Vaccine 33 (2015) 280–288

Contents lists available at ScienceDirect

Vaccine journal homepage: www.elsevier.com/locate/vaccine

Vaccination using live attenuated Leishmania donovani centrin deleted parasites induces protection in dogs against Leishmania infantum Jacqueline Araújo Fiuza a,b,c , Sreenivas Gannavaram c , Helton da Costa Santiago b , Angamuthu Selvapandiyan d , Daniel Menezes Souza b , Lívia Silva Araújo Passos b , Ludmila Zanandreis de Mendonc¸a b , Denise da Silveira Lemos-Giunchetti b , Natasha Delaqua Ricci b , Daniella Castanheira Bartholomeu b , Rodolfo Cordeiro Giunchetti b , Lilian Lacerda Bueno b , Rodrigo Correa-Oliveira a , Hira L. Nakhasi c , Ricardo Toshio Fujiwara b,∗ a

Laboratory of Cellular and Molecular Immunology, Centro de Pesquisas René Rachou, Fundac¸ão Oswaldo Cruz, Belo Horizonte, MG, Brazil Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brazil c Division of Emerging and Transfusion Transmitted Diseases, Office of Blood Research and Review, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892, USA d Institute of Molecular Medicine, 254 Okhla Industrial Estate, Phase III., New Delhi 110020, India b

a r t i c l e

i n f o

Article history: Received 25 September 2014 Received in revised form 17 November 2014 Accepted 20 November 2014 Available online 1 December 2014 Keywords: Vaccine Leishmaniasis Visceral leishmaniasis Canine visceral leishmaniasis Live attenuated Vaccines Leishmania

a b s t r a c t Live attenuated Leishmania donovani parasites such as LdCen−/− have been shown elicit protective immunity against leishmanial infection in mice and hamster models. Previously, we have reported on the induction of strong immunogenicity in dogs upon vaccination with LdCen−/− including an increase in immunoglobulin isotypes, higher lymphoproliferative response, higher frequencies of activated CD4+ and CD8+ T cells, IFN-␥ production by CD8+ T cells, increased secretion of TNF-␣ and IL-12/IL-23p40 and, finally, decreased secretion of IL-4. To further explore the potential of LdCen−/− parasites as vaccine candidates, we performed a 24-month follow up of LdCen−/− immunized dogs after challenge with virulent Leishmania infantum, aiming determination of parasite burden by qPCR, antibody production (ELISA) and cellular responses (T cell activation and cytokine production) by flow cytometry and sandwich ELISA. Our data demonstrated that vaccination with a single dose of LdCen−/− (without any adjuvant) resulted in the reduction of up to 87.3% of parasite burden after 18 months of virulent challenge. These results are comparable to those obtained with commercially available vaccine in Brazil (Leishmune® ). The protection was associated with antibody production and CD4+ and CD8+ proliferative responses, as well as T cell activation and significantly higher production of IFN-␥, IL-12/IL-23p40 and TNF-␣, which was comparable to responses induced by immunization with Leishmune® , with significant differences when compared to control animals (Placebo). Moreover, only animals immunized with LdCen−/− expressed lower levels of IL-4 when compared to animals vaccinated either with Leishmune® or PBS. Our results support further studies aiming to demonstrate the potential of genetically modified live attenuated L. donovani vaccine to control L. infantum transmission in endemic areas for CVL. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction Visceral leishmaniasis (VL), also known as kala-azar, is a potentially fatal disease caused by obligate intracellular parasites belonging to the species of the Leishmania donovani species complex. The estimated annual global incidence of VL is 200,000

∗ Corresponding author. Tel.: +55 31 3409 2859. E-mail address: [email protected] (R.T. Fujiwara). http://dx.doi.org/10.1016/j.vaccine.2014.11.039 0264-410X/© 2014 Elsevier Ltd. All rights reserved.

to 400,000, and >90% of these cases occur in India, Bangladesh, Sudan, South Sudan, Ethiopia and Brazil [1]. Dogs are the important reservoir of Leishmania infantum and represent a major source of human infections of VL and it has been proposed that the increasing burden of human VL in Brazil over the past two decades (3500 cases) is presumably due to the incidence of canine visceral leishmaniasis (CVL) [2]. Using a mathematical modeling, Dye suggested that vector control and vaccination of dogs and/or humans would be more efficacious than dog culling [3].

