mTSST-1-vaccinated mice. The main source of IL-17A in mTSST-1-vaccinated mice was T-helper 17 (Th17) cells. The protective effect of vaccination was induced when the vaccinated wild type but not IL-17A-deficient mice were challenged with S. aureus. Gene expression of chemokines, CCL2 and CXCL1, and infiltration of neutrophils and macrophages were increased in spleens and livers of vaccinated mice after infection. The IL-17A-dependent immune response was TSST-1 specific because TSST-1-deficient S. aureus failed to induce the response. The present study suggests that mTSST-1 vaccination is able to provide the IL-17A-dependent host defense against S. aureus infection which promotes chemokine-mediated infiltration of phagocytes into the infectious foci. Keywords: Staphylococcus aureus; TSST-1; vaccination; Th17; chemokine
INTRODUCTION Staphylococcus aureus is a leading cause of human diseases in the hospital setting as well as in the community. The diseases caused by this bacterium can range from superficial skin infections to life-threatening conditions such as bacteraemia, endocarditis, pneumonia and toxic shock syndrome (TSS) (Lowy,
1998). Infections with S. aureus are especially difficult to treat because this bacterium has evolved resistance to antimicrobial drugs. The emergence of S. aureus strains that resist to methicillin (MRSA) and other antimicrobial agents has become a major concern. Especially in the hospital environment, systemic infection of MRSA causes a high mortality rate (Klein, Smith and Laxminarayan 2007). Toxic shock syndrome toxin-1 (TSST-1),
Received: 21 November 2014; Accepted: 24 March 2015 C FEMS 2015. All rights reserved. For permissions, please e-mail: [email protected]
1
2
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
a superantigen produced by pathogenic strains of S. aureus, is the causative agent in TSS which manifests as fever, rash, desquamation and hypotension (Rasheed et al. 1985). Superantigens including TSST-1 directly crosslink between MHC class II molecules on antigen-presenting cells and T cell receptors (TCRs) bearing specific Vβ elements and induce high levels of pro-inflammatory cytokine production (Choi et al. 1990). Several studies have demonstrated that a majority of MRSA strains isolated from hospitals in Japan carry the TSST-1-encoding gene (tst) (Piao et al. 2005; Zaraket et al. 2007; Hu et al. 2008). A mutant of TSST-1 (mTSST-1), which is generated by replacement of histidine with alanine at position 135, is non-toxic. It lacks superantigenic activity and toxicity in an animal model but still retains antigenicity to induce TSST-1-specific adaptive immunity (Bonventre et al. 1993; Bonventre et al. 1995). Active immunization with this mTSST-1 is able to protect animals from TSST-1-induced shock, and the TSST-1-neutralizing antibodies are implicated in the protective effect (Bonventre et al. 1995; Stiles, Krakauer and Bonventre 1995). Our previous study demonstrated that subcutaneous vaccination with mTSST-1 enhances bacterial clearance in spleens and livers of mice infected with a lethal dose of S. aureus (Hu et al. 2003). In addition, intranasal vaccination with mTSST-1 promotes the elimination of S. aureus from nasal cavities of mice (Narita et al. 2008). Although the passive immunization with anti-mTSST-1 antibodies is able to rescue mice from lethal S. aureus infection, it fails to provide the complete protection (Hu et al. 2003). Therefore, the protective effect on S. aureus infection by mTSST-1 vaccination cannot be explained solely by the neutralizing antibodies against TSST-1. CD4+ T cells are known to differentiate into one of several lineages of T-helper (Th) cells, including T-helper type 1 (Th1), Th2, Th17 and inducible regulatory T cell (Zhu, Yamane and Paul 2010). These Th cells are essential for host defense against microbial threats. Although aberrant regulation of Th17 cells is involved in the pathogenesis of multiple inflammatory and autoimmune disorders, it has been demonstrated that Th17 cells play a critical role in protection against bacterial infections mediated by interleukin-17 (IL-17) production (Ouyang, Kolls and Zheng 2008; Curtis and Way, 2009). Ye et al. (2001) demonstrated that IL-17 is important in host resistance against Klebsiella pneumoniae infection by promoting early recruitment of neutrophils and other inflammatory cells into the site of infection. Thereafter, the importance of IL-17 in host defense has been further clarified for a variety of bacterial infections. Recently, the role of IL-17 in host defense against S. aureus infection was extensively elucidated. IL-17 is implicated in protective immunity against cutaneous infection of S. aureus and S. aureus-induced arthritis (Cho et al. 2010; Henningsson et al. 2010). IL-17A that is produced during vaccination with recombinant N-terminus of the candidal Als3p adhesin is required for protective immunity against S. aureus and Candida albicans (Lin et al. 2009). We previously reported that IL-17A plays a critical role in neutrophil- and macrophage-mediated adaptive immunity against S. aureus infection when using clumping factor A (ClfA) as a vaccine (Narita et al. 2010). In this study, we investigated a cellular mechanism underlying the protective effect of mTSST-1 vaccination on S. aureus infection. We demonstrated that vaccination with mTSST-1 induced Th17-dependent adaptive immunity which is characterized by IL-17A-mediated neutrophil and macrophage infiltration into the infectious foci.
MATERIALS AND METHODS Animals C57BL/6 mice purchased from Clea Japan, Tokyo, Japan and IL17A-deficient mice on a C57BL/6 background (Nakae et al. 2002) were used in this study. Mice were maintained under specific pathogen-free conditions at the Institute for Animal Experimentation, Hirosaki University Graduate School of Medicine. All animal experiments were carried out in accordance with the Institutional Animal Care and Use Committees (IACUC)/ethics committee of Hirosaki University.
Expression and purification of mTSST-1 and recombinant TSST-1 (rTSST-1) Expression and purification of mTSST-1 and rTSST-1 were performed as described previously (Hu et al. 2003). Protein concentration of each sample was determined by Bradford assay (BioRad Laboratories, Hercules, CA). The endotoxin content in the purified materials was determined by Limulus amebocyte lysate assay (Cape Cod Inc., Falmouth, MA). The endotoxin concentrations in the rTSST-1 and mTSST-1 were less than 8.6 pg μg−1 .
Bacterial strains and culture condition Staphylococcus aureus strain 834, a clinical sepsis isolate (Nakane et al. 1995) and its derivative, TSST-1-deficient mutant (tst) were grown in tryptic soy broth (BD Diagnosis Systems, Sparks, MD) for 15 h. The bacterial cells were harvested by centrifugation, washed with sterile phosphate-buffered saline (PBS) and diluted with PBS to appropriate cell concentrations as determined by spectrophotometry at 550 nm.
Construction of tst Construction of tst was performed as described previously (Asano et al. 2014). Briefly, DNA fragment containing upstream and downstream region of the tst gene was separately amplified from genomic DNA of S. aureus 834 by PCR using the following primers: TSST-1 upstream forward: 5 -GAATTCGGTAGGACATTTAATTCTGG-3 and reverse: 5 GGTACCAAGCAAAGGGCTTACG-3 , downstream forward: 5 - GGTACCTACAATACTGAAAAACCACC-3 and reverse: 5 AAGCTTAAGTTGTGGTCAAACG-3 . Both PCR products were cloned into pAULA plasmid containing tetracycline resistant gene at EcoR1–Kpn1 and Kpn1–Hind3 site, respectively. The plasmid was then introduced into S. aureus strain 834 by electroporation. The transformants were cultured at nonpermissive temperature of growth to force the integration of plasmid into genomic DNA. Deletion of tst gene was selected from tetracycline-sensitive colonies. Deficiency of tst gene and TSST-1 production were confirmed by PCR and Western blotting, respectively.
Vaccination and S. aureus infection For vaccination, purified mTSST-1 was diluted in PBS and emulsified 1:1 in alum adjuvant (Pierce, Rockford, IL). Five- to-eightweek-old wild-type and IL-17A-deficient mice were subcutaneously injected with 200 μL of the emulsion containing 10 μg of mTSST-1 or PBS as a control on days 0, 14 and 28. To determine the survival rate after S. aureus infection, wild-type and
Narita et al.
IL-17A-deficient mice were infected with 1 × 108 CFU per mouse of S. aureus intravenously on day 7 after the final vaccination. Mice were monitored for 14 days for survival. To estimate bacterial number and cytokine expression in the organs, wild-type and IL-17A-deficient mice were challenged with 5 × 107 CFU per mouse of wild-type S. aureus or tst on day 7 after the final vaccination. Number of viable S. aureus in the organs was enumerated by preparing organ homogenates in PBS and plating 10-fold serial dilutions on tryptic soy agar (BD Diagnosis System). Colonies were counted after 24 h of incubation at 37◦ C.
Cell culture Spleens were collected from mice on day 7 after the final vaccination. Spleen cells were obtained by squeezing the spleen in RPMI 1640 medium (Nissui Pharmaceutical Co., Tokyo, Japan) and filtering the cells through stainless steel mesh (size, 100). Erythrocytes were lysed with 0.85% NH4 Cl. After washing 3 times with RPMI 1640 medium, the cells were suspended at the concentration of 2 × 106 cells mL−1 in RPMI 1640 medium supplemented with 10% fetal calf serum (JRH Biosciences, Lenexa, KS), 1% L-glutamine (Wako Pure Chemical Industries, Osaka, Japan), 100 U mL−1 of penicillin G and 100 μg mL−1 of streptomycin and were inoculated into a 24-well culture plate. For cytokine assays, the spleen cells were incubated at 37◦ C with 0.1 μg mL−1 of rTSST-1 or mTSST-1. The culture supernatants were collected 48 h later and stored at −80◦ C until the cytokine assays were performed.
Cytokine assays IFN-γ , IL-4 and IL-17A were quantified by double-sandwich enzyme-linked immunosorbent assay (ELISA). IFN-γ was quantified as described previously (Nakane et al. 1995). IL-4 and IL17A were quantified using IL-4 Mouse Antibody Pair (Invitrogen, Carlsbad, CA) and IL-17 ELISA Kit (Bender MedSystems GmbH, Vienna, Austria), respectively.
