VIROLOGY

187,423-432

(1992)

V3 Loop Region of the HIV-1 gp120 Envelope

Protein

Is Essential

for Virus Infectivity

LUCINDA A. IVANOFF,*,’ JOHN W. DUBAY,t JANE F. MORRIS,* SUSAN J. ROBERTS-I LESTER GUTSHALL,* EDMUND J. STERNBERG,” ERIC HUNTER,t THOMAS J. MATTHEWS,+ AND STEPHEN R. PETTEWAY, JR.* *SmithKline Beecham Pharmaceuticals, Department of Antiinfectives, P. 0. Box 1539, King of Prussia, Pennsylvania 19406-0939, tuniversity of Alabama at Birmingham, Department of Microbiology, UAB Station, Birmingham, Alabama 35294, and *Duke University Medical Center, Department of Surgery, Lasalle Street Extension, Durham, North Carolina 27710 Received October 9, 1991; accepted

December

9, 1997

The mechanism by which HIV-i mediates cell fusion and penetrates target cells, subsequent to receptor (CD4) binding, is not well understood. However, neutralizing antibodies, which recognize the principal neutralizing determinants of the gpl20 envelope protein (the V3 loop region, residues 296 to 331), have been shown to effectively block cell fusion and virus infectivity independent of the initial gpl20-CD4 binding. To investigate the role of the V3 loop in an HIV infection, a series of site-specific mutations were introduced into the HIV-1 envelope gene. Specifically, each residue (312 to 315) in the strongly conserved tetrapeptide sequence, GPGR, which is positioned in the center of the V3 loop domain was individually altered. The processing, transport, and CD4 binding properties of the mutant envelope proteins were comparable to those of the wild-type protein, however, none of the mutants were able to form syncytia in the HeLa-T4 assay. Molecular HIV-1 clones containing mutations altering the G312, G314, or R315 residues produced noninfectious virions, whereas a clone with a P313A mutation was found to be infectious. These results demonstrate that certain V3 loop mutations can be lethal and clearly indicate that this region of the HIV-1 gpl20 protein is essential 0 1992 Academic Press, Inc. for virus infectivity.

manner (Goudsmit et al., 1988; Palker et al., 1988; Rusche et a/., 1988; Javaherian et a/., 1989; Kenealy et a/., 1989; Matsushita et a/., 1988; Skinner et al., 1988a). Moreover, these neutralizing antibodies do not interfere with gpl20 binding to CD4 (Skinner et al., 1988b; Linsley et al., 1988). Other studies (Maddon et a/., 1986; Tersmette et al., 1989) have indicated that the initial binding of the gpl20 envelope protein to CD4 is required, but not sufficient, for cell entry. In particular, mouse cells transfected with the CD4 gene (Maddon et a/., 1986) or CD4-expressing human-murine Tcell hybrids (Tersmette et a/., 1989) were found to be resistant to HIV-l infection, and it was suggested that the block in infection most likely occurred at a membrane fusion step. A fusogenic region has also been identified within the amino terminus of the transmembrane protein (gp41) and shown to be important in facilitating cell fusion (Freed et a/., 1990). Therefore, it appears that a complex series of interactions involving the two envelope proteins (gpl20 and gp41) and possibly other domains of CD4 (Camerini and Seed, 1990) and/or cellular surface factors (Hattori eta/., 1989) may be necessary in order to promote virion-membrane fusion and penetration of target cells. The amino acid sequence of the V3 loop region can vary substantially among different HIV-1 isolates. Within this hypervariable region, LaRosa et a/. (1989) have identified a conserved GPGR tetrapeptide sequence which is situated in the center of most V3 loop

INTRODUCTION The precursor envelope protein of the human immunodeficiency virus type-l (HIV-l)’ is processed to two mature products, the exterior surface (gpl20) and the transmembrane (gp41) glycoproteins. The gpl20 protein binds tightly to CD4, the cellular receptor for HIV-1 (Dalgleish et a/., 1984; Klatzman et a/., 1984; Lasky et a/., 1987), and antibodies that disrupt the gpl20-CD4 interaction are able to block infection (Dalgleish et al., 1984; Klatzman et al., 1984; McDougal et a/., 1986; Sun et al., 1989). An invariant cysteine loop structure (Leonard et a/., 1990), termed the V3 loop, is found in the gpl20 protein encompassing residues 296 to 331 of the BH 1O-specific envelope sequence. This loop region in addition to being hypervariable in amino acid sequence (LaRosa eta/., 1989) also contains the principle neutralizing determinants of the virus (Goudsmit et a/., 1988; Palker et a/., 1988; Rusche et a/., 1988; Javaherian et al., 1989; Kenealy et a/., 1989). Virus infectivity and syncytia formation (i.e., cell-to-cell fusion) are effectively blocked by antibodies that recognize V3 loop determinants, although in an isolate-specific

’ To whom reprint requests and correspondence should be addressed. a Abbreviations used: HIV-l, human immunodeficiency virus type 1; bp, base pair: RT, reverse transcriptase; PBS, phosphate-buffered saline. 423

0042.6822/92

$3.00

Copyright 0 1992 by Academic Press. Inc. All rights of reproduction in any form reserved.

424

IVANOFF ET AL.

sequences. On the basis of modeling programs, these authors have proposed a structure for the V3 loop, predicting that the GPGR motif forms a ,&turn between two P-sheet side regions, each of which encodes the more variable sequences. Freed et al. (199 1) and Helseth e! al. (1990) have recently shown that mutations in the V3 loop sequence can eliminate or reduce syncytia formation that is mediated by recombinant HIV-l envelope proteins in a nonviral in vitro assay, highlighting a potential role for the V3 loop. Similar results were obtained earlier by Kowalski et al. (1987) in the analysis of a V3 insertion mutation. In another study (Willey et a/., 1989) a spontaneous revertant (now possessing a change in the V3 loop) of an inactive mutant HIV-l virus was capable of partially restoring virus infectivity. More recently, we have demonstrated that a proviral HIV-l clone possessing a site-specific mutation, where the proline residue in the conserved GPGR of the V3 loop was changed to alanine (P3 13A), generated mutant virions having altered virus infectivity and neutralization properties (Ivanoff et al., 1991). These results indicate that the V3 loop has a functional role in virus infectivity. However, there has been no direct evidence that the integrity of the V3 loop is a requirement for infection. In this study, we describe an analysis of single amino acid substitutions in the V3 loop region that result in a complete block of virus infectivity. MATERIAL

AND METHODS

Restriction enzymes were purchased from Promega, the Sequenase sequencing kit was from United States Biochemical, and the PCR kit and Taq polymerase were from Perkin-Elmer Cetus. [a(-32P]dATP(3000 Gil mmol), [35S]methionine (1232.7 Ci/mmol), and [3H]leucine (100 Ci/mmol) were obtained from New England Nuclear and [32P]lTP (400 Ci/mmol) was from Amersham. All cell culture media was purchased from GIBCO. HEPES buffer was obtained from Sigma. Oligonucleotides were synthesized using the Applied Biosystem Model 1380A DNA synthesizer and purified as recommended.

