Insect Science (2015) 22, 95–105, DOI 10.1111/1744-7917.12101
ORIGINAL ARTICLE
Expression, subcellular localization and protein–protein interaction of four isoforms of EcR/USP in the common cutworm Li-Xia Huang, Yan-Jun Gong, Jun Gu, Bao-Juan Zeng, Li-Hua Huang and Qi-Li Feng Laboratory of Molecular and Developmental Entomology, Guangdong Provincial Key Laboratory of Biotechnology for Plant Development, School of Life Sciences, South China Normal University, Guangzhou, China
Abstract Ecdysone receptor (EcR) and ultraspiracle (USP) form heterodimers to mediate ecdysteroid signaling during molting and metamorphosis. Various EcR/USP heterodimers have been reported. However, it is unclear what kind of EcR/USP combination is adopted by lepidopteran insects during the larval–pupal metamorphosis and whether the EcR/USP heterodimer varies among different tissues. To address these questions, two isoforms of each EcR and USP were cloned from the common cutworm, their messenger RNA expression patterns were examined by real-time quantitative polymerase chain reaction in different tissues during the larval–pupal metamorphosis and in the midgut in response to hormonal induction. Furthermore, their subcellular localization and protein–protein interaction were explored by transient expression and far-western blotting, respectively. All the four genes were significantly up-regulated in prepuae and/or pupae. The expression profiles of EcRB1 and USP1 were nearly identical to each other in the epidermis, fat body and midgut, and a similar situation also applied to EcRA and USP2. The three genes responded to 20-hydroxyecdysone (20E) induction except for USP2, and USP1 could be up-regulated by both 20E and juvenile hormone. The four proteins mainly localized in the nucleus and the nuclear localization was promoted by 20E. The protein–protein interaction between each EcR and USP was found in vitro. These results suggest that two types of EcR/USP heterodimer (EcRA/USP2 and EcRB1/USP1) may exist simultaneously in the common cutworm, and the latter should play more important roles during the larval–pupal metamorphosis. In addition, the types of EcR/USP heterodimer do not vary in the tissues which undergo histolysis and regeneration during metamorphosis. Key words ecdysone receptor; protein interaction; subcellular localization; ultraspiracle
Introduction Ecdysone receptor (EcR) forms a heterodimer with ultraspiracle (USP), the homolog of retinoid X receptor in vertebrates, and play key roles in regulating many insect
Correspondence: Li-Hua Huang, Guangdong Provincial Key Lab of Biotechnology for Plant Development, School of Life Sciences, South China Normal University, Guangzhou 510631, China. Tel: +86 2085 210 024; fax: +86 2085 215 291; email: [email protected]
physiological processes, including molting, metamorphosis and reproduction (Bonneton et al., 2003). Both EcR and USP belong to a superfamily of steroid nuclear receptor (NR), which shares a common organization consisting of at least four structural domains: A/B, C, D and E regions (or domains), and some receptors such as EcR also have F-region located at the C-terminal. The A/B domain presents at the N-terminal and is highly variable (Nakagawa & Henrich, 2009). Three EcR (EcRA, EcRB1 and EcRB2) and one USP isoforms have been identified in Drosophila melanogaster, whereas, two isoforms of each EcR (EcRA and EcRB1) and USP (USP1 and USP2) have 95
C 2014
Institute of Zoology, Chinese Academy of Sciences
96
L. X. Huang et al.
been found in many lepidopteran species, such as Bombyx mori (Sekimoto et al., 2006), Manduca sexta (Fujiwara et al., 1995; Jindra et al., 1997), Choristoneura fumiferana (Perera et al., 1999) and Plutella xylostella (Tang et al., 2012). Multiple isoforms of EcR and USP with different A/B domains seem to arise through the alternative use of promoters and splicing (Henrich, 2009). Different isoforms of EcR and USP usually show specific expression profiles. EcR and USP are widely studied in the model insect, D. melanogaster. The DmEcRs were expressed in a tissue-restricted pattern. The DmEcRA was expressed predominantly in the imaginal discs, and the DmEcRB1 was expressed highly in the larval tissues that are fated for histolysis (Talbot et al., 1993; Kim et al., 1999). In addition, the expression of DmEcRs is correlated with metamorphic processes. The expression of DmEcRs was undetectable in the neurons during the larval molts; DmEcRB1 showed high levels at the start of metamorthosis, and DmEcRA dominated during the pupal–adult transformation (Truman et al., 1994). Generally, DmEcRA predominates when cells are undergoing maturational responses, and DmEcRB1 predominates during proliferative or regressive responses (Nakagawa & Henrich, 2009). It seems that the expression of DmEcRB1 proceeds that of the A isoform. However, this rule does not work well in the lepidopteran species. For example, the EcRB1 was predominant in the wing imaginal disc in B. mori (Kamimura et al., 1997), which is different from the situation in D. melanogaster. In addition, the expression of BmEcRA isoform preceded that of the B1 isoform by 2 days in the anterior silk gland in the fourth instar (Kamimura et al., 1997). A similar phenomenon was also found in the epidermis. The BmEcRB1 presented during the commitment and predifferentiative phases and then at the onset of cuticle synthesis EcRA prevailed (Jindra et al., 1996). The USP is less studied. In B. mori, USP1 was expressed at relatively high levels throughout silkworm metamorphosis, while USP2 was up-regulated at just the beginning of wandering and pupation. This expression patterns appear to be coordinate with the pulse of ecdysone during metamorphosis (Cheng et al., 2008). Both EcR and USP are mainly located in the nucleus. USP contains only nuclear localization signal (NLS) within the DNA-binding domain, whereas EcR has both NLS and nuclear export signal (NES), which exists in the ligand binding domain (Gw´oz´ d´z et al., 2007). It explains the fact that USP exhibits exclusively in the nucleus, but EcR presents in both the cytoplasm and nucleus (Nieva et al., 2005). However, the subcellular localization is not always fixed. The intracellular distribution of EcR varied and was dependent on time and cell type. The majority C
of CHO-K1 cells contained the fusion EcR in the nucleus approximately 6 h after transfection, and later the percentage of cells with exclusively nuclear localization decreased continuously and the number of cells containing EcR in nuclei as well as in cytoplasm or mainly in the cytoplasm gradually increased (Nieva et al., 2005). In addition, the hormone often has a significant influence on the intracellular localization. In Chirononmus tentans EcR was present in the cytoplasm to a considerable degree and was shifted into the nucleus by molting hormone (Lammerding-K¨oppel et al., 1998). Different isoforms of EcR or USP reveal distinct temporal and spatial expression patterns, suggesting each isoform may have a unique function. In D. melanogaster, the EcRB1 mutants failed to pupate and ecdysone responses were inhibited in larval and imaginal tissues that normally expressed high levels of EcRB1, while the initiation of ecdysone responses in tissues that normally expressed high levels of EcRA was permitted (Bender et al., 1997). The B2 isoform was required for proper development of the larval epidermis and the border cells of the developing egg chamber (Cherbas et al., 2003). The A isoform has been implicated in the remodeling of neurons (Robinow et al., 1993; Truman et al., 1994; Davis et al., 2005) and normal development of wing disc margins (Cherbas et al., 2003) and salivary gland (Davis et al., 2005). Such studies demonstrate that the individual Drosophila EcR isoforms are not equivalent in their performance. Several isoforms exist in each EcR and USP, and this raises a question about which isoforms of EcR and USP form the effective heterodimer to mediate 20E signaling. A delayed-early gene encoding MHR3 could be activated by EcRB1/USP1 but not by EcRB1/USP2 in Manduca GV1 cells (Lan et al., 1999). It indicates that EcRB1/USP1 seems to be the effective components of EcR/USP heterodimer. However, USP2 was also suggested to be the major partner for EcR in Aedes aegypti, because it revealed stronger affinity to ecdysteroidresponsive element (EcRE) than USP1 (Wang et al., 2000). In addition, EcRA/USP2 but not EcRB1/USP1 was indicated to be the components of EcR/USP complex according to their expression profiles and responsive effects to 20E in the anterior silk gland of B. mori (Sekimoto et al., 2006). The types of EcR/USP heterodimer may also vary in different developmental stages. Both EcRB1 and USP1 were up-regulated during each inter-molt period, whereas EcRA and USP2 increased their levels during the larval molts in M. sexta (Jindra et al., 1996; Asahina et al., 1997; Jindra et al., 1997; Hiruma et al., 1999; Riddiford et al., 1999). It is likely that EcRA/USP2 and EcRB1/USP1 play their roles in different developmental stages, and the former in the larval molts and the latter in 2014 Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
Characteristics of four isoforms of EcR/USP
97
Table 1 Primer sequences used for real-time quantitative polymerase chain reaction. Gene
Primer sequence (5 →3 )
Fragment length (bp)
GenBank accession no.