Intracellular cytokine staining and flow cytometric analysis Spleen cells were stimulated with 50 ng mL−1 of p-phorbol-12myristate-13-acetate (PMA) (Sigma-Aldrich, St. Louis, MO) and 1 μg mL−1 of ionomycin (Sigma-Aldrich) at 37◦ C and 2 h later, GolgiStop-containing monensin (BD Biosciences, San Jose, CA) was added. At 6 h of cell stimulation, cell surface was stained with fluorescein isothiocyanate (FITC)-conjugated anti-TCRγ δ monoclonal antibody (mAb) (GL3, eBioscience, San Diego, CA) or anti-TCRβ mAb (H57–597, eBioscience) for 30 min at 4◦ C. Then, intracellular staining was performed according to the manufacturer’s instructions. Briefly, 1 mL of Cytofix/Cytoperm solution (BD Biosciences) was added to a cell suspension with mild mixing, and then the cells were placed for 15 min at 4◦ C. The fixed cells were washed with 1 mL of BD Perm/Wash solution twice and were stained intracellularly with phycoerythrin-conjugated anti-mouse IL-17 mAb (TC11–18H10, BD Biosciences) for 30 min at 4◦ C. Populations of IL-17A-producing CD4+ T cells and IFN-γ producing CD4+ T cells were assessed using mouse Th1/Th17 Phenotyping Kit (BD Biosciences) according to the manufacturer’s instructions. For analysis of the F4/80+ macrophage population, spleens were collected after 24 h of S. aureus infection. Spleen cells were washed and stained with FITC-conjugated anti-mouse F4/80 mAb (CI:A3–1, BD Biosciences). The stained
3
cells were analyzed on a FACSAria (BD Biosciences). The data were analyzed using BD FACSDiva software (BD Biosciences).
Real-time quantitative RT-PCR Total RNA from cultured cells and mouse organs was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. First-strand cDNA synthesis was carried out using 1 μg total RNA, random primers (Takara, Shiga, Japan) and Moloney murine leukemia virus reverse transcriptase (Invitrogen). Gene expression levels were determined by quantitative real-time PCR analysis using the SYBR Green Supermix (BIORAD Laboratories). The primers and cycling conditions are listed in Table 1. The expression was analyzed as the relative expression compared to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Ikejima et al. 2005).
Histological and immunohistochemical analysis Spleen and liver tissues were fixed with 10% phosphate-buffered formalin, embedded in paraffin and sectioned at 4 μm. For immunohistochemistry, deparaffinized sections were immunostained by the avidin-biotin-peroxidase complex (ABC) method using a Vectastain ABC kit (Vector, Burlingame, CA). The sections were incubated with rat anti-mouse neutrophil mAb Ly-6G (diluted 1:20 Hycult Biotechnology Uden, Netherlands) or rat antimouse macrophage F4/80 mAb (diluted 1:100; Serotec Product Oxford, UK) overnight at 4◦ C. The color reaction was developed by the addition of diaminobenzidine and then the counterstaining was performed with hematoxylin. Macrophage density was determined by counting the F4/80-positive cells in 10 random high-power (×400) fields of each section.
Myeloperoxidase (MPO) assay MPO assay, an index of tissue neutrophil levels, was performed as described previously (Jeyaseelan et al. 2004). One unit of MPO activity is defined as the degradation of 1 mmol of peroxide per min, which gives a change in absorbance of 1.13 × 10−2 min−1 (Hobden et al. 1997).
Statistical analysis Data are expressed as median ± interquartile range. Statistical analyses were performed by Mann–Whitney U-test. For survival experiments, the Kaplan–Meier method was used to obtain survival fractions, and the significance was determined by a log rank test. P < 0.05 was considered significant.
RESULTS Vaccination with mTSST-1 induces IL-17A production in spleen cells Mice were subcutaneously vaccinated with mTSST-1 or PBS as a control on days 0, 14 and 28. The spleens were collected after 7 days of the final vaccination. The cells were stimulated with rTSST-1 or mTSST-1, and the production of Th1-, Th2and Th17-type cytokines was assessed. rTSST-1 induced a large amount of IFN-γ in the spleen cells of both vaccinated and nonvaccinated mice. In contrast, the IFN-γ production induced by mTSST-1 stimulation was low (Fig. 1). IL-4 production was detected in neither group of mice (data not shown). IL-17A production from the vaccinated mice was significantly augmented by stimulation with rTSST-1. Although the IL-17A production
4
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
Table 1. Primer sequences for specific oligonucleotide primer pairs. Primer pairsa IL-17A CXCL1 CXCL2 CCL2 GAPDH
a
F R F R F R F R F R
Sequence
PCR conditions
5 -GCTCCAGAAGGCCCTCAGA-3 5 -AGCTTTCCCTCCGCATTGA-3 5 - GGATTCACCTCAAGAACATCCAGAG -3 5 - CACCCTTCTACTAGCA CAGTGGTTG -3 5 -GAACAAAGGCAAGGCTAACTGA-3 5 -AACATAACAACATCTGGGCAAT-3 5 -ACTGAAGCCAGCTCTCTCTTCCTC-3 5 -TTCCTTCTTGGGGTCAGCACAGAC-3 5 -TGAAGGTCGGTGTGAACGGATTTGG-3 5 -ACGACATACTCAGCACCAGCATCAC-3
30 s, 94◦ C; 30 s, 60◦ C; 60 s, 72◦ C 60 s, 94◦ C; 120 s, 60◦ C; 180 s, 72◦ C 60 s, 94◦ C; 120 s, 60◦ C; 180 s, 72◦ C 60 s, 94◦ C; 120 s, 60◦ C; 180 s, 72◦ C
F, forward; R, reverse.
production were analyzed. The IL-17A-producing CD4+ T cell population was increased in the mTSST-1-vaccinated mice compared with that in the non-vaccinated mice. In contrast, the frequency of IFN-γ -producing CD4+ T cells was similar between both groups of mice (Fig. 2 and Fig. S1, Supporting Information). Next, the population of IL-17A-producing TCRαβ T cells and TCRγ δ T cells in the spleen cells was analyzed. IL-17A-producing TCRαβ cell population in the vaccinated mice was larger than that in the non-vaccinated mice. In contrast, the population of IL-17A-producing TCRγ δ cells was comparable between the vaccinated mice and the non-vaccinated mice (Fig. 2 and Fig. S1, Supporting Information). These results suggested that IL-17A was mainly produced by Th17 cells in the mTSST-1-vaccinated mice.
IL-17A is indispensable to the protective effect of mTSST-1 vaccination
Figure 1. Cytokine responses in the spleen cells of mice vaccinated with mTSST1. Mice were vaccinated with mTSST-1 + alum (open bar) or alum only (shaded bar). The spleen cells of both groups of mice were prepared after 7 days of the final vaccination and incubated with rTSST-1 or mTSST-1. Concentrations of IFN-γ and IL-17A in the culture supernatants were determined by ELISA. Data are expressed as the median ± interquartile range of a group of six to eight mice from two independent experiments. An asterisk represents a statistically significant difference from the non-vaccinated group at P < 0.05.
induced by mTSST-1 was lower than that by rTSST-1, this cytokine production from vaccinated mice was also augmented significantly (Fig. 1). These results suggested that IL-17Aproducing cells might be induced by vaccination with mTSST-1.
Th17 cells are increased by vaccination with mTSST-1 Although IL-17A is mainly produced by a CD4+ helper T cell subset known as Th17 cells, TCRγ δ cells which play a role in innate immunity are also an important source of IL-17A. Thus, we examined cellular sources of IL-17A induced by vaccination with mTSST-1. The spleen cells were prepared on day 7 after the final vaccination and stimulated with PMA and ionomycin. Then, their surface expression of CD4 and intracellular IL-17A
It has been reported that IL-17A plays an important role in protection from S. aureus infection. Hence, we investigated whether IL-17A is involved in the protective effect of vaccination with mTSST-1. Wild-type and IL-17A-deficient mice were vaccinated with mTSST-1 and challenged with 1 × 108 CFU of S. aureus on day 7 after the final vaccination, and their survival rates were monitored. Survival of the vaccinated wild-type mice was 50%, whereas the rate of vaccinated IL-17A-deficient mice was 8% on day 14 after challenge. All non-vaccinated wild-type mice died within 6 days, and all non-vaccinated IL-17A-deficient mice died within 8 days after infection (Fig. 3A). The bacterial number in the spleens and livers was determined on day 3 after infection with 5 × 107 CFU of S. aureus. The bacterial number in the organs of mTSST-1-vaccinated wild-type mice was significantly less than those in non-vaccinated wild-type animals. Similarly, the bacterial growth in the organs of mTSST-1-vaccinated wildtype mice decreased compared with vaccinated IL-17A-deficient mice. In contrast, bacterial counts in the mTSST-1-vaccinated IL17A-deficient mice were comparable to those of non-vaccinated mutant animals (Fig. 3B). Next, we used tst for infection to investigate whether the protective effect of mTSST-1 vaccination is elicited by TSST-1 produced during S. aureus infection. In the preliminary data, growth of tst in culture medium was similar to that of wild-type S. aureus and bacterial counts in the spleens, livers and kidneys of mice infected tst were comparable to those of mice infected with wild-type S. aureus in nonvaccinated mice (data not shown). When challenged with 5 × 107 CFU of tst, the bacterial elimination in the spleens and livers of the mTSST-1-vaccinated wild-type mice was not enhanced, compared with the non-vaccinated group (Fig. 3C). These
Narita et al.
5
Figure 2. Intracellular cytokine expression in CD4+ , TCRαβ and TCRγ δ T cells. Mice were vaccinated with mTSST-1 + alum (open bar) or alum only (shaded bar). The spleens of both groups of mice were collected after 7 days of the final vaccination. The spleen cells stimulated with PMA and ionomycin were stained for the indicated surface molecules and intracellular IL-17A or IFN-γ as described in the section ‘Materials and Methods’. Histograms indicate the frequency of CD4+ IL-17A+ , CD4+ IFNγ + , TCRαβ + IL-17A+ and TCRγ δ + IL-17A+ cells in the splenic lymphocytes. Each result represents a group of four to seven mice from two independent experiments. Data are expressed as the median ± interquartile range. An asterisk represents a statistically significant difference from the non-vaccinated group at P < 0.05.
results suggested that IL-17A, which is produced in the response to TSST-1, played a crucial role in the protective effect of mTSST1 vaccination.