TCTGGAT, respectively. For the G3 141 mutation, the GGG codon was changed to ATC with the oligonucleotide 5’CAAATGCTCTGA7TGGTCCTCT. The R315F mutation changed the AGA codon to T’TT with the oligonucleotide YTGTAACAAATGCAAACCCTGGTCCTC. For the P313A mutation, the CCA codon was converted to GCT as previously described (Ivanoff et a/., 1991). After confirming the presence of each mutation by DNA sequencing (Sanger et al., 1977) the mutant Bglll fragments were inserted into a pBR322 vector containing the 2.7-kbp SalIIBamHI fragment (positions 5366 to 8052) of the BHlO genome. For the mammalian expression studies, the 2.7-kbp mutant Sa/I/ BarnHI fragment was subcloned into the pSRH vector, where the expression of the envelope gene is under the control of the SV40 late promotor (details of this expression system will be published elsewhere). Double-stranded DNA sequencing of the vector was used to verify the presence of the mutant sequences. To position the mutated envelope fragment into a transfectable HIV-l vector, the 2.7-kbp mutant SalIIBamHI BHl O-derived fragment was inserted into the pHXB2gpt viral vector (Ratner et al., 1987), creating a chimeric HIV-1 molecular clone bearing the desired mutation. The presence of the mutation in the viral vector was confirmed by Southern analysis using the mutant oligonucleotide as a probe and by DNA sequencing. The chimeric molecular clone, pHXB2/10, encodes a BH 1O-specific gpl20 envelope gene. Tissue culture

conditions

Cos-1 and HeLa-T4 cell lines were grown in DMEM medium; 10% fetal calf serum; penicillin G at 100 unit/ ml; and streptomycin sulfate at 100 pg/ml. The HeLaT4 line is the Maddon line obtained from the AIDS Research and Reference Reagent Program. The T-lymphocyte cell lines (Sup-T1 and CEM) and the EBV-transformed B-lymphocyte cell line (AA5) were maintained in RPMI 1640 medium; 10% fetal calf serum; penicillin G at 100 units/ml; and streptomycin sulfate at 100 pg/ml.

Construction of V3 loop mutations

Analysis

Recombinant DNA techniques were performed as described in Maniatis eta/. (1982). Individual mutations were introduced into a M 13 vector containing the 580bp Bglll envelope fragment (positions 6618 to 7198) of the BH 10 genome (Ratner et al., 1985) using the oligonucleotide-directed mutagenesis method of Zoller and Smith (1984). Specifically, the G312D and G3 12T mutations were created by altering the GGA codon to GAT or ACT using the oligonucleotides 5’TGCTCTCCC TGGATCTCTCTGGAT or 57GCTCTCCCTGGAGTTC-

The mutant constructs in the pSRH vector (10 pg/ plate) were transfected into 60-mm plates of Cos-1 cells using a modified CaCI, technique (Chen and Okayama, 1987). Cells were metabolically labeled 48 hr post-transfection by starving the cells for 60 min in serum-free MEM lacking leucine and then pulse labeling for 30 min in 800 ~1of the same medium containing 100 &i [3H]leucine. After the pulse, cells were washed with PBS and either lysed immediately (pulse lysate) or incubated in complete medium for an additional 3 hr

of envelope

glycoprotein

expression

V3 LOOP OF HIV-1 gp120

and then lysed (chase lysate). Cell lysates were immunoprecipitated with serum from an HIV-1-infected individual and analyzed on an SDS-polyacrylamide gel, and protein bands were visualized by fluorography. Syncytia assay HeLa-T4 cells were transfected with the pSRH wildtype and mutant vectors using a modified DEAE-dextran transfection method. Cells were seeded at 3 X 1O5 tells/35-mm plate, incubated for 16 hr at 37”, and then washed three times with serum-free medium. Subsequently, 1 pg of plasmid DNA mixed with 250 pg DEAE-dextran in 250 ~1 serum-free medium was added and the cells were incubated at 37” for 45 min. The cells were again washed, treated for 2 min at room temperature with 1 ml of 20% DMSO, washed again, and then incubated for 4 hr in complete growth medium containing chloroquine (100 &‘). At 48 hr posttransfection, cells were stained by the May-Grunwald/ Giemsa method. Briefly, the cells were washed with PBS, incubated with 1 ml of May-Grunwald stain (0.25% in methanol) for 10 min, and then washed with distilled water for 10 min. Giemsa stain was added (l/ 25 dilution of 0.4% stock) and further incubated for 30 min before washing with distilled water. CD4 binding assay The CD4 binding assay was performed essentially as described by Olshevsky et a/. (1990). Briefly, 60-mm plates of Cos-1 cells were transfected with pSRH vector containing either the wild-type or the mutant envelope gene. The transfection was performed using DEAE-dextran followed by chloroquine treatment for 4 hr. Forty-eight hr post-transfection, the cells were pulse labeled with 150 PCi [35S]methionine for 30 min and chased in complete medium for 4 hr. Subsequently, the medium was removed and incubated with 5 X lo7 SupTl cells for 90 min at room temperature. The cells were centrifuged at 1000 gfor 5 min, washed once in PBS, and lysed in buffer containing lo/o NP40, 0.1 o/oSDS, 0.5% sodium deoxycholate in PBS. The cell lysates, as well as the supernatants, which had been adjusted to the same detergent concentrations, were immunoprecipitated with serum from an HIV-l -infected individual and analyzed on 8% SDS-PAGE. As a specificity control, SupTl cells were incubated for 1 hr at 4” with an excess of a competing monoclonal antibody (Leu3A) to the gp120 binding site on CD4. The cells were then incubated with culture supernatants from the wild-type transfected cells and incubated as described above.