EcRA
CCCAAATGGAAAAATAGGTCGT GACGAGACATAGCTCCTCTTGTT GCGTGCTCTTCTTACCTGTT CTATCCACTGTCTTGACTTTCG ATGTCAGTGGCGAAGAAAGA ATCCAGCGAACAGTCAACAG ATGGAGCCCTCGAGAGATTCAG CCGACGCTCTGTCTCCACATA
130
HM046618
116
JQ730731
177
JQ730733
205
JQ730734
EcRB1 USP1 USP2
the inter-molts. These findings suggest that effective components of EcR/USP change in various species or even in different tissues and developmental stages. Larval–pupal metamorphosis is one of the most important developmental stages in holometabolous insects. During the period, histolysis and regeneration take place in lots of important tissues, such as epidermis, fat body and midgut. It is unclear what kind of EcR/USP combination is adopted by lepidopteran insects during the larval–pupal metamorphosis and whether the EcR/USP heterodimer varies among different tissues. In order to address the above questions, an agricultural pest, the common cutworm Spodoptera litura (Lepidoptera: Noctuidae) was chosen, two isoforms of each EcR and USP were cloned, and their messenger RNA (mRNA) expression patterns were examined in different tissues during the larval–pupal metamorphosis and in response to hormonal induction. Their subcellular localization and protein– protein interaction were also explored. Our results indicate that two types of EcR/USP heterodimer (EcRA/USP2 and EcRB1/USP1) may exist simultaneously in the common cutworm, and the latter should play more important roles during larval–pupal metamorphosis. In addition, the types of EcR/USP heterodimer do not vary in the tissues which undergo histolysis and regeneration during metamorphosis.
Materials and methods Insect samples The population of S. litura was reared according to a previous method (Huang et al., 2011). The newly molted sixth instar larvae (with white head) were referred to as 0h-old, and then the insects were sampled every 24 h until they developed into pupae (144 h). For hormonal treatments, 2 μg juvenile hormone (JH) III (J2000, Sigma, St. C 2014
Louis, MO, USA) or 20E (H5142, Sigma) was injected into the 0-h-old larvae, and the samples were collected after 3, 6 and 12 h. The same amount of dimethyl sulphoxide (DMSO) was injected into insects as a control. Different tissues, including the epidermis, fat body and midgut were isolated according to our earlier methods (Shen et al., 2011; Gu et al., 2013). Each treatment included more than three individual larvae and was repeated three times.
Gene cloning and sequence analysis EcR and USP were first identified from the transcriptome of common cutworm (Gu et al., 2013). To get the full-length complementary DNAs (cDNAs), 5 or 3 RACE (rapid amplification of cDNA ends) and reverse transcription polymerase chain reaction (RT-PCR) were carried out using specific and degenerate primers. The relevant information is not shown in this study. Finally, specific primers were designed to amplify the open reading frames (ORFs). The primers and GenBank accession numbers are listed in Table 1. DNAMAN software package (Lynnon Corporation, Pointe-Claire, Quebec, Canada) was used to calculate the molecular weights (MWs) of the deduced proteins and sequence similarities among them. All the amino acid residues were considered during the similarity comparison. The A/B and DNA-binding domains were determined by the Basic Local Alignment Search Tool (BLAST) P search in GenBanK.
Real-time quantitative PCR Real-time quantitative PCR reactions and statistical analysis were performed according to our earlier methods (Shen et al., 2011; Gu et al., 2013).
Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
98
L. X. Huang et al.
Transient expression and immunocytochemistry The ORFs of EcRA and EcRB1 were cloned into pIB -EGFP (constructed from pIB/V5-His, Invitrogen, Carlsbad, CA, USA). The recombinant plasmid was transfected into S. litura embryonic cells (Spli-221) using LipofectamineTM 2000 (Invitrogen) according to the manual. For the 20E induction, the cells were treated with 0.4 μmol/L 20E (dissolved in DMSO) for 6 h, and then transferred onto a glass slide. A drop of 4 ,6-diamidino2-phenylindole (DAPI) was added on the slide to stain the nucleus of cells. The subcellular localization was observed under a confocal laser scanning microscope (LSM710, Carl-Zeiss, Jena, Germany). To observe the subcellular localization of USPs, immunocytochemistry experiments were carried out. The Spli-221cells were seeded in a 12-well tissue culture plate containing Grace’s medium, and a 13 mm cover glass was placed in each of the wells to let the cells grow on the cover glass. The plate was incubated at 26 °C for 72 h, and then 20E was added into the medium to a final concentration of 0.4 μmol/L and sustained for 6 h. The cover glass was washed with phosphate-buffered saline (PBS) solution and fixed with freshly prepared 4% paraformaldehyde solution for 15 min at room temperature. The cells were permeabilized in PBS containing 0.3% Triton X-100 for 30 min. After blocking with 2% bovine serum albumin (BSA) for 30 min at 37 °C, an antibody against both USP1 and USP2 was added in 1 : 100 dilution and incubated at 4 °C overnight. The cover glass was washed in PBS (3 × 10 min each) and incubated for 1 h with the second antibody conjugated to fluorescein isothiocyanate (FITC) dye (Alexa dye, Molecular Probes, Eugene, OR, USA) in 1 : 100 dilution. For nuclear staining, the cover glass was exposed for 15 min to DAPI solution (1 : 1000 dilution). The cover glass was washed with PBS (3 × 5 min each) and a drop of antifade solution (Beyotime Institute of Biotechnology, Shanghai, China) was added on the cover glass and then covered with a glass slide. Fluorescence was detected by the aforesaid method. The cells treated with the same amount of DMSO were used as a control.
Fig. 1 Sequence similarity among the four isoforms of ecdysone receptor (EcR) and ultraspiracle (USP). The full protein sequences of EcR and USP were aligned using DNAMAN software (Lynnon Corporation, Pointe-Claire, Quebec, Canada). The similarity was generated and marked on each branch.