J.A. Fiuza et al. / Vaccine 33 (2015) 280–288

Several vaccines including killed parasites, recombinant Leishmania antigens, sand fly salivary gland extract, including distinct adjuvants in these vaccine formulations have been tested against CVL [4–10]. Several of these vaccines have shown varying efficacies in dogs, although some hallmarks of a protective immune response (e.g. production of IFN-␥ and TNF-␣ that are required for macrophage activation and clearance of intracellular parasites) are often observed. Moreover, adverse effects after immunization with commercially available vaccines were observed [11,12]. On the other hand, vaccines comprising live-attenuated parasites elicit protective immunity and, more importantly, cause no pathology [13–15]. Among the live-attenuated parasites used as vaccines, the centrin deletion in L. donovani (LdCen−/− ) has been shown to specifically affect the cytokinesis and lead to multinucleated cells and eventual cell death of amastigote forms while the growth of promastigote forms is unaffected [16]. Previous studies evaluated the protective immunity of LdCen−/− and demonstrated the safety, immunogenicity and protection against infection with wild type L. donovani in mice and hamster models [14]. Previously, we have demonstrated that immunization with LdCen−/− results in an increase in immunoglobulin isotypes, higher lymphoproliferative response, higher frequencies of activated CD4+ and CD8+ T cells, IFN-␥ production by CD8+ T cells, increased secretion of TNF-␣ and IL-12/IL-23p40 and decreased secretion of IL-4 [17]. To further test the potential of LdCen−/− parasites as vaccine candidates, a 24-month follow up of LdCen−/− immunized dogs after challenge with virulent L. infantum was performed. We are reporting on the parasitological and immunological parameters, such as parasite load, antibody secretion, production of intracellular and secreted cytokines as well as T cell activation, proliferation and phenotypic markers following the challenge infection. These results were compared to those obtained from either placebo (saline) or Leishmune® (a commercially available vaccine in Brazil) immunized dogs. 2. Material and methods

281

by the Ethical Committee for Use of Experimental Animals of the Federal University of Minas Gerais, Brazil (CETEA Protocol no. 122/09). 2.3. DNA extraction, qPCR and parasite load analyses Quantitative real-time PCR (qPCR) was used to determine the parasite loads in bone marrow from 3 to 24 months after the challenge. Dogs were submitted to general anesthesia using the combination of 2 mg/kg of body weight of xylazine chloridrate (Calmium; União Química Farmacêutica, Brazil) and 11 mg/kg of body weight of ketamine chloridrate (Ketamina Agener; União Química Farmacêutica, Brazil) by intramuscular injection. One milliliter of sternal bone marrow aspirate was collected. All samples were stored at −80 ◦ C until further processing. DNA was extracted from the bone marrow samples using NucleoSpin® Tissue (Macherey-Nagel) according with manufactures instructions. The parasite loads were calculated by real-time PCR according to a method described elsewhere [19,20] with minor modifications. The parasite burdens were estimated using the following primers: Forward, 5 TGTCGCTTGCAGACCAGATG 3 and reverse, 5 GCATCGCAGGTGTGAGCAC 3 . These primers amplified a 90 bp fragment of a single-copy-number L. infantum DNA polymerase gene (GenBank accession number AF009147). PCR was carried out in a final volume of 10 ␮L containing 2.0 pmol of each DNA polymerase primers, 2X SYBR® Green PCR Master Mix (Applied Biosystems, USA), 4.0 ␮L of DNA with a final concentration of approximately 20 ng/mL and an enough volume of ultrapure water. Reactions were processed and analyzed in an ABI Prism 7500 Sequence Detection System (SDS Applied Biosystems, Foster City, CA, USA). The followed steps were programmed: an initial denaturation at 95 ◦ C for 10 min followed by 40 cycles of denaturation at 95 ◦ C for 15 s and annealing/extension at 60 ◦ C for 1 min. Parasite quantification for each bone marrow sample was calculated by interpolation from the standard curve included in the same run, performed in duplicate, and expressed as the number of L. infantum organisms per 20 ng of total DNA.

2.1. Parasites and soluble antigen (SLA) preparation 2.4. Antibody responses

The L. donovani centrin1-deleted (LdCen−/− ) parasites were used for immunization [14] and maintained as previously described [16]. L. infantum promastigote forms (MHOM/BR/1972/BH46) were grown as described [18]. For preparation of SLA, L. infantum stationary-phase promastigotes were harvested, washed three times in PBS and ruptured using a cell disruptor (Sonifier Cell Disruptor, Branson Sonic Power Co., Danbury, CT, USA). The ruptured parasite suspension was centrifuged at 18,500 rpm for 90 min at 4 ◦ C. The supernatant was dialyzed against PBS for 24 h and sterilized by filtration through 0.22 ␮m syringe filters and stored at −80 ◦ C. Protein quantification was performed using Pierce® BCA Protein Assay Kit, as described by the manufacturer.

Antigen-specific IgGTotal titers and IgG1 and IgG2 levels were measured by indirect ELISA [7]. Briefly, 96 well micro titer plates (Nalge Intl., USA) were coated overnight with 5 ␮g/mL of SLA from L. infantum. For IgGTotal , IgG1 and IgG2 analysis, sera were added at a 1:100 dilution. Peroxidase-conjugated rabbit anti-dog IgGTotal , IgG1 and IgG2 antibodies were added at a 1:5000 dilution for 1 h. The reaction was developed using O-phenylenediamine and H2 O2 (Sigma, USA) and absorbance was measured on VersaMax 340PC microplate reader (Molecular Devices, USA) at 492 nm. Cut-off values were calculated using the mean average OD of 60 negative samples plus 2 standard deviations.