IL-17A expression is upregulated in the organs of mTSST-1-vaccinated mice after S. aureus infection We investigated whether IL-17A mRNA expression is upregulated in mTSST-1-vaccinated mice after infection with S. aureus. mTSST-1-vaccinated and non-vaccinated mice were infected with S. aureus on day 7 after the final vaccination. IL-17A and IFN-γ mRNA expression in the spleens and livers of these mice was determined at 12 h after infection. IL-17A but not IFN-γ mRNA expression was increased in the spleens and livers of vaccinated mice, compared with the non-vaccinated mice (Fig. 4A). To investigate whether upregulated IL-17A mRNA expression is induced in the TSST-1-specific manner, IL-17A mRNA expression was estimated in mice infected with tst. tst failed to induce IL17 mRNA expression irrespective of vaccination (Fig. 4B). These results suggested that upregulated IL-17A mRNA expression was induced by TSST-1-specific immune response during S. aureus infection.
Chemokine expression is enhanced in the organs of mTSST-1-vaccinated mice after S. aureus infection It is well known that IL-17A promotes the expression of neutrophil- and monocyte-recruiting chemokines (Tekstra et al. 1999; Ye et al. 2001; Gaffen, 2008). Therefore, we investigated
whether IL-17A produced in mTSST-1-vaccinated mice induces mRNA expression of chemokines including CCL2, CXCL1 and CXCL2. The expression of CCL2, CXCL1 and CXCL2 mRNA was upregulated in the spleens (Fig. 5A) and CCL2 and CXCL1 mRNA expression was augmented in the livers (Fig. 5B) of vaccinated wild-type mice at 24 h post infection. To elucidate whether IL17A is required for the chemokine expression, chemokine responses in the vaccinated IL-17A-deficient mice were investigated. Increase of the chemokine mRNA expression was not observed under IL-17A deficiency (Fig. 5A and B).
Recruitment of phagocytes is enhanced in the organs of mTSST-1-vaccinated mice Histological analysis was carried out to evaluate recruitment of neutrophils and macrophages in the organs of mTSST-1vaccinated mice because CCL2, CXCL1 and CXCL2 elicit an effective recruitment of phagocytes (Molne, Verdrengh and Tarkowski 2000; Gaffen, 2008; Thurlow et al. 2011). The spleens and livers of mTSST-1-vaccinated and non-vaccinated mice were stained with anti-Ly6G antibody to assess infiltration of neutrophils at 24 h after S. aureus infection. In wild-type mice, the prominent neutrophil infiltration was shown in the spleens (Fig. S2A, Supporting Information) and livers (Fig. S2B, Supporting Information) of mTSST-1-vaccinated mice compared with that in the non-vaccinated mice. To assess neutrophil infiltration objectively, MPO assay as a quantitative assessment of neutrophil infiltration was performed. The activity in the organs of mTSST-1-vaccinated mice was higher than that in the
6
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
Figure 3. Defective protection from S. aureus infection in IL-17A-deficient mice vaccinated with mTSST-1. Wild-type and IL-17A-deficient mice were vaccinated with mTSST-1 + alum or alum only as described in the section ‘Materials and Methods’. These mice were infected with 1 × 108 CFU of S. aureus after 7 days of the final vaccination. (A) The deaths of mice were observed for 14 days after infection. Each result represents a group of 12 mice from three independent experiments. (B, C) The bacterial number in the spleens and livers of the vaccinated (open box) and the non-vaccinated mice (shaded box) was determined on day 3 after infection with 5 × 107 CFU of wild-type S. aureus (B) or tst (C). Each result represents a group of six mice from two independent experiments. Data are presented as box plots, with the boxes representing the interquartile range. The median value is represented by the line across each box. An asterisk represents a statistically significant difference between the indicated groups of mice at P < 0.05, ns: not significant.
non-vaccinated mice (Fig. 6A). To assess macrophage infiltration, the spleen cells of mTSST-1-vaccinated and nonvaccinated mice were stained with FITC-conjugated anti-F4/80 antibody and analyzed by flow cytometry. F4/80+ macrophages were increased in the spleens of mTSST-1-vaccinated mice (Fig. 6B). The enhancement of macrophage infiltration was also observed in the livers of mTSST-1-vaccinated mice by histological analyses (Fig. 6C and Fig. S2C, Supporting Information). In contrast, the enhanced recruitment of neutrophils and macrophages into the organs was not observed by mTSST1-vaccination in IL-17A-deficient mice (Fig. 6A and C). These results showed that mTSST-1 vaccination promoted IL-17Amediated recruitment of neutrophils and macrophages into the infectious foci, suggesting that mTSST-1-specific IL-17A production is crucial in host resistance against the challenge with S. aureus.
DISCUSSION Vaccination with mTSST-1 reportedly leads to the protection from TSST-1-mediated shock via TSST-1-neutralizing antibodies (Bonventre et al. 1995; Stiles, Krakauer and Bonventre 1995). We previously reported that subcutaneous vaccination as well as intranasal immunization with mTSST-1 improves survival rates and reduces bacterial counts in the spleens and livers of mice infected with a lethal dose of S. aureus (Hu et al. 2003; Narita et al. 2008). In the previous study, although the passive immunization with anti-mTSST-1 antibodies protects na¨ıve mice from lethal S. aureus infection, the protective effect of passive immunization is inferior to that of active immunization with mTSST-1 (Hu et al. 2003). The result evoked another possible mechanism that is involved in the protective effect of mTSST-1 vaccine. Therefore, we investigated this possibility in the identical condition as our previous report. Consequently, the present study demonstrated
Narita et al.
7
Figure 4. IL-17A expression in the spleens and livers of mTSST-1-vaccinated mice after S. aureus infection. The spleens and livers of the vaccinated (open bar) and the non-vaccinated (shaded bar) mice were collected at 12 h after infection. (A) IL-17A and IFN-γ mRNA expression were determined by real-time quantitative RTPCR. (B) The vaccinated and the non-vaccinated mice were infected with wild-type S. aureus or tst, and the spleens and livers were collected at 12 h after infection. IL-17A mRNA expression was determined by real-time quantitative RT-PCR. Data are expressed as the median ± interquartile range of a group of six mice from two independent experiments. An asterisk represents a statistically significant difference from the non-vaccinated group at P < 0.05.
Figure 5. Chemokine expression in the spleens and livers of mTSST-1-vaccinated wild-type mice after S. aureus infection. Wild-type or IL-17A-deficient mice were vaccinated with mTSST-1 + alum or alum only, and infected with S. aureus after 7 days of the final vaccination. The spleens and livers were collected at 24 h after infection. CCL2, CXCL1 and CXCL2 mRNA expression in the spleens (A) and livers (B) of the vaccinated (open bar) and the non-vaccinated (shaded bar) mice was determined by real-time quantitative RT-PCR. Each result represents a group of five to six mice from two independent experiments. Data are expressed as the median ± interquartile range. An asterisk represents a statistically significant difference from the non-vaccinated group at P < 0.05.
8
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
Figure 6. Infiltration of neutrophils and macrophages in the spleens and liver of mTSST-1-vaccinated mice. Wild-type and IL-17-deficient mice were vaccinated with mTSST-1 + alum or alum only, and infected with S. aureus after 7 days of the final vaccination. The organs were collected at 24 h after infection. (A) MPO activity in the spleens and livers of the vaccinated (open bar) and the non-vaccinated (shaded bar) mice was determined. Each result represents a group of five to six mice from two independent experiments. Data are expressed as the median ± interquartile range. An asterisk represents a statistically significant difference from the nonvaccinated group at P < 0.05. (B) The spleen cells from the wild-type mice were stained with anti-F4/80 mAb. F4/80+ cells were assessed by flow cytometry. Numbers in the upper-right side indicate the percentages of F4/80+ cells. The results shown are representative of at least two independent experiments. (C) Quantitative analysis of macrophages in the livers of the vaccinated (open bar) and the non-vaccinated (shaded bar) mice was carried out. Macrophage density was determined as described in the section ‘Materials and Methods’. Each result represents as the median ± interquartile range for 10 random fields of each section. An asterisk represents a statistically significant difference from the non-vaccinated group at P < 0.05.
that mTSST-1 vaccination induces IL-17A-dependent protection against S. aureus infection in addition to humoral immunity. Pathogen-activated antigen-presenting cells induce activation and differentiation of na¨ıve CD4+ T cells into Th cells including Th1, Th2 and Th17 cells. In this study, induction of IFNγ and IL-17 by rTSST-1 stimulation of spleen cells from both non-vaccinated and mTSST-1-vaccinated mice was due to its superantigenic activity. In contrast, mTSST-1 failed to induce these cytokines from the non-vaccinated mice. This may be due to lack of superantigenic activity of mTSST-1 (Hu et al. 2003). The same level of IFN-γ was induced by rTSST-1 in the nonvaccinated and mTSST-1-vaccinated mice, whereas IFN-γ production was not induced by mTSST-1 in either group, suggesting that mTSST-1-vaccination did not skew Th1 response. On the contrary, IL-17 production was significantly upregulated by rTSST-1 and mTSST-1 in the mTSST-1-vaccinated mice. These results suggest that mTSST-1 vaccination can induce Th17 response. IL-17A production was increased in CD4+ T and TCRβ + T cells in the spleen cells from mTSST-1-vaccinated mice compared with those of non-vaccinated animals. These results suggest that vaccination with mTSST-1 may induce differentiation of na¨ıve CD4+ T cells to Th17 cells and these Th17 cells are a main source for IL-17A production. In addition to Th17 cells, TCRγ δ T cells are known to be important cellular sources of IL-17 during bacterial infections (Dieli et al. 2003; Cho et al. 2010; Cheng et al. 2012). Murphy et al. (2014) recently reported that memory γ δ T cells, which had been induced in peritoneal cavities and mediastinal lymph nodes of mice by intraperitoneal infection with S. aureus, produces high levels of IL-17 and mediates an enhanced bacterial clearance upon reinfection with the bacterium. In our hands, TCRγ δ T
cells were not main IL-17A-producing cells in the mTSST-1vaccinated mice. IL-17 has been reported to be critical for host defense against S. aureus infection (Lin et al. 2009; Cho et al. 2010; Henningsson et al. 2010; Narita et al. 2010; Cheng et al. 2012; Murphy et al. 2014). Therefore, the role of IL-17A in the protection against S. aureus infection by mTSST-1 vaccination was investigated using IL-17A-deficient mice. Vaccination with mTSST-1 improved survival rate and reduced bacterial burden in the spleens and livers of mTSST-1-vaccinated wild-type mice, whereas the protective effect was not observed in IL-17A-deficient mice, suggesting that IL-17A plays a critical role in the protective effect of mTSST-1 vaccination. We investigated whether bacterial clearance in the organs is induced by antigen-specific immune response to TSST1 secreted by S. aureus during infection. Upregulation of IL-17A expression in the organs and the protection against S. aureus infection were not elicited when the vaccinated mice were infected with tst, suggesting that the protective effect of mTSST1 vaccination is dependent on TSST-1 produced during S. aureus infection. Our previous study demonstrated that vaccination with the fibrinogen-binding domain of ClfA induces IL-17A-producing cells and the IL-17A-mediated recruitment of neutrophils and macrophages into the infectious foci is critical in the protective effect on S. aureus infection (Narita et al. 2010). IL-17 induces the production of chemokines in the site of infection (Tekstra et al. 1999; Ye et al. 2001; Gaffen, 2008), and the produced chemokines elicit a recruitment of neutrophils and macrophages that are crucial for the elimination of S. aureus (Molne, Verdrengh and Tarkowski 2000; Gaffen, 2008; Thurlow et al. 2011). In this study, CCL2, CXCL1 and CXCL2 mRNA
Narita et al.