425

lmmunofluorescence For surface immunofluorescence, Cos-1 cells were seeded on glass coverslips, transfected with CaCI, as above, and stained for gpl20 surface expression using the monoclonal antibody 9284 (DuPont), which is specific for the V3 loop of the gp120 protein. The cells were stained by washing with ice-cold PBS and then adding a 1: 10 dilution of antibody (in PBS) and incubating for 30 min at 4”. The cells were washed with PBS and then fixed in 4% paraformaldehyde for 30 min at 4”. Following a PBS wash, the cells were counterstained with goat anti-mouse antibody conjugated to Texas red. For internal immunofluorescence staining of the HeLa-T4 cells, the cells were first fixed in 95% ethanol/5% acetic acid followed by three washes in PBS and then stained as described above. Analysis of virus infectivity HIV-l proviral vector DNA (10 pg) was introduced into Cos-1 cells (seeded at 1 X 1O6 cells in PlOO dishes) using the calcium-phosphate precipitation method (Graham and van der Eb, 1973). Following an incubation of 4-6 hr at 37”, the cells were shocked with 7.5% glycerol/HEPES for 2 min at 37”, washed once, and fed with fresh DMEM. Twenty-four hours later (considered as Day 0 postinfection), the medium was removed and replaced with 2 X 1O6SupTl cells in a total volume of 10 ml fresh RPMI 1640 medium. On Day 3 postinfection, the cultures were transferred to T75 flasks and fed every other day. The culture supernatants were routinely tested for reverse transcriptase (RT) activity using a microtiter assay (Willey et a/., 1988). PCR and sequencing analysis A volume of cells containing approximately 6 X 1O6 cells was centrifuged at 800 rpm for 10 min, then washed with 10 ml PBS, and recentrifuged. The resulting cell pellet was resuspended in 1 ml lysis buffer (50 mM KCI, 10 mMTris-HCI, pH 8.3, 2.5 mM MgCI,, 0.1 mg/ml gelatin, 0.45% Nonidet P-40, 0.45% Tween 20, and 0.06 mg/ml proteinase K) (Higuichi, 1989). The cells were lysed at 55” for 3 hr and then boiled for 10 min to inactivate the proteinase K. The V3 loop region was amplified in a Perkin-Elmer Cetus thermal cycler using 25 ~1 of the above lysate in a total reaction volume of 100 ~1containing 10 mM Tris-HCI, pH 8.3, 50 m/l/l KCI, 1.5 mM MgCI,, 200 pM each deoxynucleotide triphosphate (dNTP), 0.3 pM PCR-1, PCR-2, and Taq polymerase (4 units) for 40 cycles at 94”, 35”, and 72” for 1.5, 2, and 3 min, respectively. PCR-1:5’ACTGCTGTTAAATGGCAGTC (positions 6575-6594); PCR-

426

IVANOFF

A.

3>PGR A

Q

F V T I

a s’ K R T N N

G K I G MN

N pR

T

DNAKTIIVQLNQSVEINC 296

6.

AQR

H -CNlSRAKWNNTLKQlD

ET AL.

changed to either a threonine (G312T) or to an aspartic acid (G3 12D). The G3 12D mutation would introduce a negatively charged residue into the overall positively charged V3 loop sequence. The proline at position 313 was changed to alanine (P313A) as previously described (Ivanoff eta/., 1991) the glycine at position 314 was changed to isoleucine (G3141),and the arginine at 315 to a phenylalanine (R315F). The position of each mutation was verified by DNA sequencing. Effect of V3 loop mutations and processing

on envelope

expression

331

G312-D

(GGA - GAT)

G312.T P313-A

(GGA - ACT) (CCA - GCT)

G314-I

(GGG - ATC)

R315-F

(AAA - TTT)

FIG. 1. Amino acid sequence

of the V3 loop region. (A) Residues 296 to 331 of the gpl20 protein derived from the BH 10 sequence (Ratner et al., 1985) are schematically outlined. The GPGR motif, which is predictive of a type II P-turn and highly conserved among different HIV-1 isolates, is shown capitalized. (B) V3 loop mutations. Mutations altering the GPGR residues are listed. The engineered DNA changes for the individual codon mutations are shown in parentheses

2:57GCGGlTACAAllTCTGGGTC (positions 69036922). A 350-bp product was specifically amplified, then gel-purified, and sequenced by the dideoxy method (Sanger eta/., 1977). Specifically, ZOO-800 ng of purified PCR fragments was sequenced in a total volume of 20 ~1 containing 1 unit Sequenase, 10 &i [(u-32P]dATP,and 1 pg sequencing primer (57AGATCTGCCAAllXACAG-positions 6617-6636) according to the manufacturer’s protocol, except that the labeling reactions were carried out at room temperature for 30-60 sec. Following gel electrophoresis, the results were visualized by autoradiography.

To rule out the possibility that changes in the V3 loop region affected the synthesis or processing of the mutant glycoproteins, the mutant envelope genes were cloned into an SV40-based expression vector (pSRH). The plasmids were transfected into Cos-1 cells, and the cells metabolically labeled in a pulse-chase experiment as described under Materials and Methods. The cell lysates were immunoprecipitated with HIV-positive serum. As shown in Fig. 2, the gpl20 cleavage product as well as the precursor protein (gp160) were immunoprecipitated from the wild-type lysate. A similar pattern of protein products was observed for the G312D, G312T, G3141, P313A, and R315F lysates, which indicates that these mutant envelope proteins were all synthesized and processed normally. Since terminal glycosylation and precursor cleavage require transport from the rough endoplasmic reticulum to the Golgi complex, these results suggest that the efficiency of transport for the mutant envelope proteins is similar to that of the wild type glycoprotein. These results confirm that the mutations in the V3 loop region did not significantly affect the ability of the glycoprotein to be processed. Effect of V3 loop mutations syncytia formation

on CD4 binding

and

It has been shown that mutations throughout the gpl20 region can alter the CD4 binding capacity of the

RESULTS Mutagenesis of the V3 loop region of the gp120 envelope gene

Single amino acid substitutions designed to alter the highly conserved GPGR motif in the V3 loop region (Fig. 1) were introduced into the gpl20 envelope gene derived from the BH 10 genome using oligonucleotide-directed mutagenesis. The codon mutations were designed to incorporate at least two and in some cases three base pair changes so to minimize the possibility of simple reversion in culture. The first residue in this putative turn motif sequence, glycine 312, was

( WT gp160 gp120

lG312D

fG312Tl

G3141 (P313AIR315F]

-+ -b

FIG. 2. Synthesis and processing of wild-type and mutant envelope glycoproteins expressed from the pSRH vector. Transfected Cos-1 cells were metabolically labeled with [35S]methionine for a 30-min pulse and then chased for 4 hr. The labeled cells were lysed and then immunoprecipitated with serum from an HIV-l-infected individual. The precursor glycoprotein, gp160, and the cleaved product, gpl20, are indicated.