2.2. Animals and vaccination protocol

2.5. In vitro proliferative response of lymphocytes

Eighteen purposed bred healthy beagle dogs with 8 months of age were divided into three groups (3 males and 3 females per group). LdCen−/− group received 1 × 107 LdCen−/− stationary phase promastigotes subcutaneously. Leishmune® group received three subcutaneous doses of vaccine (1 mL each) with an interval of 21 days between each dose, as recommended by the manufacturer (Zoetis, Brazil). Control group received PBS alone. All animals were challenged two months after the last dose of vaccine (Leishmune® or LdCen−/− ) or PBS. Immunological parameters were measured 3, 6 and 12 months after an intravenous challenge with 1 × 107 of stationary phase promastigotes of L. infantum. The study was approved

PBMCs were isolated from heparinized blood by density gradient centrifugation as described [21]. Cell culture experiments were performed in triplicate using 5 × 105 PBMC per well, in a final volume of 1000 ␮L complete RPMI-1640 medium. Cells were stimulated with 25 ␮g/well of PHA (Sigma, USA) or 10 ␮g/well of L. infantum SLA. After 72 h incubation, supernatants were collected for cytokine detection. Cell proliferation analysis was performed on PBMC labeled with BrdU essentially as described [22], and analyzed the stimulation index using monoclonal antibodies CD4, CD8 or CD21. Proliferation responses were expressed in terms of stimulation ratio that was calculated as: mean proliferation response of

282

J.A. Fiuza et al. / Vaccine 33 (2015) 280–288

cultures stimulated SLA L. infantum/mean proliferation response of unstimulated cultures.

2.6. Flow cytometric analysis of phenotypic profile and intracytoplasmic cytokine production Flow cytometry of the ex vivo and in vitro-stimulated cells was performed as previously described [23]. For ex vivo analysis, peripheral blood was collected in Vacutainer tubes containing EDTA (Becton Dickinson, USA); erythrocytes were lysed using 2 mL of FACS Lysing Solution (BD Biosciences, USA). Undiluted monoclonal antibodies (2 ␮L) were added to remaining cells of corresponding to the following cell surface markers: CD3-FITC (clone CA17.2A12), CD4-FITC or Alexa Fluor 647 (YKIX302.9), CD8-Alexa Fluor® 647 (YCATE55.9), CD21-Alexa Fluor 647 (CA2.1D6), CD14-PE (TÜK4), MHC-II-FITC (YKIX334.2), CD11/18-FITC (YKIX490.6.4) (all from AbD Serotec, USA). Cells were incubated in the dark for 30 min at RT, washed with PBS twice and fixed in 200 ␮L of fixative solution (BD Biosciences, USA). For the analysis of cultures, whole blood was collected in heparinized Vacutainer tubes, incubated at a dilution of 1:10 in RPMI-1640 media supplemented with 1.6% l-glutamine, 3% antibiotic-antimycotic solution (all from Sigma, USA), 5% of heat inactivated FBS (Cultilab, Brazil) for 24 h at 37 ◦ C and 5% CO2 and pulsed with SLA from L. infantum (10 ␮g/well). During the last 4 h of culture, Brefeldin A (Sigma, USA) (10 ␮g/mL) was added. Cells were stained with 2 ␮L of cell surface markers [CD4-FITC (YKIX302.9) and CD8-Alexa Fluor® 647 (YCATE55.9)] and after washing steps, they were permeabilized with saponin buffer (Sigma, USA) for 15 min with further addition of anti-cytokines antibodies [IFN␥-PE (CC302) and IL-4-PE (CC303) (all from AbD Serotec, USA)]. Acquisitions were performed in a FACSCalibur flow cytometer (Becton Dickinson, USA). Data were collected on 1 × 105 lymphocytes (gated by forward and side scatter) and analyzed using CellQuest Pro software.

2.7. Measurement of cytokine production IFN-␥, IL-4, TNF-␣ and IL-12/IL-23p40 were measured in cell supernatants of PBMC cultures by a sandwich ELISA (R&D Systems, USA) following manufacturer’s instructions. Cytokine concentrations were calculated by interpolation from the standard curve using 5-parameter curve fitting software (SOFTmax® Pro-5.3, Molecular Devices, USA). The detection limits were: 31.3 pg/mL for IL-12/IL-23p40 and IL-4; and 7.8 pg/mL for TNF-␣ and IFN␥.

2.8. Biochemical and hematological analyses Levels of albumin, AST, ALT, total bilirubin, calcium, total cholesterol, creatinine, urea, alkaline phosphatase, phosphorus, gamma GT, glucose, total proteins, and whole blood count were evaluated in the three groups 3, 6 and 12 months post challenge.