EcRA and EcRB1 were separated on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidenedifluoride (PVDF) membrane. After the block and wash, the membrane was incubated with purified USP1or USP2 at room temperature for 1.5 h. The membrane was washed with TBST (1× Tris-buffered saline, 0.05% Tween-20) and subjected for western blotting analysis using the anti-USP antibody. An irrelevant protein, fatty acid binding protein (Fabp) with apparent weight of about 20 kDa (including the His-tag and true molecular weight of 14.7 kDa) (Huang et al., 2012) was used as a negative control. Results Cloning and characterization of EcR and USP Two isoforms of EcR (EcRA and EcRB1) and USP (USP1 and USP2) were cloned in the common cutworm. Their ORFs are 1 542, 1 767, 1 404, 1 245, encoding for 513, 588, 467, 414 amino acids with deduced molecular weights of 57, 66, 53 and 47 kDa, respectively. Sequence similarities are very high between isoforms of each EcR or USP, 88% in EcR and 98% in USP (Fig. 1). Slight difference is only found in the N-terminal of A/B domain (Fig. 2). However, almost no similarity exists between EcR and USP except for the DNA-binding domain (Fig. 2). Nine cysteine residues are completely conserved among the four genes (Fig. 2).
Far-western blotting Temporal and spatial expression The ORFs of four genes (EcRA, EcRB1, USP1 and USP2) were cloned into pET-32a plasmid (Novagen, Madison, WI, USA) to express his-tag fused proteins. The used primers are listed in Table 1. The recombiR nant proteins were purified using Ni-NTA His. Bind Resins (Novagen) according to the manual. The purified C
It is apparent that the mRNA abundance of both EcRB1 and USP1 are significantly higher than that of the other two genes in all the studied tissues, including the epidermis, fat body and midgut (Fig. 3). The four genes were all remarkably up-regulated in prepupae and/or pupae in 2014 Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
Characteristics of four isoforms of EcR/USP
99
Fig. 2 Alignment of the four genes coding for ecdysone receptor (EcR) and ultraspiracle (USP). The full protein sequences were aligned using DNAMAN software (Lynnon Corporation, Pointe-Claire, Quebec, Canada). The A/B and DNA-binding domains are highlighted by dashed and continuous lines, respectively. The conserved cysteine residues are marked by asterisk (*) on the top.
all the tissues. Their mRNA expression is in a time- and tissue-restricted manner. The mRNA levels of EcR and USP decreased distinctively in the pupal midgut; however, in the epidermis and fat body, the expression of four genes still sustained high levels in the pupae. The mRNA levels of four genes in the epidermis were slightly up-regulated when the individuals just developed into the sixth instar (0-h-old) as compared with that in the other larval stages (24- and 48-h-old), whereas the mRNA level kept stable during all the sixth instar stages (from the 0-h to 48-hold) in both the fat body and midgut. Difference was also found in the times to be induced during metamorphosis among the four genes. The USP2 was induced later than the others in both the epidermis and fat body. Although all the four genes were significantly up-regulated in the prepupal stage, USP2 was induced at 72 h, whereas the other three genes were not induced until the individuals entered into 96 h. It suggests that the response to 20E induction of USP2 lags behind the other three receptors in both the epidermis and fat body. Interestingly, the expression profiles of EcRB1 and USP1 were nearly identical to each other in all the three tissues, and EcRA and USP2 also revealed similar patterns. C 2014
Hormonal induction The three receptors (EcRA, EcRB1 and USP1) were significantly induced in response to 20E induction in the Spli-221 cells. Further, USP1 was also up-regulated by JH. However, USP2 responded to neither JH nor 20E. In addition, EcRA revealed quicker response to 20E than EcRB1 (Fig. 4). Subcellular localization Both EcRA and EcRB1 predominantly localized in the nucleus and a small amount of cytoplasmic counterparts moved into the nucleus during the 20E treatment (Fig. 5A). The USPs (USP1 and USP2) were exclusively localized in the nucleus (Fig. 5B). Protein–protein interaction between EcRs and USPs The in vitro experiments revealed that purified EcR (EcRA or EcRB1) interacted with both USP1 (Fig. 6A) and USP2 (Fig. 6B).
Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
100
L. X. Huang et al.
Fig. 3 Relative messenger RNA (mRNA) expression levels of four isoforms of EcR and USP in different tissues during the larval–pupal metamorphosis. A, epidermis. B, fat body. C, midgut. The newly molted sixth instar larvae (with white head) were referred to as 0-h-old, and then the insects were sampled every 24 h until they developed into pupae (144 h). The relative expression levels of EcRs and USPs are represented as the fold difference over the amount of glyceraldehyde-3-phosphate dehydrogenase (an internal control). Different letters above the columns indicate significance in the difference of expression levels by one-way analysis of variance (P < 0.05).
C
2014 Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
Characteristics of four isoforms of EcR/USP
101
Fig. 4 Relative messenger RNA (mRNA) expression levels of four isoforms of EcR and USP in response to 20-hydroxyecdysone (20E) and JH induction. Dimethyl sulphoxide was used to dissolve the hormones and also as a control. The asterisks above the columns indicate significance in the difference of expression levels by t-test analysis (P < 0.05).
Discussion Although very low sequence similarity exists between EcR and USP (Fig. 1), the DNA-binding domains are conserved, especially in the cysteine residues (Fig. 2), which are made up of two zinc-finger structures (Henrich, 2009) and are essential for trans-activation of NRs (Gr¨asser et al., 1992). In fact, a similar situation presents in nearly all the members of steroid NRs, including estrogen receptor (ER), progesterone receptor (PR), androgen receptor, glucocorticoid receptor (GR) and mineralocorticoid receptor (Fig. S1). This may explain the fact that the DNA binding elements of various steroid NRs, including EcR, GR, ER and PR, show high sequence similarities to each other (Riddihough & Pelham, 1987). Isoforms of EcR/USP have been reported to present temporal and spatial expression patterns (Jindra et al., 1996; Vafopoulou et al., 2005; Parthasarathy & Palli, 2007). These isoforms were found to play distinct functions in controlling molting and metamorphosis in the red flour beetle, Tribolium castaneum (Tan & Palli, 2008). Temporal and spatial expression was also found in the isoforms of EcR and USP in S. litura. For example, the isoforms were slightly up-regulated at the very beginning of sixth instar larvae in the epidermis rather than in both fat body and midgut (Fig. 3). The induction is apparently
C 2014
a response to the small 20E peak during each molting period (Riddiford, 1994). Interestingly, the four EcR/USP isoforms presented distinct mRNA expression profiles in the midgut as compared with those in the epidermis and fat body. In the pupae, all the four genes were significantly down-regulated in the midgut, whereas they still sustained high levels in the other two tissues (Fig. 3). These results indicate that each tissue possesses a distinctive response mechanism to 20E, or the 20E may be synthesized and secreted in an asynchronous way in different tissues. Nuclear localization is necessary for trans-activation of all nuclear receptors. The subcellular distribution of EcR/USP has been studied widely in mammalian cells, and they revealed that USP was exclusively localized in the nucleus (Nieva et al., 2005; Gw´oz´ d´z et al., 2007; Nieva et al., 2007), whereas EcR was distributed between the cytoplasm and nucleus (Nieva et al., 2007). The subcellular localization of EcR is sometimes dependent on time and cell type (Nieva et al., 2005; Gw´oz´ d´z et al., 2007). In the insect cells, USPs was distributed exclusively in the nucleus (Zheng et al., 2010); however, EcRs were localized in both the nucleus and cytoplasm (Fig. 6). The nuclear localization of both EcR and USP could be promoted by 20E treatment (Fig. 6). EcR has both NLS and NES, whereas USP has only NLS (Nieva et al., 2005; Nieva et al., 2007). Considering the different
Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
102
L. X. Huang et al.
Fig. 6 Protein-protein interaction between ecdysone receptor (EcR) and ultraspiracle (USP). The purified EcRA and EcRB1 were separated on sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto polyvinylidenedifluoride membrane. After the block and wash, the membrane was incubated with purified USP1 or USP2 at room temperature for 1.5 h. The membrane was washed with TBST (1× Tris-buffered saline, 0.05% Tween-20) and then subjected for western blotting analysis using the anti-USP antibody. An irrelevant protein Fabp (about 20 kDa, Fig. S3) was used as a negative control.