V3 LOOP OF HIV-1 gp120 pSRH

C

1

G3141

C

G312D

MIC

MIC

/

1

P313A

MlC

1

plasma membrane. This fusion can be mimicked with

G312T

M

MIC

427

R315F

M

FIG. 3. CD4 binding of the wild-type and mutant envelope glycoproteins. Supernatants from Cos-1 cells transfected with the pSRH vector containing either the wild-type or the mutant envelope genes were incubated with 5 X 1 O7SupTl T-cells. Following a 90-min incubation, the cell lysates (C) as well as the culture medium supernatants (M) were prepared and immunoprecipitated with HIV-1 -positive serum as described under Materials and Methods. The gp120 bound to the SupTl T-cells and that remaining in the supernatants are shown.

HIV-l envelope protein (Helseth et al., 1990; Olshevsky et a/., 1990). Thus to determine the impact of the V3 loop mutations on this property, the CD4 binding ability of the mutant envelope proteins was assessed in a manner similar to the method of Olshevsky et al. (1990). Cos-1 cells transfected with the pSRH vectors were metabolically labeled with [35S]methionine and the culture supernatants were then incubated with CD4-positive cells (SupTl T-cells). For analysis, both the cell lysates (C) and the culture supernatants (M) were individually immunoprecipitated with the HIV-positive serum. In this way, the amount of gpl20 bound to the SupTl cells relative to the amount remaining in the supernatant can be analyzed and gross differences in CD4 binding efficiency can be detected. As shown in Fig. 3, the wild-type glycoprotein was capable of binding efficiently to the CD4-positive cells (pSRH, lane C). This binding was completely blocked by the CD4-specific monoclonal antibody OKT4A, thus confirming the specificity of the interaction since OKT4A binds to the CD4 molecule and blocks the binding of gpl20 to CD4 (data not shown). As expected, soluble gpl20 was also found in the culture supernatant (pSRH, lane M). Each of the mutant envelope proteins was found to bind similar amounts to the SupTl cells, indicating that the mutations did not eliminate CD4 binding (Fig. 3, C lanes). Furthermore, comparable levels of released gpl20 were detected in all the supernatant samples (M lanes). While this method is only qualitative and does not determine the affinity of CD4 for gpl20, it is able to detect gross differences in CD4 binding. It is evident from these results that the CD4 binding ability of the mutant envelope proteins has been maintained. One important function of the envelope glycoprotein is to mediate the fusion of the virus with the host cell

in vitro assays (Willey et a/., 1988; Helseth et a/., 1990; Freed et a/., 1991) by exposing receptor-bearing cells to cells expressing the viral glycoprotein. To study the effects of these mutations on the ability of the mutant glycoproteins to cause fusion, the mutant envelope genes in the pSRH vector were transfected into HeLaT4 cells using DEAE-dextran. Forty-eight hours after transfection, the cells were stained and scored for the appearance of syncytia (Fig. 4). As shown in Fig. 4A, large multinucleated syncytia were observed with the wild-type envelope. In contrast, no syncytia were detected in cells transfected with any of the mutant genes (Figs. 4B-4D). The lack of syncytia formation with the mutants was not due to a defect in glycoprotein expression in the HeLa-T4 cells since immunofluorescent staining of fixed cells showed equivalent numbers of brightly staining single cells (Figs. 4E-4H). Because of the lack of detectable syncytia formation, surface immunofluorescence was performed to ensure that the envelope glycoprotein was being transported to the cell surface. Cos-1 cells transfected with the pSRH vectors were stained with a monoclonal antibody specific for gp120 and further processed as described under Materials and Methods. Cells expressing the wild-type envelope showed a surface fluorescence consistent with the expression of the glycoprotein on the membrane surface (Fig. 5). A similar pattern of surface expression was observed for all the mutant proteins. The data indicate that these V3 loop mutant envelope proteins are transported to the cell surface in a manner similar to that of the wild-type protein. Moreover, the results are consistent with the metabolic labeling experiments, since the glycoprotein is thought to be cleaved in a late compartment of the Golgi complex as it is being transported to the cell surface. Effect of V3 loop mutations

on virus infectivity

The ability of the mutant molecular clones to generate virus particles capable of establishing a stable infection was next analyzed. Cos-I cells were transfected with the proviral DNAs and virus production was monitored by measuring RT activity in the culture supernatant. By Day 2 of the transfection, RT activity was detectable in the control (HXB2/10) and all mutant culture supernatants, indicating the presence of released virions (data not shown). To further study the infectivity of the mutant viruses, cocultivation experiments were conducted. Purified vector DNAs were introduced into Cos-1 cells and then 24 hr later CD4-positive target cells (SupTl or CEM T-cells) were added to the culture. As shown in Fig. 6, the control clone (HXB2/10) quickly

428

IVANOFF

ET AL.