3. Results 3.1. Immunization with LdCen−/− attenuated parasites resulted in significantly reduced parasite burden after challenge with L. infantum Dogs vaccinated with LdCen−/− and Leishmune® exhibited significantly lower parasite load in the bone marrow when compared to PBS immunized animals (p < 0.05) at both 18 and 24 months post infection follow up period (Fig. 1). Immunization with a single dose of LdCen−/− (with no adjuvant) elicited a significant reduction of parasite burden comparable to animals that received commercially available vaccine (comprising three doses of Fucose Manose Ligand antigen and saponin as adjuvant). The protection was more prominent after 18 months of challenge infection with an average reduction of 87.3% in the parasite burden (Fig. 1A). Protection after immunization with LdCen−/− and Leishmune® was still observed after 24 months of infection but at lower rate (Fig. 1B), supporting the use of vaccine booster to improve the efficacy of those vaccines. 3.2. Immunization with LdCen−/− induced strong antibody response The analysis of sera from the dogs immunized with LdCen−/− indicated strong Leishmania-specific antibody responses. The SLA-specific IgGTotal production was significantly higher for animals immunized with LdCen−/− when compared to animals from PBS and Leishmune® groups at 3, 6 and 12 months post challenge (mpc) (p < 0.05) (Fig. 2A). Also, increased levels of IgG1 were detected in LdCen−/− group compared to PBS controls at 3, 6 and 12 mpc (p < 0.001, p < 0.01 and p < 0.05, respectively) (Fig. 2B). IgG2 antibody levels were significantly higher in LdCen−/− group compared to control group on 3 mpc (p < 0.01), and higher in LdCen−/− and Leishmune® vaccinated dogs compared to PBS group (p < 0.001) at 12 mpc (Fig. 2C). 3.3. Increased antigen specific T cell proliferation in LdCen−/− immunized dogs after challenge In order to examine the induction of memory responses by LdCen−/− parasites, lymphoproliferative response was evaluated in L. infantum SLA-pulsed PBMCs (Fig. 3). Comparative analysis of the different vaccinated groups showed a significant increase (p < 0.05) of CD4+ T cell proliferation (measured as stimulation index) at 12 mpc only in the LdCen−/− immunized dogs. Leishmune® immunized dogs did not show any difference in proliferation compared to PBS control group at 6 and 12 mpc time points (Fig. 3A). In addition, animals vaccinated with LdCen−/− exhibited a significantly higher (p < 0.05) CD8+ T cell proliferative response after SLA stimulation (p < 0.05) at 3 mpc when compared to the PBS control group (Fig. 3B). No significant differences were observed for proliferation of B cells (Fig. 3C). 3.4. LdCen−/− immunized dogs showed higher activation of CD4+ and CD8+ T cells after challenge

2.9. Statistical analysis Statistical analysis was performed using GraphPad Prism 5.0 software (GraphPad Software Inc, USA). Non-parametric Kruskal–Wallis test followed by Dunns test was used to compare data from three groups (LdCen−/− , Leishmune® and PBS). Differences were considered significant when a p value ≤0.05 was obtained.

Assessment of CD4+ and CD8+ T cell activation after immunization with different vaccines was performed to evaluate the expression (mean fluorescence intensity - MFI) of MHC II and CD11/18 (Fig. 4A–D). The ex vivo analysis revealed that circulating lymphocytes from LdCen−/− vaccinated group displayed increased CD11/18 expression in both CD4+ and CD8+ T cells when compared to control (p = 0.02 for both) and Leishmune® immunized

J.A. Fiuza et al. / Vaccine 33 (2015) 280–288

283

Fig. 1. Parasite burden after challenge infection. Detection of parasites (expressed as number of parasites/20 ng of total DNA) after 18 (A) or 24 (B) months of infection with L. infantum. Statistical differences (p < 0.05) are indicated in letters (a: PBS, b: Leishmune and c: LdCen−/− ). Percentual values indicate the reduction of parasite burden in comparison to the control (PBS) animals.

Fig. 2. Specific antibody production after challenge infection. ELISAs anti-SLA from L. infantum were performed to detected production of total IgG (A), IgG1 (B) and IgG2 (C). The antibody OD values are shown on the y-axis, and the error bars indicate the standard deviation. Dotted line represents the cut-off value. Significant differences are indicated on the graphs (* p < 0.05; ** p < 0.01; *** p < 0.001).

Fig. 3. Cell proliferative responses in animals immunized with Leishmune or LdCen−/− after challenge infection. Proliferation of T CD4+ (A), T CD8+ (B) and B cells/CD21+ (C) cells after pulsing with L. infantum SLA for 72 h. Proliferation responses were expressed in terms of stimulation ratio that was calculated as: mean proliferation response of cultures stimulated SLA L. infantum/mean proliferation response of unstimulated cultures. Significant differences are indicated on the graphs (* p < 0.05; ** p < 0.01).

284

J.A. Fiuza et al. / Vaccine 33 (2015) 280–288

Fig. 4. Phenotypic profile of T cell activation after challenge infection. Mean fluorescence intensity (MFI) in ex vivo and culture analysis for expression of MHC II (A, C, E and G) or CD11/18 (B, D, F and H) by T CD4+ and CD8+ cells. Results from cultures are expressed as ratio (MFI of cultures stimulated with SLA L. infantum/MFI of unstimulated cultures). Significant differences are indicated on the graphs (* p < 0.05; ** p < 0.01).

J.A. Fiuza et al. / Vaccine 33 (2015) 280–288

285

Fig. 5. Production of cytokines in dogs immunized with Leishmune or LdCen−/− after challenge infection. Detection of IFN-␥ (A), TNF-␣, (B), IL-12/IL-23p40 (C) and IL-4 (D) in cell cultures after stimulation with L. infantum SLA. Results are expressed as delta (production of cytokines in cultures stimulated with SLA L. infantum minus production of cytokines in unstimulated cultures). Significant differences are indicated on the graphs (* p < 0.05).

animals (p = 0.009 and p = 0.01, respectively) at 12 months after challenge (Fig. 4B and D). No major differences were detected in the expression of MHC II in both CD4+ and CD8+ T cell populations (Fig. 4A and C). Cell activation was also examined in whole blood cultures for measurement of MHC II and CD11/18 expression by mean fluorescence intensity (MFI), aiming to determine the capacity of antigen presentation (Fig. 4E–H). After 12 months of challenge, vaccination with LdCen−/− induced a higher ratio (stimulated/unstimulated culture) of expression of MHC II molecules on CD8+ T cells when compared to control (p = 0.001) and Leishmune® (p = 0.002) groups (Fig. 4G) but not on CD4+ T cells (Fig. 4E). Also, considering the same period of follow up, high expression of CD11/18 was induced in both CD4+ and CD8+ T cells from animals immunized with LdCen−/− when compared to animals that received PBS (p = 0.04 and 0.0001) or Leishmune® (p = 0.03, only for CD4+ T cells) (Fig. 4F and H, respectively).