expression in the spleens and CCL2 and CXCL1 mRNA expression in the livers were upregulated, and infiltration of neutrophils and macrophages was enhanced in both organs of mTSST-1-vaccinated wild-type mice but not IL-17-deficient mice during S. aureus infection. These results indicate that IL-17A may upregulate chemokine mRNA expression and enhance recruitment of phagocytes into the infectious foci to resolve S. aureus infection. The IL-17-mediated protective effect should be achieved in the response to TSST-1 because it is likely that recognition of TSST-1 but not other pathogen-related antigens occurred in mTSST-1-vaccinated mice during S. aureus infection. In this study, we demonstrated that vaccination with mTSST1 induces Th17 cells and that IL-17A elicits the protective effect against S. aureus infection in mice. These findings would be useful for development of IL-17A-mediated new therapeutic and prophylactic strategy against infectious diseases.
SUPPLEMENTARY DATA Supplementary data are available at FEMSPD online.
FUNDING This study was supported by JSPS KAKENHI grant number 23390100 and grant for Hirosaki University Institutional Research. Conflict of interest. None declared.
REFERENCES Asano K, Asano Y, Ono HK, et al. Suppression of starvationinduced autophagy by recombinant toxic shock syndrome toxin-1 in epithelial cells. PLoS One 2014;9:e113018. Bonventre PF, Heeg H, Cullen C, et al. Toxicity of recombinant toxic shock syndrome toxin 1 and mutant toxins produced by Staphylococcus aureus in a rabbit infection model of toxic shock syndrome. Infect Immun 1993;61:793–9. Bonventre PF, Heeg H, Edwards CK, III, et al. A mutation at histidine residue 135 of toxic shock syndrome toxin yields an immunogenic protein with minimal toxicity. Infect Immun 1995;63:509–515. Cheng P, Liu T, Zhou WY, et al. Role of gamma-delta T cells in host response against Staphylococcus aureus-induced pneumonia. BMC Immunol 2012;13:38. Cho JS, Pietras EM, Garcia NC, et al. IL-17 is essential for host defense against cutaneous Staphylococcus aureus infection in mice. J Clin Invest 2010;120:1762–73. Choi Y, Lafferty JA, Clements JR, et al. Selective expansion of T cells expressing V beta 2 in toxic shock syndrome. J Exp Med 1990;172:981–4. Curtis MM, Way SS. Interleukin-17 in host defence against bacterial, mycobacterial and fungal pathogens. Immunology 2009;126:177–85. Dieli F, Ivanyi J, Marsh P, et al. Characterization of lung γ δ T cells following intranasal infection with Mycobacterium bovis bacillus Calmette-Guerin. J Immunol 2003;170:463–9. Gaffen SL. An overview of IL-17 function and signaling. Cytokine 2008;43:402–7. Henningsson L, Jirholt P, Lindholm C, et al. Interleukin-17A during local and systemic Staphylococcus aureus-induced arthritis in mice. Infect Immun 2010;78:3783–90.
9
Hobden JA, Masinick SA, Barrett RP, et al. Proinflammatory cytokine deficiency and pathogenesis of Pseudomonas aeruginosa keratitis in aged mice. Infect Immun 1997;65:2754–8. Hu D-L, Omoe K, Inoue F, et al. Comparative prevalence of superantigenic toxin genes in meticillin-resistant and meticillinsusceptible Staphylococcus aureus isolates. J Med Microbiol 2008;57:1106–12. Hu DL, Omoe K, Sasaki S, et al. Vaccination with non-toxic mutant toxic shock syndrome toxin 1 protects against Staphylococcus aureus infection. J Infect Dis 2003;188:743–52. Ikejima S, Sasaki S, Sashinami H, et al. Impairment of host resistance to Listeria monocytogenes infection in liver of db/db and ob/ob mice. Diabetes 2005;54:182–9. Jeyaseelan S, Chu HW, Young SK, et al. Transcriptional profiling of lipopolysaccharide-induced acute lung injury. Infect Immun 2004;72:7247–56. Klein E, Smith DL, Laxminarayan R. Hospitalizations and deaths caused by methicillin-resistant Staphylococcus aureus, United States, 1999–2005. Emerg Infect Dis 2007;13:1840–6. Lin L, Ibrahim AS, Xu X, et al. Th1-Th17 cells mediate protective adaptive immunity against Staphylococcus aureus and Candida albicans infection in mice. PLoS Pathog 2009;5:e1000703. Lowy FD. Staphylococcus aureus infections. New Engl J Med 1998;339:520–32. Molne L, Verdrengh M, Tarkowski A. Role of neutrophil leukocytes in cutaneous infection caused by Staphylococcus aureus. Infect Immun 2000;68:6162–7. Murphy AG, O’Keeffe KM, Lalor SJ, et al. Staphylococcus aureus infection of mice expands a population of memory γ δ T cells that are protective against subsequent infection. J Immunol 2014;192:3697–708. Nakae S, Komiyama Y, Nambu A, et al. Antigen-specific T cell sensitization is impaired in IL-17-deficient mice, causing suppression of allergic cellular and humoral responses. Immunity 2002;17:375–87. Nakane A, Okamoto M, Asano M, et al. Endogenous gamma interferon, tumor necrosis factor, and interleukin-6 in Staphylococcus aureus infection in mice. Infect Immun 1995;63:1165–72. Narita K, Hu DL, Mori F, et al. Role of interleukin-17A in cellmediated protection against Staphylococcus aureus infection in mice immunized with the fibrinogen-binding domain of clumping factor A. Infect Immun 2010;78:4234–42. Narita K, Hu DL, Tsuji T, et al. Intranasal immunization of mutant toxic shock syndrome toxin 1 elicits systemic and mucosal immune response against Staphylococcus aureus infection. FEMS Immunol Med Mic 2008;52:389–96. Ouyang W, Kolls JK, Zheng Y. The biological functions of T helper 17 cell effector cytokines in inflammation. Immunity 2008;28:454–67. Piao C, Karasawa T, Totsuka K, et al. Prospective surveillance of community-onset and healthcare-associated methicillinresistant Staphylococcus aureus isolated from a universityaffiliated hospital in Japan. Microbiol Immunol 2005;49:959–70. Rasheed JK, Arko RJ, Feeley JC, et al. Acquired ability of Staphylococcus aureus to produce toxic shock-associated protein and resulting illness in a rabbit model. Infect Immun 1985;47:598– 604. Stiles BG, Krakauer T, Bonventre PF. Biological activity of toxic shock syndrome toxin 1 and a site-directed mutant, H135A, in a lipopolysaccharide-potentiated mouse lethality model. Infect Immun 1995;63:1229–34. Tekstra J, Beekhuizen H, Van De Gevel JS, et al. Infection of human endothelial cells with Staphylococcus aureus induces the
10
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
production of monocyte chemotactic protein-1 (MCP-1) and monocyte chemotaxis. Clin Exp Immunol 1999;117:489–95. Thurlow LR, Hanke ML, Fritz T, et al. Staphylococcus aureus biofilms prevent macrophage phagocytosis and attenuate inflammation in vivo. J Immunol 2011;186:6585–96. Ye P, Rodriguez FH, Kanaly S, et al. Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression,
neutrophil recruitment, and host defense. J Exp Med 2001;194:519–27. Zaraket H, Otsuka T, Saito K, et al. Molecular characterization of methicillin-resistant Staphylococcus aureus in hospitals in Niigata, Japan: divergence and transmission. Microbiol Immunol 2007;51:171–6. Zhu J, Yamane H, Paul WE. Differentiation of effector CD4 T cell populations. Annu Rev Immunol 2010;28:445–89.