Fig. 5 Subcellular localization of four ecdysone receptor (EcR) and ultraspiracle (USP). (A) Transient expression of EcRA and EcRB1. The open reading frames of EcRA and EcRB1 were cloned into pIB-EGFP and transfected into Spli-221 cells. For the 20-hydroxyecdysone (20E) induction, the cells were treated with 0.4 μmol/L 20E (dissolved in dimethyl sulphoxide [DMSO]). The nucleus of cells was stained with 4 ,6-diamidino2-phenylindole. The subcellular localization was observed under a confocal laser scanning microscope. The nucleus and cytoplasm are denoted with “N” and “C”, respectively. (B) Immunocytochemistry of USPs. The Spli-221 cells were grown on the cover glass, and then 20E was added into the medium to a final concentration of 0.4 μmol/L and sustained for 6 h. After fixture and permeablization, anti-USP (recognizing both USP1 and USP2, Fig. S2) was added to localize the subcellular distribution of USP2. The cells treated with the same amount of DMSO were used as a control.
subcellular localizations, EcR and USP can form heterodimers in only the nucleus. This may retain EcRs in the nucleus and avoid them from returning to the cytoplasm, and therefore increases the trans-activation of EcRs. EcR and USP form heterodimers to perform their functions in steroid signaling. However, the detailed compo C
nents of EcR/USP heterodimer have not been fully discovered. The purified EcRs (EcRA and EcRB1) interacted with both USP1 and USP2 (Fig. 6). This suggests that four possible types of heterodimers, including EcRA/USP1, EcRA/USP2, EcRB1/USP1 and EcRB1/USP2, can form in vitro. However, the true situation in vivo is not clear. In Aedes aegypti, EcRB and USP-A (more like USP1 of lepidopteran species) mRNAs were detected during larval stages in larval cells, and EcRA and USP-B (more like USP2) mRNAs were detected during pupal stages in imaginal cells. These data suggest that EcRB/USP1 heterodimer is adopted in the larvae while EcRA/USP2 is in the pupae (Parthasarathy & Palli, 2007). The situation in lepidopteran insects seems to be different. In M. sexta, the MHR3 was activated by the application of EcRB1 and USP1 but not by EcRB1 and USP2 (Lan et al., 1999). However, EcRA and USP2 rather than EcRB1 and USP1 were deduced to be components of the EcR/USP complex in the anterior silk gland of B.mori (Sekimoto et al., 2006). These findings indicate that two types of heterodimers (EcRB1/USP1 and EcRA/USP2) could be adopted by lepidopteran insects and the effective combination may vary in different tissues. This hypothesis is supported by our results. The four isoforms of EcR/USP revealed two distinct mRNA expression patterns, one in EcRA and USP2 and the other in EcRB1 and USP1 (Fig. 3). It is likely that two different types of EcR/USP heterodimer (EcRA/USP2 and EcRB1/USP1) exist in the common cutworm. Even though two different heterodimers exist, their 2014 Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
Characteristics of four isoforms of EcR/USP
importance may vary from each other. It is apparent that the mRNA abundance of both EcRB1 and USP1 was significantly higher than that of the other two genes during metamophosis (Fig. 3). The higher mRNA abundance of EcRB1and USP1was also found in other insects, such as Plutella xylostella (Tang et al., 2012) and Tribolium castaneum (Tan & Palli, 2008). In addition, the trans-activation activity of EcRB1 was higher than EcRA (Ruff et al., 2009), and USP1 showed stronger 20E induction than USP2 (Fig. 4). These results suggest that EcRA/USP2 and EcRB1/USP1 heterodimers may exist simultaneously in common cutworm, and the latter should be the major combination during larval–pupal metamorphosis. However, other combinations of EcR/USP complex cannot be excluded. The presence of EcRA reduced the binding of EcRB1/USP1 complex to EcRE, because EcRA/USP1 showed no binding activity to EcRE1 (Hiruma & Riddiford, 2004). Therefore, other types of EcR/USP heterodimers may exist and play their roles in regulating the trans-activation of the effective EcR/USP by competing for the DNA binding sites. In conclusion, EcRB1 and USP1 showed identical transcriptional expression profiles, and a similar situation was also applied to EcRA and USP2. Both EcRB1 and USP1 showed higher transcription activity upon 20E induction than EcRA and USP2. The two EcRs could interact with either USP1 or USP2 in vitro. These results suggest that two types of heterodimers (EcRA/USP2 and EcRB1/USP1) may exist simultaneously in the common cutworm, and the latter should play more important roles during larval– pupal metamorphosis. In addition, the types of EcR/USP heterodimer do not vary in the tissues which undergo histolysis and regeneration during metamorphosis. These findings will be a valuable supplement and help for elucidating the mechanism of EcR/USP function. Acknowledgments The research was supported by the grants from National Natural Science Foundation of China (Grant No. 31172154) and the National Basic Research Program of China (973 Program, No. 2012CB114101). Disclosure The authors declare no conflicts of interest. References Asahina, M., Jindra, M. and Riddiford, L.M. (1997) Developmental expression of ultraspiracle proteins in the epidermis C 2014
103
of the tobacco hornworm, Manduca sexta, during larval life and the onset of metamorphosis. Development Genes and Evolution, 207, 381–388. Bender, M., Imam, F.B., Talbot, W.S., Ganetzky, B. and Hogness, D.S. (1997) Drosophila ecdysone receptor mutations reveal functional differences among receptor isoforms. Cell, 91, 777–788. Bonneton, F., Zelus, D., Iwema, T., Robinson-Rechavi, M. and Laudet, V. (2003) Rapid divergence of the ecdysone receptor in Diptera and Lepidoptera suggests coevolution between ECR and USP-RXR. Molecular Biology and Evolution, 20, 541–553. Cheng, D., Xia, Q., Duan, J., Wei, L., Huang, C., Li, Z., Wang, G. and Xiang, Z. (2008) Nuclear receptors in Bombyx mori: insights into genomic structure and developmental expression. Insect Biochemistry and Molecular Biology, 38, 1130– 1137. Cherbas, L., Hu, X., Zhimulev, I., Belyaeva, E. and Cherbas, P. (2003) EcR isoforms in Drosophila: testing tissue-specific requirements by targeted blockade and rescue. Development, 130, 271–284. Davis, M.B., Carney, G.E., Robertson, A.E. and Bender, M. (2005) Phenotypic analysis of EcR-A mutants suggests that EcR isoforms have unique functions during Drosophila development. Developmental Biology, 282, 385–396. Fujiwara, H., Jindra, M., Newitt, R., Palli, S.R., Hiruma, K. and Riddiford, L.M. (1995) Cloning of an ecdysone receptor homolog from Manduca sexta and the developmental profile of its mRNA in wings. Insect Biochemistry and Molecular Biology, 25, 845–856. Gr¨asser, F.A., LaMontagne, K., Whittaker, L., Stohr, S. and Lipsick, J.S. (1992) A highly conserved cysteine in the v-Myb DNA-binding domain is essential for transformation and transcriptional trans-activation. Oncogene, 7, 1005–1009. Gu, J., Huang, L.X., Gong, Y.J., Zheng, S.C., Liu, L., Huang, L.H. and Feng, Q.L. (2013) De novo characterization of transcriptome and gene expression dynamics in epidermis during the larval–pupal metamorphosis of common cutworm. Insect Biochemistry and Molecular Biology, 43, 794–808. Gw´oz´ d´z, T., Dutko-Gw´oz´ d´z, J., Nieva, C., Betanska, K., Orlowski, M., Kowalska, A., Dobrucki, J., Spindler-Barth, M., Spindler, K.D. and Ozyhar, A. (2007) EcR and Usp, components of the ecdysteroid nuclear receptor complex, exhibit differential distribution of molecular determinants directing subcellular trafficking. Cell Signaling, 19, 490–503. Henrich, V.C. (2009) The ecdysteroid receptor. Insect Development: Morphogenesis, Molting and Metamorphosis (ed. L.I. Gilbert), pp. 61–303. Academic Press, London. Hiruma, K. and Riddiford, L.M. (2004) Differential control of MHR3 promoter activity by isoforms of the ecdysone receptor and inhibitory effects of E75A and MHR3. Developmental Biology, 272, 510–521.
Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
104
L. X. Huang et al.
Hiruma, K., Shinoda, T., Malone, F. and Riddiford, L.M. (1999) Juvenile hormone modulates 20-hydroxyecdysone-inducible ecdysone receptor and ultraspiracle gene expression in the tobacco hornworm, Manduca sexta. Development Genes and Evolution, 209, 18–30. Huang, Y.F., Xu, Z.B., Lin, X.Y., Feng, Q.L. and Zheng, S.C. (2011) Structure and expression of glutathione S-transferase genes from the midgut of the common cutworm, Spodoptera litura (Noctuidae) and their response to xenobiotic compounds and bacteria. Journal of Insect Physiology, 57, 1033– 1044. Huang, Z.Q., Zhou, D.H., Gao, G.P., Zheng, S.C., Feng, Q.L. and Liu, L. (2012) Cloning and characterization of a midgutspecific fatty acid binding protein in Spodoptera litura. Archives of Insect Biochemistry and Physiology, 79, 1–17. Jindra, M., Huang, J.Y., Malone, F., Asahina, M. and Riddiford, L.M. (1997) Identification and mRNA developmental profiles of two ultraspiracle isoforms in the epidermis and wings of Manduca sexta. Insect Molecular Biology, 6, 41–53. Jindra, M., Malone, F., Hiruma, K. and Riddiford, L.M. (1996) Developmental profiles and ecdysteroid regulation of the mRNAs for two ecdysone receptor isoforms in the epidermis and wings of the tobacco hornworm, Manduca sexta. Devopmental Biology, 180, 258–272. Kamimura, M., Tomita, S., Kiuchi, M. and Fujiwara, H. (1997) Tissue-specific and stage-specific expression of two silkworm ecdysone receptor isoforms–ecdysteroid-dependent transcription in cultured anterior silk glands. European Journal of Biochemistry, 248, 786–793. Kim, S., Park, J.G. and Lee, C.C. (1999) Transcript titers of ecdysteroid receptor components vary between tissues and stages during Drosophila development. Molecular Cells, 28, 61–66. Lammerding-K¨oppel, M., Spindler-Barth, M., Steiner, E., Lezzi, M., Drews, U. and Spindler, K.D. (1998) Immunohistochemical localization of ecdysteroid receptor and ultraspiracle in the epithelial cell line from Chironomus tentans (Insecta, Diptera). Tissue and Cell, 30, 187–194. Lan, Q., Hiruma, K., Hu, X., Jindra, M. and Riddiford, L.M. (1999) Activation of a delayed-early gene encoding MHR3 by the ecdysone receptor heterodimer EcR-B1-USP-1 but not by EcR-B1-USP-2. Molecular and Cellular Biology, 19, 4897– 4906. Nakagawa, Y. and Henrich, V.C. (2009) Arthropod nuclear receptors and their role in molting. FEBS Journal, 276, 6128– 6157. Nieva, C., Gw´oz´ d´z, T., Dutko-Gw´oz´ d´z, J., Wiedenmann, J., Spindler-Barth, M., Wieczorek, E., Dobrucki, J., Du´s, D., Henrich, V., Ozyhar, A. and Spindler, K.D. (2005) Ultraspiracle promotes the nuclear localization of ecdysteroid receptor in mammalian cells. Biological Chemistry, 386, 463–470.
C
Nieva, C., Spindler-Barth, M., Azoitei, A. and Spindler, K.D. (2007) Influence of hormone on intracellular localization of the Drosophila melanogaster ecdysteroid receptor (EcR). Cell Signaling, 19, 2582–2587. Parthasarathy, R. and Palli, S.R. (2007) Stage- and cell-specific expression of ecdysone receptors and ecdysone-induced transcription factors during midgut remodeling in the yellow fever mosquito, Aedes aegypti. Journal of Insect Physiology, 53, 216–229. Perera, S.C., Ladd, T.R., Dhadialla, T.S., Krell, P.J., Sohi, S.S., Retnakaran, A. and Palli, S.R. (1999) Studies on two ecdysone receptor isoforms of the spruce budworm, Choristoneura fumiferana. Molecular and Cellular Endocrinology, 152, 73– 84. Riddiford, L.M. (1994) Cellular and molecular actions of juvenile hormone I. General considerations and premetamorphic actions. Advances in Insect Physiology, 24, 213–274. Riddiford, L.M., Hiruma, K., Lan, Q. and Zhou, B. (1999) Regulation and role of nuclear receptors during larval molting and metamorphosis of Lepidoptera. American Zoology, 39, 736–746. Riddihough, G. and Pelham, H.R. (1987) An ecdysone response element in the Drosophila hsp27 promoter. The EMBO Journal, 6, 3729–3734. Robinow, S., Talbot, W.S., Hogness, D.S. and Truman, J.W. (1993) Programmed cell death in the Drosophila CNS is ecdysone-regulated and coupled with a specific ecdysone receptor isoform. Development, 119, 1251–1259. Ruff, H., Tremmel, C. and Spindler-Barth, M. (2009) Transcriptional activity of ecdysone receptor isoforms is regulated by modulation of receptor stability and interaction with Ab- and C-domains of the heterodimerization partner ultraspiracle. Archives of Insect Biochemistry and Physiology, 72, 154– 171. Sekimoto, T., Iwami, M. and Sakurai, S. (2006) Coordinate responses of transcription factors to ecdysone during programmed cell death in the anterior silk gland of the silkworm, Bombyx mori. Insect Molecular Biology, 15, 281–292. Shen, Y., Gu, J., Huang, L.H., Zheng, S.C., Liu, L., Xu, W.H., Feng, Q.L. and Kang, L. (2011) Cloning and expression analysis of six small heat shock protein genes in the common cutworm, Spodoptera litura. Journal of Insect Physiology, 57, 908–914. Talbot, W.S., Swyryd, E.A. and Hogness, D.S. (1993) Drosophila tissues with different metamorphic responses to ecdysone express different ecdysone receptor isoforms. Cell, 73, 1323–1337. Tan, A. and Palli, S.R. (2008) Edysone receptor isoforms play distinct roles in controlling molting and metamorphosis in the red flour beetle, Tribolium castaneum. Molecular and Cellular Endocrinology, 291, 42–49.