3.5. Immunization with the LdCen−/− induced strong Type 1 cytokines production by T cells in response to SLA stimulation In order to evaluate the profile of cytokine response in vaccinated/challenged dogs, the cytokines production was assessed in the supernatant of stimulated PBMCs by sandwich ELISA (Fig. 5). Only animals from LdCen−/− group showed higher production (p < 0.05) of IFN-␥ and IL-12/IL-23p40 compared to the PBS control and Leishmune® groups at 12 mpc (Fig. 5A and C). Additionally, TNF-␣ was produced in higher amount (p < 0.05) by animals from LdCen−/− and Leishmune® groups when compared to placebo (Fig. 5B) at 12 mpc. In contrast, at the same period, the LdCen−/− dogs expressed lower levels® (p < 0.05) of IL-4 than animals immunized with PBS and Leishmune® (Fig. 5D).

3.6. Higher frequencies of T cells expressing intracytoplasmic IFN- and decreased expression of IL-4 were the hallmark of LdCen−/− vaccinated dogs Ex vivo analysis of T lymphocyte subsets demonstrated that LdCen−/− vaccination induced significantly higher IFN-␥ expression by CD4+ (p < 0.02) and CD8+ T cells (p < 0.04) compared to PBS group, 12 months after challenge (Fig. 6A and C). In contrast, a decreased (p < 0.02) IL-4 expression was observed in CD4+ T cells obtained from LdCen−/− group compared to PBS, 3 months post challenge, and in CD8+ T cells compared to Leishmune® and PBS groups (p < 0.04 and p < 0.007, respectively), 12 months post challenge (Fig. 6B and D). 3.7. Phenotypic profile of circulating cells (monocytes, B cells and CD4+ and CD8+ T cells) and hematological and biochemical analysis Vaccination with Leishmune® or LdCen−/− parasites did not alter the frequencies of CD3+ CD4+ , CD3+ CD8+ , CD21+ and CD14+ after 3, 6, and 12 months post challenge, compared to control animals (Supplementary Table 1) during ex vivo analysis. Also, hematological and biochemical analysis showed that vaccination with Leishmune® or LdCen−/− parasites did not result in changes in the all parameters analyzed after challenge (Supplementary Table 2). 4. Discussion Vaccination studies in murine models have shown that live attenuated forms of parasites gives better protection when compared to vaccines of recombinant antigens [13,15,14,24–28]. Previously, we have described that immunization with LdCen−/− parasites induced strong immunogenicity in dogs, such as high antibody production, proliferation response, T cell activation,

286

J.A. Fiuza et al. / Vaccine 33 (2015) 280–288

Fig. 6. Intracytoplasmatic cytokine production by T cells in dogs immunized with Leishmune or LdCen−/− after challenge infection. Number of CD4+ (A and B) or CD8+ circulating T cells (C and D) producing IFN-␥ and IL-4 in cell cultures after stimulation with L. infantum SLA. Significant differences are indicated on the graphs (* p < 0.05; ** p < 0.01).

increased production of Th1 cytokines and decreased secretion of Th2 cytokines [17]. Here, we demonstrated that LdCen−/− and Leishmune® immunization results in significant protection as revealed by the low parasite burdens in the bone marrow at 18 months and even 24 months post challenge. The level of parasite burden observed in LdCen−/− and Leishmune® immunized group is comparable to that typically observed in asymptomatic dogs that are PCR positive [29] suggesting the robust degree of protection. Thus, the protection obtained in the present study confirms the ability of LdCen−/− vaccine to limit parasite replication and prevent severe disease after challenge even at long term (18 and 24 months post-challenge). While infected dogs can remain healthy [30] but still maintain the transmission of VL [31], there is evidence that vaccination of dogs impairs the transmission of parasites to phlebotomines [11]. Moreover, clinically healthy dogs that present an efficient immune response against the parasite has little or no ability to transmit Leishmania to the vector in, even when a low parasite load is still detected [3,32]. According to our parasitological data and considering the lower parasite burden mainly at 18 months after infection, it may argued that even with the possibility of contact with L. infantum, LdCen−/− vaccinated dogs could remain healthy and may not transmit parasites to the sandfly vector. Protection elicited by LdCen−/− vaccine was preceded by sustained production of IgGTOTAL during all post challenge period, with detection of higher IgG1 levels (3 mpc) and progressive production in the IgG2 after immunization (until 12 mpc). Indeed, serum reactivity observed in vaccinated dogs indicates the antigen recognition of L. infantum, suggesting the establishment of immunogenic events [4,8,17,21,33–35]. Moreover, although no difference has been observed in the analysis of ex vivo immunophenotypic profile (B cells, monocytes, CD3+ T and T cell subsets) during the period post L. infantum challenge (Supplementary Tables 1 and 2), a remarkable change in both memory T cells and the lymphocyte