RESEARCH ARTICLE
Vaccination with non-toxic mutant toxic shock syndrome toxin-1 induces IL-17-dependent protection against Staphylococcus aureus infection Kouji Narita1,2 , Dong-Liang Hu1,3 , Krisana Asano1 and Akio Nakane1,∗ 1
Department of Microbiology and Immunology, Hirosaki University Graduate School of Medicine, Hirosaki, Aomori 036-8562, Japan, 2 Institute for Animal Experimentation, Hirosaki University Graduate School of Medicine, Hirosaki, Aomori 036-8562, Japan and 3 Laboratory of Zoonoses, Kitasato University School of Veterinary Medicine, Towada, Aomori 034-8628, Japan ∗ Corresponding author: Department of Microbiology and Immunology, Hirosaki University Graduate School of Medicine, 5 Zaifu-cho, Hirosaki, Aomori 036-8562, Japan. Tel: +81-172-39-5032; Fax: +81-172-39-5034; E-mail: [email protected] One sentence summary: Non-toxic mutant toxic shock syndrome toxin-1-vaccination establishes the IL-17A-dependent host defense against Staphylococcus aureus infection by promoting chemokine-mediated infiltration of phagocytes at infectious foci. Editor: Willem van Eden
ABSTRACT Toxic shock syndrome toxin–1 (TSST-1) is one of superantigens produced by Staphylococcus aureus. We have previously demonstrated that vaccination with non-toxic mutant TSST-1 (mTSST-1) develops host protection to lethal S. aureus infection in mice. However, the detailed mechanism underlying this protection is necessary to elucidate because the passive transfer of antibodies against TSST-1 fails to provide complete protection against S. aureus infection. In this study, the results showed that interleukin-17A (IL-17A)-producing cells were increased in the spleen cells of mTSST-1-vaccinated mice. The main source of IL-17A in mTSST-1-vaccinated mice was T-helper 17 (Th17) cells. The protective effect of vaccination was induced when the vaccinated wild type but not IL-17A-deficient mice were challenged with S. aureus. Gene expression of chemokines, CCL2 and CXCL1, and infiltration of neutrophils and macrophages were increased in spleens and livers of vaccinated mice after infection. The IL-17A-dependent immune response was TSST-1 specific because TSST-1-deficient S. aureus failed to induce the response. The present study suggests that mTSST-1 vaccination is able to provide the IL-17A-dependent host defense against S. aureus infection which promotes chemokine-mediated infiltration of phagocytes into the infectious foci. Keywords: Staphylococcus aureus; TSST-1; vaccination; Th17; chemokine
INTRODUCTION Staphylococcus aureus is a leading cause of human diseases in the hospital setting as well as in the community. The diseases caused by this bacterium can range from superficial skin infections to life-threatening conditions such as bacteraemia, endocarditis, pneumonia and toxic shock syndrome (TSS) (Lowy,
1998). Infections with S. aureus are especially difficult to treat because this bacterium has evolved resistance to antimicrobial drugs. The emergence of S. aureus strains that resist to methicillin (MRSA) and other antimicrobial agents has become a major concern. Especially in the hospital environment, systemic infection of MRSA causes a high mortality rate (Klein, Smith and Laxminarayan 2007). Toxic shock syndrome toxin-1 (TSST-1),
Received: 21 November 2014; Accepted: 24 March 2015 C FEMS 2015. All rights reserved. For permissions, please e-mail: [email protected]
1
2
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
a superantigen produced by pathogenic strains of S. aureus, is the causative agent in TSS which manifests as fever, rash, desquamation and hypotension (Rasheed et al. 1985). Superantigens including TSST-1 directly crosslink between MHC class II molecules on antigen-presenting cells and T cell receptors (TCRs) bearing specific Vβ elements and induce high levels of pro-inflammatory cytokine production (Choi et al. 1990). Several studies have demonstrated that a majority of MRSA strains isolated from hospitals in Japan carry the TSST-1-encoding gene (tst) (Piao et al. 2005; Zaraket et al. 2007; Hu et al. 2008). A mutant of TSST-1 (mTSST-1), which is generated by replacement of histidine with alanine at position 135, is non-toxic. It lacks superantigenic activity and toxicity in an animal model but still retains antigenicity to induce TSST-1-specific adaptive immunity (Bonventre et al. 1993; Bonventre et al. 1995). Active immunization with this mTSST-1 is able to protect animals from TSST-1-induced shock, and the TSST-1-neutralizing antibodies are implicated in the protective effect (Bonventre et al. 1995; Stiles, Krakauer and Bonventre 1995). Our previous study demonstrated that subcutaneous vaccination with mTSST-1 enhances bacterial clearance in spleens and livers of mice infected with a lethal dose of S. aureus (Hu et al. 2003). In addition, intranasal vaccination with mTSST-1 promotes the elimination of S. aureus from nasal cavities of mice (Narita et al. 2008). Although the passive immunization with anti-mTSST-1 antibodies is able to rescue mice from lethal S. aureus infection, it fails to provide the complete protection (Hu et al. 2003). Therefore, the protective effect on S. aureus infection by mTSST-1 vaccination cannot be explained solely by the neutralizing antibodies against TSST-1. CD4+ T cells are known to differentiate into one of several lineages of T-helper (Th) cells, including T-helper type 1 (Th1), Th2, Th17 and inducible regulatory T cell (Zhu, Yamane and Paul 2010). These Th cells are essential for host defense against microbial threats. Although aberrant regulation of Th17 cells is involved in the pathogenesis of multiple inflammatory and autoimmune disorders, it has been demonstrated that Th17 cells play a critical role in protection against bacterial infections mediated by interleukin-17 (IL-17) production (Ouyang, Kolls and Zheng 2008; Curtis and Way, 2009). Ye et al. (2001) demonstrated that IL-17 is important in host resistance against Klebsiella pneumoniae infection by promoting early recruitment of neutrophils and other inflammatory cells into the site of infection. Thereafter, the importance of IL-17 in host defense has been further clarified for a variety of bacterial infections. Recently, the role of IL-17 in host defense against S. aureus infection was extensively elucidated. IL-17 is implicated in protective immunity against cutaneous infection of S. aureus and S. aureus-induced arthritis (Cho et al. 2010; Henningsson et al. 2010). IL-17A that is produced during vaccination with recombinant N-terminus of the candidal Als3p adhesin is required for protective immunity against S. aureus and Candida albicans (Lin et al. 2009). We previously reported that IL-17A plays a critical role in neutrophil- and macrophage-mediated adaptive immunity against S. aureus infection when using clumping factor A (ClfA) as a vaccine (Narita et al. 2010). In this study, we investigated a cellular mechanism underlying the protective effect of mTSST-1 vaccination on S. aureus infection. We demonstrated that vaccination with mTSST-1 induced Th17-dependent adaptive immunity which is characterized by IL-17A-mediated neutrophil and macrophage infiltration into the infectious foci.
MATERIALS AND METHODS Animals C57BL/6 mice purchased from Clea Japan, Tokyo, Japan and IL17A-deficient mice on a C57BL/6 background (Nakae et al. 2002) were used in this study. Mice were maintained under specific pathogen-free conditions at the Institute for Animal Experimentation, Hirosaki University Graduate School of Medicine. All animal experiments were carried out in accordance with the Institutional Animal Care and Use Committees (IACUC)/ethics committee of Hirosaki University.
Expression and purification of mTSST-1 and recombinant TSST-1 (rTSST-1) Expression and purification of mTSST-1 and rTSST-1 were performed as described previously (Hu et al. 2003). Protein concentration of each sample was determined by Bradford assay (BioRad Laboratories, Hercules, CA). The endotoxin content in the purified materials was determined by Limulus amebocyte lysate assay (Cape Cod Inc., Falmouth, MA). The endotoxin concentrations in the rTSST-1 and mTSST-1 were less than 8.6 pg μg−1 .
Bacterial strains and culture condition Staphylococcus aureus strain 834, a clinical sepsis isolate (Nakane et al. 1995) and its derivative, TSST-1-deficient mutant (tst) were grown in tryptic soy broth (BD Diagnosis Systems, Sparks, MD) for 15 h. The bacterial cells were harvested by centrifugation, washed with sterile phosphate-buffered saline (PBS) and diluted with PBS to appropriate cell concentrations as determined by spectrophotometry at 550 nm.
Construction of tst Construction of tst was performed as described previously (Asano et al. 2014). Briefly, DNA fragment containing upstream and downstream region of the tst gene was separately amplified from genomic DNA of S. aureus 834 by PCR using the following primers: TSST-1 upstream forward: 5 -GAATTCGGTAGGACATTTAATTCTGG-3 and reverse: 5 GGTACCAAGCAAAGGGCTTACG-3 , downstream forward: 5 - GGTACCTACAATACTGAAAAACCACC-3 and reverse: 5 AAGCTTAAGTTGTGGTCAAACG-3 . Both PCR products were cloned into pAULA plasmid containing tetracycline resistant gene at EcoR1–Kpn1 and Kpn1–Hind3 site, respectively. The plasmid was then introduced into S. aureus strain 834 by electroporation. The transformants were cultured at nonpermissive temperature of growth to force the integration of plasmid into genomic DNA. Deletion of tst gene was selected from tetracycline-sensitive colonies. Deficiency of tst gene and TSST-1 production were confirmed by PCR and Western blotting, respectively.
Vaccination and S. aureus infection For vaccination, purified mTSST-1 was diluted in PBS and emulsified 1:1 in alum adjuvant (Pierce, Rockford, IL). Five- to-eightweek-old wild-type and IL-17A-deficient mice were subcutaneously injected with 200 μL of the emulsion containing 10 μg of mTSST-1 or PBS as a control on days 0, 14 and 28. To determine the survival rate after S. aureus infection, wild-type and
Narita et al.
IL-17A-deficient mice were infected with 1 × 108 CFU per mouse of S. aureus intravenously on day 7 after the final vaccination. Mice were monitored for 14 days for survival. To estimate bacterial number and cytokine expression in the organs, wild-type and IL-17A-deficient mice were challenged with 5 × 107 CFU per mouse of wild-type S. aureus or tst on day 7 after the final vaccination. Number of viable S. aureus in the organs was enumerated by preparing organ homogenates in PBS and plating 10-fold serial dilutions on tryptic soy agar (BD Diagnosis System). Colonies were counted after 24 h of incubation at 37◦ C.
Cell culture Spleens were collected from mice on day 7 after the final vaccination. Spleen cells were obtained by squeezing the spleen in RPMI 1640 medium (Nissui Pharmaceutical Co., Tokyo, Japan) and filtering the cells through stainless steel mesh (size, 100). Erythrocytes were lysed with 0.85% NH4 Cl. After washing 3 times with RPMI 1640 medium, the cells were suspended at the concentration of 2 × 106 cells mL−1 in RPMI 1640 medium supplemented with 10% fetal calf serum (JRH Biosciences, Lenexa, KS), 1% L-glutamine (Wako Pure Chemical Industries, Osaka, Japan), 100 U mL−1 of penicillin G and 100 μg mL−1 of streptomycin and were inoculated into a 24-well culture plate. For cytokine assays, the spleen cells were incubated at 37◦ C with 0.1 μg mL−1 of rTSST-1 or mTSST-1. The culture supernatants were collected 48 h later and stored at −80◦ C until the cytokine assays were performed.