1991), we have shown that a P313A mutant clone was also capable of producing infectious virus particles. An infectivity profile similar to the control was detected on the SupTl cells (Fig. 6). Within the same lo-day time frame, however, we did not observe a productive infection with the other mutant clones. It became apparent that those particular amino acid substitutions (i.e., G312D, G312T, G3141, and R315F) which altered either the glycine or the arginine residues in the conserved GPGR motif were critical for infection and resulted in the production of noninfectious virions. To determine if the defective phenotype was the direct result of the V3 loop mutations, total cellular extracts were prepared from the coculture cells and a 350-bp region encompassing the V3 loop domain was amplified by PCR methodology. The amplified DNA

FIG. 4. Syncytia formation in HeLa-T4 cells. HeLa-T4 cells were plated into 35mm dishes and transfected with the pSRH vectors. Two days after transfection, the cells were stained by the MayGrunwald/Giemsa technique as described under Materials and Methods. (A) Wild-type envelope gene. (B) G312D. (C) G3141. (D) P3 13A. lmmunofluorescent staining of the glycoprotein-producing HeLa-T4 cells was carried out after ethanol/acetic acid fixation and incubation with a mouse monoclonal antibody (9284) to the V3 loop as described under Materials and Methods. (E) WT. (F) G312D. (G) G3141. (H) P313A. Similar results were observed with the G3 12T and R315F mutants (data not shown).

established an HIV-l infection. There were high RTvalues coincident with the formation of syncytia at Days 5-7 postinfection. In an earlier study (Ivanoff et a/.,

FIG. 5. Cell surface expression of wild-type and mutant envelope glycoproteins. Cos-1 cells were plated on glass coverslips and transfected with the pSRH vectors. Surface immunofluorescence was performed using the V3 loop-specific monoclonal antibody, 9284, as described under Materials and Methods. (A) Wild-type. (B) G312D. (C) G312T. (D) G3 141. (E) P3 13A. (F) Mock. Similar results were observed with the R315F mutant (data not shown).

V3 LOOP OF HIV-l

0 2

4

6 Time

8 (days

10

12

14

16

post-infection)

FIG. 6. Infectivity profile of HIV-1 proviral DNAs in coculture. Cos-1 cells were transfected with the HIV-1 proviral vector DNAs as described under Materials and Methods. Twenty-four hours after transfection, the media was removed and replaced with 2 X 1 O6 SupTl T-cells in a total volume of 10 ml of fresh media. On Day 3 postinfection, the cultures were transferred to T-75 flasks and fed every other day. RT levels in the culture supernatants were measured and recorded up to 14 days postinfection. Results are representative of at least two separate cocultivation experiments. HXB2/10 (0); P313A (0); G312D (El); G314l (0); G312T (+); R315F (B)

fragments were used directly for DNA sequencing (data not shown). From samples taken on Day 5 postinfection, when peak RT levels for the HXB2/10 and P313A cultures are observed, the DNA sequence derived from the HXB2/10 culture matched precisely the BHI 0 sequence. The P313A culture had maintained the alanine codon (GCT) at position 313. Similarly, the individually engineered mutations were clearly evident in the other mutant cultures. Other variations from the control sequence (BH 10) were not detected. On the basis of these data, we would conclude that certain mutations in the GPGR motif of the V3 loop sequence are lethal. DISCUSSION Within the hypetvariable V3 loop region of the different HIV-l gp120 envelope proteins, the tetrapeptide sequence GPGR (residues 312 to 315 in the IIIB strain) has been highly conserved, being present in 90% of the natural HIV-1 isolates analyzed in one study (LaRosa et al., 1989). Many potent HIV-specific neutralizing antibodies (Goudsmit et al., 1988; Palker et al., 1988; Rusche et al., 1988; Javaherian et al., 1989; Kenealyetal., 1989; Matsushita eta/., 1988; Skinneret al., 1988a) have been shown to recognize epitopes

gp120

429

that map to the V3 loop region and in certain cases to include the GPGR sequence. This GPGR sequence is highly indicative of a type II ,&turn structure (Wilmont and Thornton, 1988) and, as such, may impart a defined secondary structure to the loop, as previously suggested (LaRosa et a/., 1989). In general, the second, third, and fourth positions in the type II P-turn motif sequence are dominated by proline, glycine, and arginine/glutamine residues, respectively, with no strong sequence preference for the first position (Wilmont and Thornton, 1988). Interestingly, from the different HIV-1 gpl20 sequences derived from field isolates (LaRosa et al., 1989), a glycine residue is present at the first position of this tetrapeptide sequence 98% of the time. Hence, it is conceivable that the GPGR sequence has been maintained for structural and possibly functional reasons. In support of a functional role, recent studies have indicated that the V3 loop region is important for mediating syncytia formation (Helseth et a/., 1990; Freed et al., 1991) and may also be involved in defining cell specificity(O’Brien eta/., 1990; Shioda eta/., 1991; Takeuchi et a/., 1991). In particular, recombinant viruses where the V3 region was exchanged between a T-lymphotropic and a monotropic HIV molecular clone (O’Brien et al., 1990; Shioda et al., 1991) as well as discrete point mutations (Ivanoff et al., 1991; Takeuchi et al., 199 1), have been shown to alter the original cell tropism of the cloned viruses. In this study, each residue in the GPGR sequence was individually altered using an oligonucleotide-directed mutagenesis strategy. The mutant envelope proteins were found to be efficiently expressed and processed to the mature glycoprotein products in two mammalian cell lines. We have shown that the proteins are localized to the cellular membrane, as determined by surface immunofluorescence, at levels comparable to the BH 1O-specific envelope protein. Their reactivity with the V3 loop-specific monoclonal antibody, 9284, would indicate that these particular mutations have not significantly disrupted the overall conformation of the V3 loop in the mutant envelope proteins. The structural integrity of the mutant envelope proteins is further supported by the fact that each was capable of specifically interacting with the CD4 molecule. The results of immunoprecipitations demonstrated no significant difference in the envelope-CD4 interaction for the mutants. From these studies, the expression, processing, transport, and CD4 binding of the mutant envelope proteins appear to be qualitatively normal, however, slight differences in the affinity of the CD4-envelope interaction would be undetectable by these methods. Enveloped viruses, in general, can be introduced into host cells following adsorption by either receptormediated endocytosis or direct fusion of the viral and