activation profile was identified. In this sense, higher CD4+ T and CD8+ T cell reactivity following stimulation was observed for LdCen−/− group. The sustained proliferation capacity of CD8+ T cells observed particularly in LdCen−/− group is of special significance since it has been linked to control of parasite burden [4,8,21,35,36]. Recently, increased levels of CD8+ T cells have been shown to be a major phenotypic feature of asymptomatic dogs bearing low parasite load and, even in naturally L. infantum infected dogs, displaying a strong association with low splenic parasitism [29,37]. Furthermore, studies regarding the immune response in vaccinated dogs or during ongoing of CVL have revealed that increased cell proliferation is directly related to high production of NO and IFN-␥, in addition to the maintaining of asymptomatic disease [4,8,21,35,36]. Indeed, our results showed increased levels of IFN-␥, TNF-␣ and IL12/IL-23p40 in LdCen−/− group after specific stimulation at 12 mpc. The remarkable increase in the IL-12/IL-23p40 and reduction in IL-4 related to LdCen−/− group when compared to Leishmune® vaccinated group would indicate a predominant type 1 immune response and reinforce the protection profile induced by immunization with LdCen−/− attenuated parasites. Similarly, the analysis of the intracytoplasmic cytokines pattern produced by T-cell subsets demonstrated, particularly in LdCen−/− group, increased IFN-␥ produced by CD4+ and CD8+ T cells, which is associated to the resistance profile triggered by vaccines against CVL [33–35,38]. The decrease of IL-4 by CD4+ and mainly by CD8+ T cell subsets after challenge, also support the hypothesis that vaccination with LdCen−/− is able to induce a predominant type 1 immune response and protective response against L. infantum infection in dogs. A recent study using LdCen−/− parasites in mice demonstrated that the immunity induced by these parasites is able to confer protection against a challenge with L. mexicana suggesting the broad spectrum of T cell immunity stimulated by LdCen−/− parasites [39].

J.A. Fiuza et al. / Vaccine 33 (2015) 280–288

In the present study, the evaluation of the activation status considering T cell subsets was performed by analysis in the expression of MHC -II and CD11/18. We observed an increased expression of CD11/18 by CD4+ and CD8+ T cells (ex vivo and in vitro analysis) in addition to higher levels of CD8+ MHC-II+ T-lymphocytes in LdCen−/− vaccinated dogs at 12 mpc. These data suggest that LdCen−/− is able to induce activation of both the CD4+ and CD8+ T-cell subsets. In fact, it has been proposed that an increased expression of MHC-II may reflect antigenic priming related to a previous immune event, and this status of activation in asymptomatic dogs may be related to protection against ongoing CVL [8,35]. Higher expression of activation markers in T cells was also observed after immunization protocol in dogs providing further evidence of immunoprotection against Leishmania infection [33,34]. Previous work has shown that LdCen−/− live attenuated vaccine was immunogenic in mice, hamsters and dogs [14,17], and protective against VL in mice and hamsters [14]. Here we have shown the overall tolerance of the LdCen−/− live attenuated vaccine in dogs, even following L. infantum challenge, since no alteration was observed in hematological and biochemical parameters (Supplementary Tables 3–5). Importantly, LdCen−/− live attenuated vaccine induced a strong antibody production, a selectively CD4+ and CD8+ T cell activation in addition to prominent type 1 immune response that contributed to a remarkable reduction in bone marrow parasite load, even 24 months post L. infantum infection. The protective response after using only a single dose of vaccine (with no use of adjuvant) was comparable to the protection determined by three doses of commercially available vaccines. While the costs of production between live attenuated and subunit vaccines may not be still comparable for proper evaluation, the use of single shot vaccine may reduce the cost when it is applied in the field (e.g. vaccine campaign) as it does not require months to perform immunization. Therefore, the use of such vaccine may contribute by reducing effort (among others, personnel and logistics) and minimizing loss to follow up. This study support further analysis aiming to demonstrate the potential of genetically modified live attenuated L. donovani vaccine to control L. infantum transmission in endemic areas for CVL. Acknowledgments This work was financially supported by the Fundac¸ão de Amparo a Pesquisa do Estado de Minas Gerais/FAPEMIG (grant no. CBB–PPM-00296-11) and the Brazilian National Research Council (CNPq). HCS, DCB, RCG, RCO and RTF are supported by CNPq fellowships.

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.vaccine. 2014.11.039.