Cytokine assays IFN-γ , IL-4 and IL-17A were quantified by double-sandwich enzyme-linked immunosorbent assay (ELISA). IFN-γ was quantified as described previously (Nakane et al. 1995). IL-4 and IL17A were quantified using IL-4 Mouse Antibody Pair (Invitrogen, Carlsbad, CA) and IL-17 ELISA Kit (Bender MedSystems GmbH, Vienna, Austria), respectively.
Intracellular cytokine staining and flow cytometric analysis Spleen cells were stimulated with 50 ng mL−1 of p-phorbol-12myristate-13-acetate (PMA) (Sigma-Aldrich, St. Louis, MO) and 1 μg mL−1 of ionomycin (Sigma-Aldrich) at 37◦ C and 2 h later, GolgiStop-containing monensin (BD Biosciences, San Jose, CA) was added. At 6 h of cell stimulation, cell surface was stained with fluorescein isothiocyanate (FITC)-conjugated anti-TCRγ δ monoclonal antibody (mAb) (GL3, eBioscience, San Diego, CA) or anti-TCRβ mAb (H57–597, eBioscience) for 30 min at 4◦ C. Then, intracellular staining was performed according to the manufacturer’s instructions. Briefly, 1 mL of Cytofix/Cytoperm solution (BD Biosciences) was added to a cell suspension with mild mixing, and then the cells were placed for 15 min at 4◦ C. The fixed cells were washed with 1 mL of BD Perm/Wash solution twice and were stained intracellularly with phycoerythrin-conjugated anti-mouse IL-17 mAb (TC11–18H10, BD Biosciences) for 30 min at 4◦ C. Populations of IL-17A-producing CD4+ T cells and IFN-γ producing CD4+ T cells were assessed using mouse Th1/Th17 Phenotyping Kit (BD Biosciences) according to the manufacturer’s instructions. For analysis of the F4/80+ macrophage population, spleens were collected after 24 h of S. aureus infection. Spleen cells were washed and stained with FITC-conjugated anti-mouse F4/80 mAb (CI:A3–1, BD Biosciences). The stained
3
cells were analyzed on a FACSAria (BD Biosciences). The data were analyzed using BD FACSDiva software (BD Biosciences).
Real-time quantitative RT-PCR Total RNA from cultured cells and mouse organs was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. First-strand cDNA synthesis was carried out using 1 μg total RNA, random primers (Takara, Shiga, Japan) and Moloney murine leukemia virus reverse transcriptase (Invitrogen). Gene expression levels were determined by quantitative real-time PCR analysis using the SYBR Green Supermix (BIORAD Laboratories). The primers and cycling conditions are listed in Table 1. The expression was analyzed as the relative expression compared to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Ikejima et al. 2005).
Histological and immunohistochemical analysis Spleen and liver tissues were fixed with 10% phosphate-buffered formalin, embedded in paraffin and sectioned at 4 μm. For immunohistochemistry, deparaffinized sections were immunostained by the avidin-biotin-peroxidase complex (ABC) method using a Vectastain ABC kit (Vector, Burlingame, CA). The sections were incubated with rat anti-mouse neutrophil mAb Ly-6G (diluted 1:20 Hycult Biotechnology Uden, Netherlands) or rat antimouse macrophage F4/80 mAb (diluted 1:100; Serotec Product Oxford, UK) overnight at 4◦ C. The color reaction was developed by the addition of diaminobenzidine and then the counterstaining was performed with hematoxylin. Macrophage density was determined by counting the F4/80-positive cells in 10 random high-power (×400) fields of each section.
Myeloperoxidase (MPO) assay MPO assay, an index of tissue neutrophil levels, was performed as described previously (Jeyaseelan et al. 2004). One unit of MPO activity is defined as the degradation of 1 mmol of peroxide per min, which gives a change in absorbance of 1.13 × 10−2 min−1 (Hobden et al. 1997).
Statistical analysis Data are expressed as median ± interquartile range. Statistical analyses were performed by Mann–Whitney U-test. For survival experiments, the Kaplan–Meier method was used to obtain survival fractions, and the significance was determined by a log rank test. P < 0.05 was considered significant.
RESULTS Vaccination with mTSST-1 induces IL-17A production in spleen cells Mice were subcutaneously vaccinated with mTSST-1 or PBS as a control on days 0, 14 and 28. The spleens were collected after 7 days of the final vaccination. The cells were stimulated with rTSST-1 or mTSST-1, and the production of Th1-, Th2and Th17-type cytokines was assessed. rTSST-1 induced a large amount of IFN-γ in the spleen cells of both vaccinated and nonvaccinated mice. In contrast, the IFN-γ production induced by mTSST-1 stimulation was low (Fig. 1). IL-4 production was detected in neither group of mice (data not shown). IL-17A production from the vaccinated mice was significantly augmented by stimulation with rTSST-1. Although the IL-17A production
4
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
Table 1. Primer sequences for specific oligonucleotide primer pairs. Primer pairsa IL-17A CXCL1 CXCL2 CCL2 GAPDH
a
F R F R F R F R F R
Sequence
PCR conditions
5 -GCTCCAGAAGGCCCTCAGA-3 5 -AGCTTTCCCTCCGCATTGA-3 5 - GGATTCACCTCAAGAACATCCAGAG -3 5 - CACCCTTCTACTAGCA CAGTGGTTG -3 5 -GAACAAAGGCAAGGCTAACTGA-3 5 -AACATAACAACATCTGGGCAAT-3 5 -ACTGAAGCCAGCTCTCTCTTCCTC-3 5 -TTCCTTCTTGGGGTCAGCACAGAC-3 5 -TGAAGGTCGGTGTGAACGGATTTGG-3 5 -ACGACATACTCAGCACCAGCATCAC-3
30 s, 94◦ C; 30 s, 60◦ C; 60 s, 72◦ C 60 s, 94◦ C; 120 s, 60◦ C; 180 s, 72◦ C 60 s, 94◦ C; 120 s, 60◦ C; 180 s, 72◦ C 60 s, 94◦ C; 120 s, 60◦ C; 180 s, 72◦ C
F, forward; R, reverse.
production were analyzed. The IL-17A-producing CD4+ T cell population was increased in the mTSST-1-vaccinated mice compared with that in the non-vaccinated mice. In contrast, the frequency of IFN-γ -producing CD4+ T cells was similar between both groups of mice (Fig. 2 and Fig. S1, Supporting Information). Next, the population of IL-17A-producing TCRαβ T cells and TCRγ δ T cells in the spleen cells was analyzed. IL-17A-producing TCRαβ cell population in the vaccinated mice was larger than that in the non-vaccinated mice. In contrast, the population of IL-17A-producing TCRγ δ cells was comparable between the vaccinated mice and the non-vaccinated mice (Fig. 2 and Fig. S1, Supporting Information). These results suggested that IL-17A was mainly produced by Th17 cells in the mTSST-1-vaccinated mice.
IL-17A is indispensable to the protective effect of mTSST-1 vaccination
Figure 1. Cytokine responses in the spleen cells of mice vaccinated with mTSST1. Mice were vaccinated with mTSST-1 + alum (open bar) or alum only (shaded bar). The spleen cells of both groups of mice were prepared after 7 days of the final vaccination and incubated with rTSST-1 or mTSST-1. Concentrations of IFN-γ and IL-17A in the culture supernatants were determined by ELISA. Data are expressed as the median ± interquartile range of a group of six to eight mice from two independent experiments. An asterisk represents a statistically significant difference from the non-vaccinated group at P < 0.05.
induced by mTSST-1 was lower than that by rTSST-1, this cytokine production from vaccinated mice was also augmented significantly (Fig. 1). These results suggested that IL-17Aproducing cells might be induced by vaccination with mTSST-1.
Th17 cells are increased by vaccination with mTSST-1 Although IL-17A is mainly produced by a CD4+ helper T cell subset known as Th17 cells, TCRγ δ cells which play a role in innate immunity are also an important source of IL-17A. Thus, we examined cellular sources of IL-17A induced by vaccination with mTSST-1. The spleen cells were prepared on day 7 after the final vaccination and stimulated with PMA and ionomycin. Then, their surface expression of CD4 and intracellular IL-17A
It has been reported that IL-17A plays an important role in protection from S. aureus infection. Hence, we investigated whether IL-17A is involved in the protective effect of vaccination with mTSST-1. Wild-type and IL-17A-deficient mice were vaccinated with mTSST-1 and challenged with 1 × 108 CFU of S. aureus on day 7 after the final vaccination, and their survival rates were monitored. Survival of the vaccinated wild-type mice was 50%, whereas the rate of vaccinated IL-17A-deficient mice was 8% on day 14 after challenge. All non-vaccinated wild-type mice died within 6 days, and all non-vaccinated IL-17A-deficient mice died within 8 days after infection (Fig. 3A). The bacterial number in the spleens and livers was determined on day 3 after infection with 5 × 107 CFU of S. aureus. The bacterial number in the organs of mTSST-1-vaccinated wild-type mice was significantly less than those in non-vaccinated wild-type animals. Similarly, the bacterial growth in the organs of mTSST-1-vaccinated wildtype mice decreased compared with vaccinated IL-17A-deficient mice. In contrast, bacterial counts in the mTSST-1-vaccinated IL17A-deficient mice were comparable to those of non-vaccinated mutant animals (Fig. 3B). Next, we used tst for infection to investigate whether the protective effect of mTSST-1 vaccination is elicited by TSST-1 produced during S. aureus infection. In the preliminary data, growth of tst in culture medium was similar to that of wild-type S. aureus and bacterial counts in the spleens, livers and kidneys of mice infected tst were comparable to those of mice infected with wild-type S. aureus in nonvaccinated mice (data not shown). When challenged with 5 × 107 CFU of tst, the bacterial elimination in the spleens and livers of the mTSST-1-vaccinated wild-type mice was not enhanced, compared with the non-vaccinated group (Fig. 3C). These
Narita et al.