430

IVANOFF

cell membranes (Fan and Sefton, 1978; Knipe, 1991). For HIV-l, virus entry into CD4-positive target cells occurs primarily through the second route by a pH-independent mechanism (McClure et al., 1987; Stein et al., 1987). The course of events involved in this fusion process are not well understood, but the formation of multinucleated cells (syncytia) has been clearly demonstrated in vitro (Dalgleish et al., 1984; Maddon et a/., 1986; Sodroski et a/., 1986; Lifson et al., 1986; Willey et a/., 1988; Helseth et a/., 1990; Freed et al., 1991). In the nonviral in vitro assay (Willey et al., 1988; Freed et al., 1991), cultures containing CD4-positive target cells (i.e., HeLa-T4) and cells expressing HIV-l envelope proteins are capable of generating syncytia and it is thought that this phenomenon may mimic, at least partially, the virion-cell fusion process. The involvement of the V3 loop in the fusion function of the envelope protein was recently identified by Freed et al. (199 1). Point mutations altering the proline, glycine, or arginine (PGR) residues at positions 313 to 315 in a recombinant gpl20 protein were shown to inhibit syncytia formation in this assay. In our study, we observed similar results with the P313A, G3141, and R315F mutations and further demonstrate that alteration of the first residue in the turn motif (G312) to either an aspartic acid (G312D) or a threonine (G312T) residue also prevented syncytia formation. A certain degree of amino acid variability within the GPGR motif is observed in the sequences derived from different natural HIV-1 isolates, but these are also accompanied by additional changes in the V3 loop sequence (LaRosa et a/., 1989). Clearly, the ability of the HIV-l envelope protein to mediate fusion, at least with the HeLa-T4 target cells, is sensitive to amino acid changes in the putative turn motif of the V3 loop. How the impairment of this envelope function may correlate with virus infectivity has not been addressed in previous reports. In this study, we have introduced the mutant envelope genes into an infectious HIV-1 molecular clone in order to study this question. As shown in the cocultivation studies, the control (HXB2/ 10) and the proviral clone containing the P313A mutation were capable of producing infectious virus partcles. This is in contrast to our observation that the P313A envelope protein was defective in forming syncytia in the HeLa-T4 assay. However, we have recently reported (Ivanoff et al,, 1991) that the P313A virus has a reduced infectivityforAA5 cells, a B-cell line that is highly permissive to an HIV-1 infection (Chaffee et a/., 1988) when compared to SupTl T-cells. One explanation is that the P313A envelope protein may fuse inefficiently with the membrane of AA5 cells, as it does with HeLa-T4 cells and, as such, this step may become rate limiting in the infection process. These

ET AL.

results suggest that a deficiency in the in vitro syncytia formation may be one indicator of virus infectivity. The other substitutions which altered eitherthe glycine residues (G312D, G312T, or G314l mutations) or the arginine residue (R315F mutation) in the conserved GPGR motif of the V3 loop resulted in a complete block of virus infectivity, and it is conceivable that the defect in fusion for these mutants may be more restrictive. One mechanism has been suggested where a cleavage event targeting the V3 loop of gp120 and involving a cellular protease may be important in an HIV-l infection. In support of this hypothesis, a Kunitz-type protease inhibitor (trypstatin), whose reactive site bears a strong homology to the GPGR sequence found in the V3 loop of gpl20, has been shown to block HIV-l -induced syncytia formation (Hattori et al., 1989). Clements et al, (1991) have further reported that the V3 loop region in the envelope proteins of both HIV-1 and HIV-2 possess proteolytic cleavage sites. It is important to recognize that a direct correlation between a putative processing site in the V3 loop and virus infectivity has not been demonstrated. Future studies will be required to address what effect, if any, these envelope mutants may have on the susceptibility of the V3 loop region to proteolysis. It is, however, tempting to speculate that the fusion process may play an important role in helping to determine cell tropism. On the basis of the data presented in this report, we would conclude that the V3 loop region of the gp120 envelope protein has a functional role that appears to be essential for virus infectivity. ACKNOWLEDGMENTS We thank Dr. B. Metcalf and Dr. D. Bolognesi for helpful discussions and continuous support and J. Manze for assistance in preparing the manuscript.

REFERENCES CAMERINI, D., and SEED, 6. (1990). A CD4 domain important for HIV mediated syncytium formation lies outside the virus binding site. Cell 60, 747-754. CHAFFEE, S. E., LEEDS, J. M.. MATTHEWS, T. J., WEINHOLD, K. J., SKINNER, M., BOLOGNESI,D. P., and HERSHFIELD,M. S. (1988). Phenotypic variation in the response to the human immunodeficiency virus among derivatives of the CEM T and WILZB cell lines. J. Exp. Med. 168, 605-621. CHEN, C., and OKAYAMA, H. (1987). High efficiency transformation of mammalian cells by plasmid DNA. Mol. Ce//. Biol. 7, 2745-2752. CLEMENTS, G. J., PRICE-JONES,M. J., STEPHENS, P. E., SUI-~ON, C., SCHULZ, T. F., CLAPHAM, P. R., MCKEATING, J. A., MCCLURE, M. O., THOMSON, S., MARSH, M., Knv, J., WEISS, R. A., and MOORE, J. P. (1991). The V3 loops of the HIV-1 and HIV-2 surface glycoproteins contain proteolytic cleavage sites: A possible function in viral fusion? AIDS Res. Hum. Retroviruses 7, 3-l 6. DALGLEISH, A., BEVERLY, P., CLAPHAM, P., CRAWFORD, D., GREAVES, M., and WEISS, R. (1984). The CD4 (T4) antigen is an essential