2014 Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
Characteristics of four isoforms of EcR/USP Tang, B.Z., Dong, W., Liang, P., Zhou, X.G. and Gao, X.W. (2012) Cloning, ligand-binding, and temporal expression of ecdysteroid receptors in the diamondback moth, Plutella xylostella. BMC Molecular Biology, 13: 32. Truman, J.W., Talbot, W.S., Fahrbach, S.E. and Hogness, D.S. (1994) Ecdysone receptor expression in the CNS correlates with stage-specific responses to ecdysteroids during Drosophila and Manduca development. Development, 120, 219–234. Vafopoulou, X., Steel, C.G.H. and Terry, K.L. (2005) Edysteroid receptor (EcR) shows marked differences in temporal patterns between tissues during larval–adult development in Rhodnius prolixus: correlations with haemolymph ecdysteroid titres. Journal of Insect Physiology, 51, 27–38. Wang, S.F., Li, C., Zhu, J., Miura, K., Miksicek, R.J. and Raikhel, A.S. (2000) Differential expression and regulation by 20hydroxyecdysone of mosquito ultraspiracle isoforms. Developmental Biology, 218, 99–113. Zheng, W.W., Yang, D.T., Wang, J.X., Song, Q.S., Gilbert, L.I. and Zhao, X.F. (2010) Hsc70 binds to ultraspiracle resulting in the upregulation of 20-hydroxyecdsone-responsive genes in Helicoverpa armigera. Molecular and Cellular Endocrinology, 315, 282–291. Accepted December 12, 2013
C 2014
105
Supporting Information Additional Supporting Information may be found in the online version of this article at the publisher’s web-site: Fig. S1 Alignment of steroid nuclear receptors. The full amino acids were aligned using DNAMAN software. The DNA-binding domain was underlined, and the conserved cysteine residues were marked with asterisk (*) on the top. AR: androgen receptor (Gallus gallus, NP_001035179), ER: estrogen receptor (Homo sapiens, NP_000116), GR: glucocorticoid receptor (Rattus norvegicus, NP_036708), MR: mineralocorticoid receptor (Rattus norvegicus, NP_037263), PR: progesterone receptor (Bos taurus, NP_001192285). Fig. S2 Western blotting of four isoforms of EcR and USP. The four purified proteins were separated in the SDS-PAGE and transferred onto PVDF membrane. AntiUSP was added to test its specificity. The anti-USP was generated in our lab using the full length protein of B. mori USP1 (NM_001044005) as the antigen. It recognizes both USP1 and USP2 of S. litura. Fig. S3 SDS-PAGE of EcRs, USPs and Fabp. The five purified proteins were separated in the SDS-PAGE to reveal their comparative molecular weights.
Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
Copyright of Insect Science is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
ORIGINAL ARTICLE
Expression, subcellular localization and protein–protein interaction of four isoforms of EcR/USP in the common cutworm Li-Xia Huang, Yan-Jun Gong, Jun Gu, Bao-Juan Zeng, Li-Hua Huang and Qi-Li Feng Laboratory of Molecular and Developmental Entomology, Guangdong Provincial Key Laboratory of Biotechnology for Plant Development, School of Life Sciences, South China Normal University, Guangzhou, China
Abstract Ecdysone receptor (EcR) and ultraspiracle (USP) form heterodimers to mediate ecdysteroid signaling during molting and metamorphosis. Various EcR/USP heterodimers have been reported. However, it is unclear what kind of EcR/USP combination is adopted by lepidopteran insects during the larval–pupal metamorphosis and whether the EcR/USP heterodimer varies among different tissues. To address these questions, two isoforms of each EcR and USP were cloned from the common cutworm, their messenger RNA expression patterns were examined by real-time quantitative polymerase chain reaction in different tissues during the larval–pupal metamorphosis and in the midgut in response to hormonal induction. Furthermore, their subcellular localization and protein–protein interaction were explored by transient expression and far-western blotting, respectively. All the four genes were significantly up-regulated in prepuae and/or pupae. The expression profiles of EcRB1 and USP1 were nearly identical to each other in the epidermis, fat body and midgut, and a similar situation also applied to EcRA and USP2. The three genes responded to 20-hydroxyecdysone (20E) induction except for USP2, and USP1 could be up-regulated by both 20E and juvenile hormone. The four proteins mainly localized in the nucleus and the nuclear localization was promoted by 20E. The protein–protein interaction between each EcR and USP was found in vitro. These results suggest that two types of EcR/USP heterodimer (EcRA/USP2 and EcRB1/USP1) may exist simultaneously in the common cutworm, and the latter should play more important roles during the larval–pupal metamorphosis. In addition, the types of EcR/USP heterodimer do not vary in the tissues which undergo histolysis and regeneration during metamorphosis. Key words ecdysone receptor; protein interaction; subcellular localization; ultraspiracle
Introduction Ecdysone receptor (EcR) forms a heterodimer with ultraspiracle (USP), the homolog of retinoid X receptor in vertebrates, and play key roles in regulating many insect
Correspondence: Li-Hua Huang, Guangdong Provincial Key Lab of Biotechnology for Plant Development, School of Life Sciences, South China Normal University, Guangzhou 510631, China. Tel: +86 2085 210 024; fax: +86 2085 215 291; email: [email protected]
physiological processes, including molting, metamorphosis and reproduction (Bonneton et al., 2003). Both EcR and USP belong to a superfamily of steroid nuclear receptor (NR), which shares a common organization consisting of at least four structural domains: A/B, C, D and E regions (or domains), and some receptors such as EcR also have F-region located at the C-terminal. The A/B domain presents at the N-terminal and is highly variable (Nakagawa & Henrich, 2009). Three EcR (EcRA, EcRB1 and EcRB2) and one USP isoforms have been identified in Drosophila melanogaster, whereas, two isoforms of each EcR (EcRA and EcRB1) and USP (USP1 and USP2) have 95
C 2014
Institute of Zoology, Chinese Academy of Sciences
96
L. X. Huang et al.
been found in many lepidopteran species, such as Bombyx mori (Sekimoto et al., 2006), Manduca sexta (Fujiwara et al., 1995; Jindra et al., 1997), Choristoneura fumiferana (Perera et al., 1999) and Plutella xylostella (Tang et al., 2012). Multiple isoforms of EcR and USP with different A/B domains seem to arise through the alternative use of promoters and splicing (Henrich, 2009). Different isoforms of EcR and USP usually show specific expression profiles. EcR and USP are widely studied in the model insect, D. melanogaster. The DmEcRs were expressed in a tissue-restricted pattern. The DmEcRA was expressed predominantly in the imaginal discs, and the DmEcRB1 was expressed highly in the larval tissues that are fated for histolysis (Talbot et al., 1993; Kim et al., 1999). In addition, the expression of DmEcRs is correlated with metamorphic processes. The expression of DmEcRs was undetectable in the neurons during the larval molts; DmEcRB1 showed high levels at the start of metamorthosis, and DmEcRA dominated during the pupal–adult transformation (Truman et al., 1994). Generally, DmEcRA predominates when cells are undergoing maturational responses, and DmEcRB1 predominates during proliferative or regressive responses (Nakagawa & Henrich, 2009). It seems that the expression of DmEcRB1 proceeds that of the A isoform. However, this rule does not work well in the lepidopteran species. For example, the EcRB1 was predominant in the wing imaginal disc in B. mori (Kamimura et al., 1997), which is different from the situation in D. melanogaster. In addition, the expression of BmEcRA isoform preceded that of the B1 isoform by 2 days in the anterior silk gland in the fourth instar (Kamimura et al., 1997). A similar phenomenon was also found in the epidermis. The BmEcRB1 presented during the commitment and predifferentiative phases and then at the onset of cuticle synthesis EcRA prevailed (Jindra et al., 1996). The USP is less studied. In B. mori, USP1 was expressed at relatively high levels throughout silkworm metamorphosis, while USP2 was up-regulated at just the beginning of wandering and pupation. This expression patterns appear to be coordinate with the pulse of ecdysone during metamorphosis (Cheng et al., 2008). Both EcR and USP are mainly located in the nucleus. USP contains only nuclear localization signal (NLS) within the DNA-binding domain, whereas EcR has both NLS and nuclear export signal (NES), which exists in the ligand binding domain (Gw´oz´ d´z et al., 2007). It explains the fact that USP exhibits exclusively in the nucleus, but EcR presents in both the cytoplasm and nucleus (Nieva et al., 2005). However, the subcellular localization is not always fixed. The intracellular distribution of EcR varied and was dependent on time and cell type. The majority C