5
Figure 2. Intracellular cytokine expression in CD4+ , TCRαβ and TCRγ δ T cells. Mice were vaccinated with mTSST-1 + alum (open bar) or alum only (shaded bar). The spleens of both groups of mice were collected after 7 days of the final vaccination. The spleen cells stimulated with PMA and ionomycin were stained for the indicated surface molecules and intracellular IL-17A or IFN-γ as described in the section ‘Materials and Methods’. Histograms indicate the frequency of CD4+ IL-17A+ , CD4+ IFNγ + , TCRαβ + IL-17A+ and TCRγ δ + IL-17A+ cells in the splenic lymphocytes. Each result represents a group of four to seven mice from two independent experiments. Data are expressed as the median ± interquartile range. An asterisk represents a statistically significant difference from the non-vaccinated group at P < 0.05.
results suggested that IL-17A, which is produced in the response to TSST-1, played a crucial role in the protective effect of mTSST1 vaccination.
IL-17A expression is upregulated in the organs of mTSST-1-vaccinated mice after S. aureus infection We investigated whether IL-17A mRNA expression is upregulated in mTSST-1-vaccinated mice after infection with S. aureus. mTSST-1-vaccinated and non-vaccinated mice were infected with S. aureus on day 7 after the final vaccination. IL-17A and IFN-γ mRNA expression in the spleens and livers of these mice was determined at 12 h after infection. IL-17A but not IFN-γ mRNA expression was increased in the spleens and livers of vaccinated mice, compared with the non-vaccinated mice (Fig. 4A). To investigate whether upregulated IL-17A mRNA expression is induced in the TSST-1-specific manner, IL-17A mRNA expression was estimated in mice infected with tst. tst failed to induce IL17 mRNA expression irrespective of vaccination (Fig. 4B). These results suggested that upregulated IL-17A mRNA expression was induced by TSST-1-specific immune response during S. aureus infection.
Chemokine expression is enhanced in the organs of mTSST-1-vaccinated mice after S. aureus infection It is well known that IL-17A promotes the expression of neutrophil- and monocyte-recruiting chemokines (Tekstra et al. 1999; Ye et al. 2001; Gaffen, 2008). Therefore, we investigated
whether IL-17A produced in mTSST-1-vaccinated mice induces mRNA expression of chemokines including CCL2, CXCL1 and CXCL2. The expression of CCL2, CXCL1 and CXCL2 mRNA was upregulated in the spleens (Fig. 5A) and CCL2 and CXCL1 mRNA expression was augmented in the livers (Fig. 5B) of vaccinated wild-type mice at 24 h post infection. To elucidate whether IL17A is required for the chemokine expression, chemokine responses in the vaccinated IL-17A-deficient mice were investigated. Increase of the chemokine mRNA expression was not observed under IL-17A deficiency (Fig. 5A and B).
Recruitment of phagocytes is enhanced in the organs of mTSST-1-vaccinated mice Histological analysis was carried out to evaluate recruitment of neutrophils and macrophages in the organs of mTSST-1vaccinated mice because CCL2, CXCL1 and CXCL2 elicit an effective recruitment of phagocytes (Molne, Verdrengh and Tarkowski 2000; Gaffen, 2008; Thurlow et al. 2011). The spleens and livers of mTSST-1-vaccinated and non-vaccinated mice were stained with anti-Ly6G antibody to assess infiltration of neutrophils at 24 h after S. aureus infection. In wild-type mice, the prominent neutrophil infiltration was shown in the spleens (Fig. S2A, Supporting Information) and livers (Fig. S2B, Supporting Information) of mTSST-1-vaccinated mice compared with that in the non-vaccinated mice. To assess neutrophil infiltration objectively, MPO assay as a quantitative assessment of neutrophil infiltration was performed. The activity in the organs of mTSST-1-vaccinated mice was higher than that in the
6
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
Figure 3. Defective protection from S. aureus infection in IL-17A-deficient mice vaccinated with mTSST-1. Wild-type and IL-17A-deficient mice were vaccinated with mTSST-1 + alum or alum only as described in the section ‘Materials and Methods’. These mice were infected with 1 × 108 CFU of S. aureus after 7 days of the final vaccination. (A) The deaths of mice were observed for 14 days after infection. Each result represents a group of 12 mice from three independent experiments. (B, C) The bacterial number in the spleens and livers of the vaccinated (open box) and the non-vaccinated mice (shaded box) was determined on day 3 after infection with 5 × 107 CFU of wild-type S. aureus (B) or tst (C). Each result represents a group of six mice from two independent experiments. Data are presented as box plots, with the boxes representing the interquartile range. The median value is represented by the line across each box. An asterisk represents a statistically significant difference between the indicated groups of mice at P < 0.05, ns: not significant.
non-vaccinated mice (Fig. 6A). To assess macrophage infiltration, the spleen cells of mTSST-1-vaccinated and nonvaccinated mice were stained with FITC-conjugated anti-F4/80 antibody and analyzed by flow cytometry. F4/80+ macrophages were increased in the spleens of mTSST-1-vaccinated mice (Fig. 6B). The enhancement of macrophage infiltration was also observed in the livers of mTSST-1-vaccinated mice by histological analyses (Fig. 6C and Fig. S2C, Supporting Information). In contrast, the enhanced recruitment of neutrophils and macrophages into the organs was not observed by mTSST1-vaccination in IL-17A-deficient mice (Fig. 6A and C). These results showed that mTSST-1 vaccination promoted IL-17Amediated recruitment of neutrophils and macrophages into the infectious foci, suggesting that mTSST-1-specific IL-17A production is crucial in host resistance against the challenge with S. aureus.
DISCUSSION Vaccination with mTSST-1 reportedly leads to the protection from TSST-1-mediated shock via TSST-1-neutralizing antibodies (Bonventre et al. 1995; Stiles, Krakauer and Bonventre 1995). We previously reported that subcutaneous vaccination as well as intranasal immunization with mTSST-1 improves survival rates and reduces bacterial counts in the spleens and livers of mice infected with a lethal dose of S. aureus (Hu et al. 2003; Narita et al. 2008). In the previous study, although the passive immunization with anti-mTSST-1 antibodies protects na¨ıve mice from lethal S. aureus infection, the protective effect of passive immunization is inferior to that of active immunization with mTSST-1 (Hu et al. 2003). The result evoked another possible mechanism that is involved in the protective effect of mTSST-1 vaccine. Therefore, we investigated this possibility in the identical condition as our previous report. Consequently, the present study demonstrated
Narita et al.
7
Figure 4. IL-17A expression in the spleens and livers of mTSST-1-vaccinated mice after S. aureus infection. The spleens and livers of the vaccinated (open bar) and the non-vaccinated (shaded bar) mice were collected at 12 h after infection. (A) IL-17A and IFN-γ mRNA expression were determined by real-time quantitative RTPCR. (B) The vaccinated and the non-vaccinated mice were infected with wild-type S. aureus or tst, and the spleens and livers were collected at 12 h after infection. IL-17A mRNA expression was determined by real-time quantitative RT-PCR. Data are expressed as the median ± interquartile range of a group of six mice from two independent experiments. An asterisk represents a statistically significant difference from the non-vaccinated group at P < 0.05.
Figure 5. Chemokine expression in the spleens and livers of mTSST-1-vaccinated wild-type mice after S. aureus infection. Wild-type or IL-17A-deficient mice were vaccinated with mTSST-1 + alum or alum only, and infected with S. aureus after 7 days of the final vaccination. The spleens and livers were collected at 24 h after infection. CCL2, CXCL1 and CXCL2 mRNA expression in the spleens (A) and livers (B) of the vaccinated (open bar) and the non-vaccinated (shaded bar) mice was determined by real-time quantitative RT-PCR. Each result represents a group of five to six mice from two independent experiments. Data are expressed as the median ± interquartile range. An asterisk represents a statistically significant difference from the non-vaccinated group at P < 0.05.
8
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
Figure 6. Infiltration of neutrophils and macrophages in the spleens and liver of mTSST-1-vaccinated mice. Wild-type and IL-17-deficient mice were vaccinated with mTSST-1 + alum or alum only, and infected with S. aureus after 7 days of the final vaccination. The organs were collected at 24 h after infection. (A) MPO activity in the spleens and livers of the vaccinated (open bar) and the non-vaccinated (shaded bar) mice was determined. Each result represents a group of five to six mice from two independent experiments. Data are expressed as the median ± interquartile range. An asterisk represents a statistically significant difference from the nonvaccinated group at P < 0.05. (B) The spleen cells from the wild-type mice were stained with anti-F4/80 mAb. F4/80+ cells were assessed by flow cytometry. Numbers in the upper-right side indicate the percentages of F4/80+ cells. The results shown are representative of at least two independent experiments. (C) Quantitative analysis of macrophages in the livers of the vaccinated (open bar) and the non-vaccinated (shaded bar) mice was carried out. Macrophage density was determined as described in the section ‘Materials and Methods’. Each result represents as the median ± interquartile range for 10 random fields of each section. An asterisk represents a statistically significant difference from the non-vaccinated group at P < 0.05.