V3 LOOP OF HIV-1 gp120 component of the receptor for the AIDS retrovirus. Nature 312, 763-766. FAN, D. P., and SEFTON, B. M. (1978). The entry into host cells of sindbis virus, vesicular stomatitis virus and sendai virus. Cell 15, 985-992. FREED, E. O., MYERS, D. I., and RISSER,R. (1990). Characterization of the fusion domain of the human immunodeficiency virus type 1 envelope glycoprotein gp41. Proc. Nat/. Acad. Sci. USA 87,46504654. FREED, E. O., MYERS, D. .I., and RISSER,R. (1991). Identification of the principal neutralizing determinant of human immunodeficiency virus type 1 as a fusion domain. J. Viral. 65, 190-l 94. GOUDSMIT, J., DEBOUCK,C., MELOEN, R.. SMIT, L., BAKKER,M., ASHER, D., WOLFF, A., GIBBS, C., and GAIDUSEK,C. (1988). Human immunodeficiency virus type 1 neutralization epitope with conserved architecture elicits early type-specific antibodies in experimentally infected chimpanzees. Proc. Nat/. Acad. Sci. USA 85,4478-4482. GRAHAM, F. L., and VAN DER EB, A. J. (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA. Viro/ogy52,456467. HATORI, T., KOITO, A., TAKATSUKI, K., KIDO, H., and KATUNUMA, N. (1989). Involvement of tryptase-related cellular protease in human immunodeficiency virus type-l infection. FEBS Lett. 248,4852. HELSETH, E., KOWALSKI,M., GABUZDA, D., OLSHEVSKY,U., HASELTINE, W., and SODROSKI,J. (1990). Rapid complementation assays measuring replicative potential human immunodeficiency virus type 1 envelope glycoprotein mutants. 1. Viral. 64, 2416-2420. HIGUICHI, R. (1989). Simple and rapid preparation of samples for PCR. In “PCR Technology: Principles and Applications for DNA Amplification” (H. A. Erlich, Ed.), Stockton Press, New York. IVANOFF, L. A., LOONEY, D. J., MCDANAL, C., MORRIS, J. F., WONGSTAAL, F., LANGLOIS, A. J., PET~EWAY,S. R., and MATTHEWS, T. J. (1991). Alteration of HIV-1 infectivity and neutralization by a single amino acid replacement in the V3 loop domain. AlLIS Res. Hum. Retroviruses 7, 595-603. JAVAHERIAN,K., LANGLOIS, A. J., MCDANAL, C., Ross, K. L., ECKLER, L. I., JELLIS C. L., PROFY, A. T., RUSCHE, J. R., BOLOGNESI, D. P., PUTNEY, S. D., and MATTHEWS, T. J. (1989). Principle neutralizing domains of the human immunodeficiency virus type 1 envelope protein. Proc. Nat/. Acad. Sci. USA 86, 6768-6772. KENEALY,W. R., MATTHEWS, T. J., GANFIELD, M. C., LANGLOIS, A. J., WASELEFSKY,D. M., and PE-TTEWAY,S. R. (1989). Antibodies from human immunodeficiencyvirus-infected individuals bind to a short amino acid sequence that elicits neutralizing antibodies in animals. AIDS Res. Hum. Retroviruses 5, 173-182. KLATZMAN, D., CHAMPAGNE, E., CHAMARET, S., GRVEST,J., GEUTARD, D., HERCEND, T., GLUCKMAN, J. C., and MONTAIGNER, L. (1984). Tlymphocyte T4 molecule behaves as the receptor for human retrovirus LAV. Nature 312, 767-768. KNIPE, D. M. (1991). Virus-host-cell interactions. ln “Fields Virology” (B. N. Fields, D. M. Knipe et a/., Eds.), Second ed. Raven Press, New York. KOWALSKI,M., POTZ, J., BASIRIPOUR,L., DORFMAN. T., GOH, W., TERWILLIGER, E., DAMON, A., ROSEN, C., HASELTINE,W., and SODROSKI,J. (1987). Functional regions of the envelope glycoprotein of human immunodeficiency virus type 1. Science 237, 1351-l 355. LAROSA, G., DAVIDE, J. P., WEINHOLD, K., WATERBURY,J. A., PROP/, A. T., LEWIS,J. A., LANGLOIS,A. J., DRESSMAN,G. R., BOSWELL,R. N., SHADDUCK, P., HOLLEY, L. H., KARPLUS, M., BOLOGNESI, D. P., MATTHEWS,T. J., EMINI, E. A., and PUTNEY,S. D. (1989). Conserved sequence and structural elements in the HIV-1 principal neutralizing determinant. Science 249, 932-935. LASKY, L. A., NAKAMURA, G., SMITH, D. H., FENNIE, C., SHIMASAKI, C., PATZER, E., BERMAN, P., GREGORY,T., and CAPON, D. J. (1987).

431

Delineation of a region of the human immunodeficiency virus type 1 gpl20 glycoprotein critical for interaction with the CD4 receptor. Cell 50, 975-985. LEONARD, C. K., SPELLMAN, M. W., RIDDLE, L., HARRIS, R. J., THOMAS, J. N., and GREGORY,T. J. (1990). Assignment of intrachain disulfide bonds and characterization of potential glycosylation sites of the type-l recombinant human immunodeficiency virus envelope glycoprotein (gp120) expressed in Chinese hamster ovary cells. /. Biol. Chem. 265, 10,373-l 0,382. LIFSON, J. D., FEINBERG.M. B., REYES,G. R., RABIN, L., BANAPOUR,B., CHAKRABARTI,S., Moss, B., WONGSTAAL, F., STEIMER, K. S., and ENGLEMAN. E. G. (1986). Induction of CD4-dependent cell fusion by the HTLV-III/LAV envelope glycoprotein. Nature 323, 725-728. LINSLEY, P., LEDBETTER,J., KINNEY-THOMAS, E., and Hu, S.-L. (1988). Effects of anti-gpl20 monoclonal antibodies on CD4 receptor binding by the env protein of human immunodeficiency virus type 1. J. Viral. 62, 3695-3702. MADDON, P. J., DALGLEISH,A. G., MCDOUGAL, J. S., CLAPHAM, P. R., WEISS, R. A., and ABEL, R. (1986). The T4 gene encodes the AIDS virus receptor and is expressed in the immune system and the brain. Cell 47, 333-348. MANIA% T., FRITSCH, E. F., and SAMBROOK, J. (1982). “Molecular Cloning: A Laboratory Manual.” Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. MATSUSHITA, S., ROBERT-GUROFF,M., RUSCHE,J., KOIFO, A., HATTORI, T., HOSHINO, H., JAVAHERIAN, K., TAKATSUKI, K., and PUTNEY, S. (1988). Characterization of the human immunodeficiency virus neutralizing monoclonal antibody and mapping of the neutralizing epitope. f. Viral. 62, 2 107-21 14. MCCLURE, M. O., MARSH, M., and WEISS, R. A. (1987). Human immunodeficiency virus infection of CD4-bearing cells occurs by a pHindependent mechanism. EMBO J. 7, 513-518. MCDOUGAL, J., NICHOLSON,J., CROSS, G., CORT, S., KENNEDY,M., and MAWLE, A. (1986). Binding of the human retrovirus HTLV-IIl/LAV/ ARV/HIV to the CD4 (T4) molecule: Conformation dependence, epitope mapping, antibody inhibition and potential for idiotypic mimicry. J. lmmunol. 137, 2937-2944. O’BRIEN, W. A., KOYANAGI, Y., NAMAZIE, A., ZHAO, J-Q., DIAGNE, A., IDLER, K., ZUCK, J. A., and CHEN, I. S. Y. (1990). HIV-1 tropism for mononuclear phagocytes can be determined by regions of gpl20 outside the CD4-binding domain. Nature 348, 69-73. OLSHEVSKY,U., HELSETH, E., FURMAN, C., LI, J., HASELTINE.W., and SODROSKI,J. (1990). Identification of individual human immunodeficiency type 1 gpl20 amino acids important for CD4 receptor binding. J. Viral. 64, 5701-5707. PALKER,T. J., CLARK, M. L., LANGLOIS, A. J., MATI-HEWS, T. J., WEINHOLD, K. J., RANDALL, R., BOLOGNESI, D. P., and HAYNES, B. F. (1988). Type-specific neutralization of human immunodeficiency virus with antibodies to env-encoded synthetic peptides. Proc. Natl. Acad. Sci. USA 85, 1932-l 936. RATNER, L. R., HASELTINE,W., PATARCA, R., LIVAK. K. J., STARCICH, B., JOSEPH% S. F., DORAN, E. R., RAFALSKI,J. A., WHITEHORN, E. A., BAUMEISTER,K., IVANOFF, L., PET~EWAY,S. R., PEARSON,M. L., LAUTENBERGER,1. A., PAPAS, T. S., GHRAYEB,J., CHANG, N. T., GALLO, R. C., and WONGSTAAL, F. (1985). Complete nucleotide sequence of the AIDS virus, HTLV-III. Nature 313, 277-284. RATNER, L., FISHER, A., JAGODZINSKI,L. L., MITSUGA, H., GIOU, R. S., GALLO, R. C., and WONGSTAAL, F. (1987). Complete nucleotide sequence of functional clones of the AIDS virus. AlDS Res. Hum. Retroviruses 3, 57-69. RUSCHE, J. R., JAVAHERIAN,K., MCDANAL, C., PETRO, J., LYNN, D. L., GRIMAIIA, R., LANGLOIS, A., GALLO, R. C., ARTHUR, L. O., FISCHINGER,P. J., BOLOGNESI,D. P., PUTNEY,S. D., and MATTHEWS,T. J. (1988). Antibodies that inhibit fusion of human immunodeficiency