[23]

[24]

References [25] [1] Alvar J, Velez ID, Bern C, Herrero M, Desjeux P, Cano J, et al. Leishmaniasis worldwide and global estimates of its incidence. PLoS One 2012;7:e35671. [2] Dantas-Torres F, Solano-Gallego L, Baneth G, Ribeiro VM, de Paiva-Cavalcanti M, Otranto D. Canine leishmaniosis in the old and new worlds: unveiled similarities and differences. Trends Parasitol 2012;28:531–8. [3] Dye C. The logic of visceral leishmaniasis control. Am J Trop Med Hyg 1996;55:125–30. [4] Aguiar-Soares RD, Roatt BM, Ker HG, Moreira N, Mathias FA, Cardoso JM, et al. LBSapSal-vaccinated dogs exhibit increased circulating T-lymphocyte subsets (CD4(+) and CD8(+)) as well as a reduction of parasitism after challenge with Leishmania infantum plus salivary gland of Lutzomyia longipalpis. Parasites Vectors 2014;7:61. [5] Borja-Cabrera GP, Correia Pontes NN, da Silva VO, Paraguai de Souza E, Santos WR, Gomes EM, et al. Long lasting protection against canine kala-azar using

[26] [27] [28]

[29]

287

the FML-QuilA saponin vaccine in an endemic area of Brazil (Sao Goncalo do Amarante, RN). Vaccine 2002;20:3277–84. Fernandes AP, Costa MM, Coelho EA, Michalick MS, de Freitas E, Melo MN, et al. Protective immunity against challenge with Leishmania (Leishmania) chagasi in beagle dogs vaccinated with recombinant A2 protein. Vaccine 2008;26:5888–95. Fujiwara RT, Vale AM, Franca da Silva JC, da Costa RT, Quetz Jda S, Martins Filho OA, et al. Immunogenicity in dogs of three recombinant antigens (TSA, LeIF and LmSTI1) potential vaccine candidates for canine visceral leishmaniasis. Vet Res 2005;36:827–38. Giunchetti RC, Correa-Oliveira R, Martins-Filho OA, Teixeira-Carvalho A, Roatt BM, de Oliveira Aguiar-Soares RD, et al. Immunogenicity of a killed Leishmania vaccine with saponin adjuvant in dogs. Vaccine 2007;25:7674–86. Lemesre JL, Holzmuller P, Cavaleyra M, Goncalves RB, Hottin G, Papierok G. Protection against experimental visceral leishmaniasis infection in dogs immunized with purified excreted secreted antigens of Leishmania infantum promastigotes. Vaccine 2005;23:2825–40. Mayrink W, Genaro O, Silva JC, da Costa RT, Tafuri WL, Toledo VP, et al. Phase I and II open clinical trials of a vaccine against Leishmania chagasi infections in dogs. Mem Inst Oswaldo Cruz 1996;91:695–7. Fernandes CB, Junior JT, de Jesus C, Souza BM, Larangeira DF, Fraga DB, et al. Comparison of two commercial vaccines against visceral leishmaniasis in dogs from endemic areas: IgG, and subclasses, parasitism, and parasite transmission by xenodiagnosis. Vaccine 2014;32:1287–95. Parra LE, Borja-Cabrera GP, Santos FN, Souza LO, Palatnik-de-Sousa CB, Menz I. Safety trial using the Leishmune vaccine against canine visceral leishmaniasis in Brazil. Vaccine 2007;25:2180–6. Selvapandiyan A, Dey R, Gannavaram S, Lakhal-Naouar I, Duncan R, Salotra P, et al. Immunity to visceral leishmaniasis using genetically defined liveattenuated parasites. J Trop Med 2012;2012:631460. Selvapandiyan A, Dey R, Nylen S, Duncan R, Sacks D, Nakhasi HL. Intracellular replication-deficient Leishmania donovani induces long lasting protective immunity against visceral leishmaniasis. J Immunol 2009;183: 1813–20. Silvestre R, Cordeiro-da-Silva A, Ouaissi A. Live attenuated Leishmania vaccines: a potential strategic alternative. Arch Immunol Ther Exp (Warsz) 2008;56:123–6. Selvapandiyan A, Debrabant A, Duncan R, Muller J, Salotra P, Sreenivas G, et al. Centrin gene disruption impairs stage-specific basal body duplication and cell cycle progression in Leishmania. J Biol Chem 2004;279:25703–10. Fiuza JA, Santiago Hda C, Selvapandiyan A, Gannavaram S, Ricci ND, Bueno LL, et al. Induction of immunogenicity by live attenuated Leishmania donovani centrin deleted parasites in dogs. Vaccine 2013;31:1785–92. Vale AM, Fujiwara RT, da Silva Neto AF, Miret JA, Alvarez DC, da Silva JC, et al. Identification of highly specific and cross-reactive antigens of Leishmania species by antibodies from Leishmania (Leishmania) chagasi naturally infected dogs. Zoonoses Public Health 2009;56:41–8. Alves CF, de Amorim IF, Moura EP, Ribeiro RR, Michalick MS, Kalapothakis E, et al. Expression of IFN-gamma, TNF-alpha, IL-10 and TGF-beta in lymph nodes associates with parasite load and clinical form of disease in dogs naturally infected with Leishmania (Leishmania) chagasi. Vet Immunol Immunopathol 2009;128:349–58. de Almeida Ferreira S, Leite RS, Ituassu LT, Almeida GG, Souza DM, Fujiwara RT, et al. Canine skin and conjunctival swab samples for the detection and quantification of Leishmania infantum DNA in an endemic urban area in Brazil. PLoS Negl Trop Dis 2012;6:e1596. Giunchetti RC, Reis AB, da Silveira-Lemos D, Martins-Filho OA, Correa-Oliveira R, Bethony J, et al. Antigenicity of a whole parasite vaccine as promising candidate against canine leishmaniasis. Res Vet Sci 2008;85:106–12. Campi-Azevedo AC, Gazzinelli G, Bottazzi ME, Teixeira-Carvalho A, CorreaOliveira R, Caldas IR. In vitro cultured peripheral blood mononuclear cells from patients with chronic schistosomiasis mansoni show immunomodulation of cyclin D1,2,3 in the presence of soluble egg antigens. Microb Infect 2007;9:1493–9. Fiuza JA, Fujiwara RT, Gomes JAS, Rocha M.OdC. Chaves AT, de Araujo FF, et al. Profile of central and effector memory T cells in the progression of chronic human chagas disease. PLoS Negl Trop Dis 2009;3:e512. Datta S, Manna M, Khanra S, Ghosh M, Bhar R, Chakraborty A, et al. Therapeutic immunization with radio-attenuated Leishmania parasites through i.m. route revealed protection against the experimental murine visceral leishmaniasis. Parasitol Res 2012;111:361–9. Dey R, Meneses C, Salotra P, Kamhawi S, Nakhasi HL, Duncan R. Characterization of a Leishmania stage-specific mitochondrial membrane protein that enhances the activity of cytochrome c oxidase and its role in virulence. Mol Microbiol 2010;77:399–414. Handman E. Leishmaniasis: current status of vaccine development. Clin Microbiol Rev 2001;14:229–43. Kedzierski L, Zhu Y, Handman E. Leishmania vaccines: progress and problems. Parasitology 2006;133(Suppl.):S87–112. Selvapandiyan A, Duncan R, Debrabant A, Lee N, Sreenivas G, Salotra P, et al. Genetically modified live attenuated parasites as vaccines for leishmaniasis. Indian J Med Res 2006;123:455–66. Reis AB, Teixeira-Carvalho A, Giunchetti RC, Roatt BM, Coura-Vital W, Nicolato Rde C, et al. Cellular immunophenotypic profile in the splenic compartment during canine visceral leishmaniasis. Vet Immunol Immunopathol 2014;157:190–6.