that mTSST-1 vaccination induces IL-17A-dependent protection against S. aureus infection in addition to humoral immunity. Pathogen-activated antigen-presenting cells induce activation and differentiation of na¨ıve CD4+ T cells into Th cells including Th1, Th2 and Th17 cells. In this study, induction of IFNγ and IL-17 by rTSST-1 stimulation of spleen cells from both non-vaccinated and mTSST-1-vaccinated mice was due to its superantigenic activity. In contrast, mTSST-1 failed to induce these cytokines from the non-vaccinated mice. This may be due to lack of superantigenic activity of mTSST-1 (Hu et al. 2003). The same level of IFN-γ was induced by rTSST-1 in the nonvaccinated and mTSST-1-vaccinated mice, whereas IFN-γ production was not induced by mTSST-1 in either group, suggesting that mTSST-1-vaccination did not skew Th1 response. On the contrary, IL-17 production was significantly upregulated by rTSST-1 and mTSST-1 in the mTSST-1-vaccinated mice. These results suggest that mTSST-1 vaccination can induce Th17 response. IL-17A production was increased in CD4+ T and TCRβ + T cells in the spleen cells from mTSST-1-vaccinated mice compared with those of non-vaccinated animals. These results suggest that vaccination with mTSST-1 may induce differentiation of na¨ıve CD4+ T cells to Th17 cells and these Th17 cells are a main source for IL-17A production. In addition to Th17 cells, TCRγ δ T cells are known to be important cellular sources of IL-17 during bacterial infections (Dieli et al. 2003; Cho et al. 2010; Cheng et al. 2012). Murphy et al. (2014) recently reported that memory γ δ T cells, which had been induced in peritoneal cavities and mediastinal lymph nodes of mice by intraperitoneal infection with S. aureus, produces high levels of IL-17 and mediates an enhanced bacterial clearance upon reinfection with the bacterium. In our hands, TCRγ δ T
cells were not main IL-17A-producing cells in the mTSST-1vaccinated mice. IL-17 has been reported to be critical for host defense against S. aureus infection (Lin et al. 2009; Cho et al. 2010; Henningsson et al. 2010; Narita et al. 2010; Cheng et al. 2012; Murphy et al. 2014). Therefore, the role of IL-17A in the protection against S. aureus infection by mTSST-1 vaccination was investigated using IL-17A-deficient mice. Vaccination with mTSST-1 improved survival rate and reduced bacterial burden in the spleens and livers of mTSST-1-vaccinated wild-type mice, whereas the protective effect was not observed in IL-17A-deficient mice, suggesting that IL-17A plays a critical role in the protective effect of mTSST-1 vaccination. We investigated whether bacterial clearance in the organs is induced by antigen-specific immune response to TSST1 secreted by S. aureus during infection. Upregulation of IL-17A expression in the organs and the protection against S. aureus infection were not elicited when the vaccinated mice were infected with tst, suggesting that the protective effect of mTSST1 vaccination is dependent on TSST-1 produced during S. aureus infection. Our previous study demonstrated that vaccination with the fibrinogen-binding domain of ClfA induces IL-17A-producing cells and the IL-17A-mediated recruitment of neutrophils and macrophages into the infectious foci is critical in the protective effect on S. aureus infection (Narita et al. 2010). IL-17 induces the production of chemokines in the site of infection (Tekstra et al. 1999; Ye et al. 2001; Gaffen, 2008), and the produced chemokines elicit a recruitment of neutrophils and macrophages that are crucial for the elimination of S. aureus (Molne, Verdrengh and Tarkowski 2000; Gaffen, 2008; Thurlow et al. 2011). In this study, CCL2, CXCL1 and CXCL2 mRNA
Narita et al.
expression in the spleens and CCL2 and CXCL1 mRNA expression in the livers were upregulated, and infiltration of neutrophils and macrophages was enhanced in both organs of mTSST-1-vaccinated wild-type mice but not IL-17-deficient mice during S. aureus infection. These results indicate that IL-17A may upregulate chemokine mRNA expression and enhance recruitment of phagocytes into the infectious foci to resolve S. aureus infection. The IL-17-mediated protective effect should be achieved in the response to TSST-1 because it is likely that recognition of TSST-1 but not other pathogen-related antigens occurred in mTSST-1-vaccinated mice during S. aureus infection. In this study, we demonstrated that vaccination with mTSST1 induces Th17 cells and that IL-17A elicits the protective effect against S. aureus infection in mice. These findings would be useful for development of IL-17A-mediated new therapeutic and prophylactic strategy against infectious diseases.
SUPPLEMENTARY DATA Supplementary data are available at FEMSPD online.
FUNDING This study was supported by JSPS KAKENHI grant number 23390100 and grant for Hirosaki University Institutional Research. Conflict of interest. None declared.
REFERENCES Asano K, Asano Y, Ono HK, et al. Suppression of starvationinduced autophagy by recombinant toxic shock syndrome toxin-1 in epithelial cells. PLoS One 2014;9:e113018. Bonventre PF, Heeg H, Cullen C, et al. Toxicity of recombinant toxic shock syndrome toxin 1 and mutant toxins produced by Staphylococcus aureus in a rabbit infection model of toxic shock syndrome. Infect Immun 1993;61:793–9. Bonventre PF, Heeg H, Edwards CK, III, et al. A mutation at histidine residue 135 of toxic shock syndrome toxin yields an immunogenic protein with minimal toxicity. Infect Immun 1995;63:509–515. Cheng P, Liu T, Zhou WY, et al. Role of gamma-delta T cells in host response against Staphylococcus aureus-induced pneumonia. BMC Immunol 2012;13:38. Cho JS, Pietras EM, Garcia NC, et al. IL-17 is essential for host defense against cutaneous Staphylococcus aureus infection in mice. J Clin Invest 2010;120:1762–73. Choi Y, Lafferty JA, Clements JR, et al. Selective expansion of T cells expressing V beta 2 in toxic shock syndrome. J Exp Med 1990;172:981–4. Curtis MM, Way SS. Interleukin-17 in host defence against bacterial, mycobacterial and fungal pathogens. Immunology 2009;126:177–85. Dieli F, Ivanyi J, Marsh P, et al. Characterization of lung γ δ T cells following intranasal infection with Mycobacterium bovis bacillus Calmette-Guerin. J Immunol 2003;170:463–9. Gaffen SL. An overview of IL-17 function and signaling. Cytokine 2008;43:402–7. Henningsson L, Jirholt P, Lindholm C, et al. Interleukin-17A during local and systemic Staphylococcus aureus-induced arthritis in mice. Infect Immun 2010;78:3783–90.
9
Hobden JA, Masinick SA, Barrett RP, et al. Proinflammatory cytokine deficiency and pathogenesis of Pseudomonas aeruginosa keratitis in aged mice. Infect Immun 1997;65:2754–8. Hu D-L, Omoe K, Inoue F, et al. Comparative prevalence of superantigenic toxin genes in meticillin-resistant and meticillinsusceptible Staphylococcus aureus isolates. J Med Microbiol 2008;57:1106–12. Hu DL, Omoe K, Sasaki S, et al. Vaccination with non-toxic mutant toxic shock syndrome toxin 1 protects against Staphylococcus aureus infection. J Infect Dis 2003;188:743–52. Ikejima S, Sasaki S, Sashinami H, et al. Impairment of host resistance to Listeria monocytogenes infection in liver of db/db and ob/ob mice. Diabetes 2005;54:182–9. Jeyaseelan S, Chu HW, Young SK, et al. Transcriptional profiling of lipopolysaccharide-induced acute lung injury. Infect Immun 2004;72:7247–56. Klein E, Smith DL, Laxminarayan R. Hospitalizations and deaths caused by methicillin-resistant Staphylococcus aureus, United States, 1999–2005. Emerg Infect Dis 2007;13:1840–6. Lin L, Ibrahim AS, Xu X, et al. Th1-Th17 cells mediate protective adaptive immunity against Staphylococcus aureus and Candida albicans infection in mice. PLoS Pathog 2009;5:e1000703. Lowy FD. Staphylococcus aureus infections. New Engl J Med 1998;339:520–32. Molne L, Verdrengh M, Tarkowski A. Role of neutrophil leukocytes in cutaneous infection caused by Staphylococcus aureus. Infect Immun 2000;68:6162–7. Murphy AG, O’Keeffe KM, Lalor SJ, et al. Staphylococcus aureus infection of mice expands a population of memory γ δ T cells that are protective against subsequent infection. J Immunol 2014;192:3697–708. Nakae S, Komiyama Y, Nambu A, et al. Antigen-specific T cell sensitization is impaired in IL-17-deficient mice, causing suppression of allergic cellular and humoral responses. Immunity 2002;17:375–87. Nakane A, Okamoto M, Asano M, et al. Endogenous gamma interferon, tumor necrosis factor, and interleukin-6 in Staphylococcus aureus infection in mice. Infect Immun 1995;63:1165–72. Narita K, Hu DL, Mori F, et al. Role of interleukin-17A in cellmediated protection against Staphylococcus aureus infection in mice immunized with the fibrinogen-binding domain of clumping factor A. Infect Immun 2010;78:4234–42. Narita K, Hu DL, Tsuji T, et al. Intranasal immunization of mutant toxic shock syndrome toxin 1 elicits systemic and mucosal immune response against Staphylococcus aureus infection. FEMS Immunol Med Mic 2008;52:389–96. Ouyang W, Kolls JK, Zheng Y. The biological functions of T helper 17 cell effector cytokines in inflammation. Immunity 2008;28:454–67. Piao C, Karasawa T, Totsuka K, et al. Prospective surveillance of community-onset and healthcare-associated methicillinresistant Staphylococcus aureus isolated from a universityaffiliated hospital in Japan. Microbiol Immunol 2005;49:959–70. Rasheed JK, Arko RJ, Feeley JC, et al. Acquired ability of Staphylococcus aureus to produce toxic shock-associated protein and resulting illness in a rabbit model. Infect Immun 1985;47:598– 604. Stiles BG, Krakauer T, Bonventre PF. Biological activity of toxic shock syndrome toxin 1 and a site-directed mutant, H135A, in a lipopolysaccharide-potentiated mouse lethality model. Infect Immun 1995;63:1229–34. Tekstra J, Beekhuizen H, Van De Gevel JS, et al. Infection of human endothelial cells with Staphylococcus aureus induces the
10
FEMS Pathogens and Disease, 2015, Vol. 73, No. 4
production of monocyte chemotactic protein-1 (MCP-1) and monocyte chemotaxis. Clin Exp Immunol 1999;117:489–95. Thurlow LR, Hanke ML, Fritz T, et al. Staphylococcus aureus biofilms prevent macrophage phagocytosis and attenuate inflammation in vivo. J Immunol 2011;186:6585–96. Ye P, Rodriguez FH, Kanaly S, et al. Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression,
neutrophil recruitment, and host defense. J Exp Med 2001;194:519–27. Zaraket H, Otsuka T, Saito K, et al. Molecular characterization of methicillin-resistant Staphylococcus aureus in hospitals in Niigata, Japan: divergence and transmission. Microbiol Immunol 2007;51:171–6. Zhu J, Yamane H, Paul WE. Differentiation of effector CD4 T cell populations. Annu Rev Immunol 2010;28:445–89.