432

IVANOFF

virus-infected cells bind a 24-amino acid sequence of the viral envelope, gpl20. Proc. Nat/. Acad. Sci. USA 85, 3 198-3202. SANGER, F., NICKLENS,S., and COULSON, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Nat/. Acad, SC;. USA 74, 5463-5467. SHIODA, T., LEVY, J. A., and CHENG-MAYER, C. (1991). Macrophage and T-cell line tropisms of HIV-1 are determined by specific regions of the envelope gpl20 gene. Nature 349, 167-l 69. SKINNER, M. A., TING, R., LANGLOIS, A. J., WEINHOLD, K. J., LYERLY, H. K., JAVAHERIAN,K., and MATTHEWS,T. J. (1988a). Characteristics of a neutralizing monoclonal antibody to the HIV envelope glycoprotein. AIDS Res. Hum. Retroviruses 4, 187-l 94. SKINNER, M. A., LANGLOIS, A. J., MCDANAL, C. B., MCDOUGAL, J. S., BOLOGNESI,D. P., and MATTHEWS, T. J. (198813). Neutralizing antibodies to an immunodominant envelope sequence do not prevent gpl20 binding to CD4. J. Viral. 62, 4195-4200. SODROSKI,J., GOH, W. L., ROSEN, C., CAMPBELL, K., and HASELTINE, W. A. (1986). Role of the HTLV-lII/LAV envelope in syncytium formation and cytopathicity. Nature 322, 470-474. STEIN, B. S., GOWDA, S. D., LIFSON, J. D., PENHALLOW,R. C., BENSCH, K. G., and ENGLEMAN, E. G. (1987). pHindependent HIV entry into CD4-positive T cells via virus envelope fusion to the plasma membrane. Cell 49, 659-668. SUN, N. C., Ho, D. D., SUN, R. Y. C., LIOU, R. S., GORDON, W., FUNG, M. S. C., LI, X. L., TING, R. C., LEE, T. H., CHANG, N. T., and CHANG, T. W. (1989). Generation and characterization of monoclonal anti-

ET AL. bodies to the putative CD4-binding domain of human immunodeficiency virus type 1 gpl20. J. Viral. 63, 3579-3585. TAKEUCHI, Y., AKUTSU, M., MURAYAMA, K., SHIMIZU, N., and HOSHINO, H. (1991). Host range mutant of human immunodeficiency virus type 1: Modification of cell tropism by a single point mutation at the neutralization epitope in the env gene. J. viral. 65, 17 1O-l 718. TERSMETTE, M., VAN DONGEN, J. J. M., CLAPHAM, P. R., DEGOODE, R. E. Y., WOLVERS-TE~ERO, I. L. M., GEURTSVAN KESSEL,A., HUISMAN, J. G., WEISS, R. A., and MIEDEMA, F. (1989). Human immunodeficiency virus infection studied in CD4-expressing human-murine T-cell hybrids. Virology 168, 267-273. WILLEY, R. L., SMITH, D. H., LASKY, L. A., THEODORE,T. S., EARL, P. L., MARS, B., CAPON, D. J., and MARTIN, M. A. (1988). In vitro mutagenesis identifies a region within the envelope gene of the human immunodeficiency virus that is critical for infectivity. J. Viral. 62, 139-147. WILLEY, R. L., Ross, E. K., BUCKLER-WHITE,A. J., THEODORE,T. S., and MARTIN, M. A. (1989). Functional interaction of constant and variable domains of human immunodeficiency virus type 1 gp120.J. Viral. 63, 3595-3600. WILMONT, C. M., and THORNTON, J. M. (1988). Analysis and prediction of the different types of P-turn in proteins. J. Mol. Biol. 203, 221232. ZOLLER, M. J., and SMITH, M. (1984). Oligonucleotide-directed mutagenesis: A simple method using two oligonucleotide primers and a single stranded DNA template. DNA 3, 479-488.