288

J.A. Fiuza et al. / Vaccine 33 (2015) 280–288

[30] Solano-Gallego L, Koutinas A, Miro G, Cardoso L, Pennisi MG, Ferrer L, et al. Directions for the diagnosis, clinical staging, treatment and prevention of canine leishmaniosis. Vet Parasitol 2009;165:1–18. [31] Lachaud L, Chabbert E, Dubessay P, Dereure J, Lamothe J, Dedet JP, et al. Value of two PCR methods for the diagnosis of canine visceral leishmaniasis and the detection of asymptomatic carriers. Parasitology 2002;125: 197–207. [32] Vercosa BL, Lemos CM, Mendonca IL, Silva SM, de Carvalho SM, Goto H, et al. Transmission potential, skin inflammatory response, and parasitism of symptomatic and asymptomatic dogs with visceral leishmaniasis. BMC Vet Res 2008;4:45. [33] Araujo MS, de Andrade RA, Sathler-Avelar R, Magalhaes CP, Carvalho AT, Andrade MC, et al. Immunological changes in canine peripheral blood leukocytes triggered by immunization with first or second generation vaccines against canine visceral leishmaniasis. Vet Immunol Immunopathol 2011;141:64–75. [34] Araujo MS, de Andrade RA, Vianna LR, Mayrink W, Reis AB, Sathler-Avelar R, et al. Despite Leishvaccine and Leishmune trigger distinct immune profiles, their ability to activate phagocytes and CD8+ T-cells support their highquality immunogenic potential against canine visceral leishmaniasis. Vaccine 2008;26:2211–24.

[35] Roatt BM, Aguiar-Soares RD, Vitoriano-Souza J, Coura-Vital W, Braga SL, CorreaOliveira R, et al. Performance of LBSap vaccine after intradermal challenge with L. infantum and saliva of Lu. longipalpis: immunogenicity and parasitological evaluation. PLoS One 2012;7:e49780. [36] Pinelli E, Gonzalo RM, Boog CJ, Rutten VP, Gebhard D, del Real G, et al. Leishmania infantum-specific T cell lines derived from asymptomatic dogs that lyse infected macrophages in a major histocompatibility complex-restricted manner. Eur J Immunol 1995;25:1594–600. [37] Guerra LL, Teixeira-Carvalho A, Giunchetti RC, Martins-Filho OA, Reis AB, Correa-Oliveira R. Evaluation of the influence of tissue parasite density on hematological and phenotypic cellular parameters of circulating leukocytes and splenocytes during ongoing canine visceral leishmaniasis. Parasitol Res 2009;104:611–22. [38] Resende LA, Roatt BM, Aguiar-Soares RD, Viana KF, Mendonca LZ, Lanna MF, et al. Cytokine and nitric oxide patterns in dogs immunized with LBSap vaccine, before and after experimental challenge with Leishmania chagasi plus saliva of Lutzomyia longipalpis. Vet Parasitol 2013;198:371–81. [39] Dey R, Natarajan G, Bhattacharya P, Cummings H, Dagur PK, Terrazas C, et al. Characterization of cross-protection by genetically modified live-attenuated Leishmania donovani parasites against Leishmania mexicana. J Immunol 2014;193(Oct 1 (7)):3513–27, http://dx.doi.org/10.4049/jimmunol.1303145.