of CHO-K1 cells contained the fusion EcR in the nucleus approximately 6 h after transfection, and later the percentage of cells with exclusively nuclear localization decreased continuously and the number of cells containing EcR in nuclei as well as in cytoplasm or mainly in the cytoplasm gradually increased (Nieva et al., 2005). In addition, the hormone often has a significant influence on the intracellular localization. In Chirononmus tentans EcR was present in the cytoplasm to a considerable degree and was shifted into the nucleus by molting hormone (Lammerding-K¨oppel et al., 1998). Different isoforms of EcR or USP reveal distinct temporal and spatial expression patterns, suggesting each isoform may have a unique function. In D. melanogaster, the EcRB1 mutants failed to pupate and ecdysone responses were inhibited in larval and imaginal tissues that normally expressed high levels of EcRB1, while the initiation of ecdysone responses in tissues that normally expressed high levels of EcRA was permitted (Bender et al., 1997). The B2 isoform was required for proper development of the larval epidermis and the border cells of the developing egg chamber (Cherbas et al., 2003). The A isoform has been implicated in the remodeling of neurons (Robinow et al., 1993; Truman et al., 1994; Davis et al., 2005) and normal development of wing disc margins (Cherbas et al., 2003) and salivary gland (Davis et al., 2005). Such studies demonstrate that the individual Drosophila EcR isoforms are not equivalent in their performance. Several isoforms exist in each EcR and USP, and this raises a question about which isoforms of EcR and USP form the effective heterodimer to mediate 20E signaling. A delayed-early gene encoding MHR3 could be activated by EcRB1/USP1 but not by EcRB1/USP2 in Manduca GV1 cells (Lan et al., 1999). It indicates that EcRB1/USP1 seems to be the effective components of EcR/USP heterodimer. However, USP2 was also suggested to be the major partner for EcR in Aedes aegypti, because it revealed stronger affinity to ecdysteroidresponsive element (EcRE) than USP1 (Wang et al., 2000). In addition, EcRA/USP2 but not EcRB1/USP1 was indicated to be the components of EcR/USP complex according to their expression profiles and responsive effects to 20E in the anterior silk gland of B. mori (Sekimoto et al., 2006). The types of EcR/USP heterodimer may also vary in different developmental stages. Both EcRB1 and USP1 were up-regulated during each inter-molt period, whereas EcRA and USP2 increased their levels during the larval molts in M. sexta (Jindra et al., 1996; Asahina et al., 1997; Jindra et al., 1997; Hiruma et al., 1999; Riddiford et al., 1999). It is likely that EcRA/USP2 and EcRB1/USP1 play their roles in different developmental stages, and the former in the larval molts and the latter in 2014 Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
Characteristics of four isoforms of EcR/USP
97
Table 1 Primer sequences used for real-time quantitative polymerase chain reaction. Gene
Primer sequence (5 →3 )
Fragment length (bp)
GenBank accession no.
EcRA
CCCAAATGGAAAAATAGGTCGT GACGAGACATAGCTCCTCTTGTT GCGTGCTCTTCTTACCTGTT CTATCCACTGTCTTGACTTTCG ATGTCAGTGGCGAAGAAAGA ATCCAGCGAACAGTCAACAG ATGGAGCCCTCGAGAGATTCAG CCGACGCTCTGTCTCCACATA
130
HM046618
116
JQ730731
177
JQ730733
205
JQ730734
EcRB1 USP1 USP2
the inter-molts. These findings suggest that effective components of EcR/USP change in various species or even in different tissues and developmental stages. Larval–pupal metamorphosis is one of the most important developmental stages in holometabolous insects. During the period, histolysis and regeneration take place in lots of important tissues, such as epidermis, fat body and midgut. It is unclear what kind of EcR/USP combination is adopted by lepidopteran insects during the larval–pupal metamorphosis and whether the EcR/USP heterodimer varies among different tissues. In order to address the above questions, an agricultural pest, the common cutworm Spodoptera litura (Lepidoptera: Noctuidae) was chosen, two isoforms of each EcR and USP were cloned, and their messenger RNA (mRNA) expression patterns were examined in different tissues during the larval–pupal metamorphosis and in response to hormonal induction. Their subcellular localization and protein– protein interaction were also explored. Our results indicate that two types of EcR/USP heterodimer (EcRA/USP2 and EcRB1/USP1) may exist simultaneously in the common cutworm, and the latter should play more important roles during larval–pupal metamorphosis. In addition, the types of EcR/USP heterodimer do not vary in the tissues which undergo histolysis and regeneration during metamorphosis.
Materials and methods Insect samples The population of S. litura was reared according to a previous method (Huang et al., 2011). The newly molted sixth instar larvae (with white head) were referred to as 0h-old, and then the insects were sampled every 24 h until they developed into pupae (144 h). For hormonal treatments, 2 μg juvenile hormone (JH) III (J2000, Sigma, St. C 2014
Louis, MO, USA) or 20E (H5142, Sigma) was injected into the 0-h-old larvae, and the samples were collected after 3, 6 and 12 h. The same amount of dimethyl sulphoxide (DMSO) was injected into insects as a control. Different tissues, including the epidermis, fat body and midgut were isolated according to our earlier methods (Shen et al., 2011; Gu et al., 2013). Each treatment included more than three individual larvae and was repeated three times.
Gene cloning and sequence analysis EcR and USP were first identified from the transcriptome of common cutworm (Gu et al., 2013). To get the full-length complementary DNAs (cDNAs), 5 or 3 RACE (rapid amplification of cDNA ends) and reverse transcription polymerase chain reaction (RT-PCR) were carried out using specific and degenerate primers. The relevant information is not shown in this study. Finally, specific primers were designed to amplify the open reading frames (ORFs). The primers and GenBank accession numbers are listed in Table 1. DNAMAN software package (Lynnon Corporation, Pointe-Claire, Quebec, Canada) was used to calculate the molecular weights (MWs) of the deduced proteins and sequence similarities among them. All the amino acid residues were considered during the similarity comparison. The A/B and DNA-binding domains were determined by the Basic Local Alignment Search Tool (BLAST) P search in GenBanK.
Real-time quantitative PCR Real-time quantitative PCR reactions and statistical analysis were performed according to our earlier methods (Shen et al., 2011; Gu et al., 2013).
Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
98
L. X. Huang et al.
Transient expression and immunocytochemistry The ORFs of EcRA and EcRB1 were cloned into pIB -EGFP (constructed from pIB/V5-His, Invitrogen, Carlsbad, CA, USA). The recombinant plasmid was transfected into S. litura embryonic cells (Spli-221) using LipofectamineTM 2000 (Invitrogen) according to the manual. For the 20E induction, the cells were treated with 0.4 μmol/L 20E (dissolved in DMSO) for 6 h, and then transferred onto a glass slide. A drop of 4 ,6-diamidino2-phenylindole (DAPI) was added on the slide to stain the nucleus of cells. The subcellular localization was observed under a confocal laser scanning microscope (LSM710, Carl-Zeiss, Jena, Germany). To observe the subcellular localization of USPs, immunocytochemistry experiments were carried out. The Spli-221cells were seeded in a 12-well tissue culture plate containing Grace’s medium, and a 13 mm cover glass was placed in each of the wells to let the cells grow on the cover glass. The plate was incubated at 26 °C for 72 h, and then 20E was added into the medium to a final concentration of 0.4 μmol/L and sustained for 6 h. The cover glass was washed with phosphate-buffered saline (PBS) solution and fixed with freshly prepared 4% paraformaldehyde solution for 15 min at room temperature. The cells were permeabilized in PBS containing 0.3% Triton X-100 for 30 min. After blocking with 2% bovine serum albumin (BSA) for 30 min at 37 °C, an antibody against both USP1 and USP2 was added in 1 : 100 dilution and incubated at 4 °C overnight. The cover glass was washed in PBS (3 × 10 min each) and incubated for 1 h with the second antibody conjugated to fluorescein isothiocyanate (FITC) dye (Alexa dye, Molecular Probes, Eugene, OR, USA) in 1 : 100 dilution. For nuclear staining, the cover glass was exposed for 15 min to DAPI solution (1 : 1000 dilution). The cover glass was washed with PBS (3 × 5 min each) and a drop of antifade solution (Beyotime Institute of Biotechnology, Shanghai, China) was added on the cover glass and then covered with a glass slide. Fluorescence was detected by the aforesaid method. The cells treated with the same amount of DMSO were used as a control.
Fig. 1 Sequence similarity among the four isoforms of ecdysone receptor (EcR) and ultraspiracle (USP). The full protein sequences of EcR and USP were aligned using DNAMAN software (Lynnon Corporation, Pointe-Claire, Quebec, Canada). The similarity was generated and marked on each branch.
EcRA and EcRB1 were separated on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidenedifluoride (PVDF) membrane. After the block and wash, the membrane was incubated with purified USP1or USP2 at room temperature for 1.5 h. The membrane was washed with TBST (1× Tris-buffered saline, 0.05% Tween-20) and subjected for western blotting analysis using the anti-USP antibody. An irrelevant protein, fatty acid binding protein (Fabp) with apparent weight of about 20 kDa (including the His-tag and true molecular weight of 14.7 kDa) (Huang et al., 2012) was used as a negative control. Results Cloning and characterization of EcR and USP Two isoforms of EcR (EcRA and EcRB1) and USP (USP1 and USP2) were cloned in the common cutworm. Their ORFs are 1 542, 1 767, 1 404, 1 245, encoding for 513, 588, 467, 414 amino acids with deduced molecular weights of 57, 66, 53 and 47 kDa, respectively. Sequence similarities are very high between isoforms of each EcR or USP, 88% in EcR and 98% in USP (Fig. 1). Slight difference is only found in the N-terminal of A/B domain (Fig. 2). However, almost no similarity exists between EcR and USP except for the DNA-binding domain (Fig. 2). Nine cysteine residues are completely conserved among the four genes (Fig. 2).
Far-western blotting Temporal and spatial expression The ORFs of four genes (EcRA, EcRB1, USP1 and USP2) were cloned into pET-32a plasmid (Novagen, Madison, WI, USA) to express his-tag fused proteins. The used primers are listed in Table 1. The recombiR nant proteins were purified using Ni-NTA His. Bind Resins (Novagen) according to the manual. The purified C
It is apparent that the mRNA abundance of both EcRB1 and USP1 are significantly higher than that of the other two genes in all the studied tissues, including the epidermis, fat body and midgut (Fig. 3). The four genes were all remarkably up-regulated in prepupae and/or pupae in 2014 Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
Characteristics of four isoforms of EcR/USP
99
Fig. 2 Alignment of the four genes coding for ecdysone receptor (EcR) and ultraspiracle (USP). The full protein sequences were aligned using DNAMAN software (Lynnon Corporation, Pointe-Claire, Quebec, Canada). The A/B and DNA-binding domains are highlighted by dashed and continuous lines, respectively. The conserved cysteine residues are marked by asterisk (*) on the top.
all the tissues. Their mRNA expression is in a time- and tissue-restricted manner. The mRNA levels of EcR and USP decreased distinctively in the pupal midgut; however, in the epidermis and fat body, the expression of four genes still sustained high levels in the pupae. The mRNA levels of four genes in the epidermis were slightly up-regulated when the individuals just developed into the sixth instar (0-h-old) as compared with that in the other larval stages (24- and 48-h-old), whereas the mRNA level kept stable during all the sixth instar stages (from the 0-h to 48-hold) in both the fat body and midgut. Difference was also found in the times to be induced during metamorphosis among the four genes. The USP2 was induced later than the others in both the epidermis and fat body. Although all the four genes were significantly up-regulated in the prepupal stage, USP2 was induced at 72 h, whereas the other three genes were not induced until the individuals entered into 96 h. It suggests that the response to 20E induction of USP2 lags behind the other three receptors in both the epidermis and fat body. Interestingly, the expression profiles of EcRB1 and USP1 were nearly identical to each other in all the three tissues, and EcRA and USP2 also revealed similar patterns. C 2014
Hormonal induction The three receptors (EcRA, EcRB1 and USP1) were significantly induced in response to 20E induction in the Spli-221 cells. Further, USP1 was also up-regulated by JH. However, USP2 responded to neither JH nor 20E. In addition, EcRA revealed quicker response to 20E than EcRB1 (Fig. 4). Subcellular localization Both EcRA and EcRB1 predominantly localized in the nucleus and a small amount of cytoplasmic counterparts moved into the nucleus during the 20E treatment (Fig. 5A). The USPs (USP1 and USP2) were exclusively localized in the nucleus (Fig. 5B). Protein–protein interaction between EcRs and USPs The in vitro experiments revealed that purified EcR (EcRA or EcRB1) interacted with both USP1 (Fig. 6A) and USP2 (Fig. 6B).
Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
100
L. X. Huang et al.
Fig. 3 Relative messenger RNA (mRNA) expression levels of four isoforms of EcR and USP in different tissues during the larval–pupal metamorphosis. A, epidermis. B, fat body. C, midgut. The newly molted sixth instar larvae (with white head) were referred to as 0-h-old, and then the insects were sampled every 24 h until they developed into pupae (144 h). The relative expression levels of EcRs and USPs are represented as the fold difference over the amount of glyceraldehyde-3-phosphate dehydrogenase (an internal control). Different letters above the columns indicate significance in the difference of expression levels by one-way analysis of variance (P < 0.05).
C
2014 Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
Characteristics of four isoforms of EcR/USP
101
Fig. 4 Relative messenger RNA (mRNA) expression levels of four isoforms of EcR and USP in response to 20-hydroxyecdysone (20E) and JH induction. Dimethyl sulphoxide was used to dissolve the hormones and also as a control. The asterisks above the columns indicate significance in the difference of expression levels by t-test analysis (P < 0.05).
Discussion Although very low sequence similarity exists between EcR and USP (Fig. 1), the DNA-binding domains are conserved, especially in the cysteine residues (Fig. 2), which are made up of two zinc-finger structures (Henrich, 2009) and are essential for trans-activation of NRs (Gr¨asser et al., 1992). In fact, a similar situation presents in nearly all the members of steroid NRs, including estrogen receptor (ER), progesterone receptor (PR), androgen receptor, glucocorticoid receptor (GR) and mineralocorticoid receptor (Fig. S1). This may explain the fact that the DNA binding elements of various steroid NRs, including EcR, GR, ER and PR, show high sequence similarities to each other (Riddihough & Pelham, 1987). Isoforms of EcR/USP have been reported to present temporal and spatial expression patterns (Jindra et al., 1996; Vafopoulou et al., 2005; Parthasarathy & Palli, 2007). These isoforms were found to play distinct functions in controlling molting and metamorphosis in the red flour beetle, Tribolium castaneum (Tan & Palli, 2008). Temporal and spatial expression was also found in the isoforms of EcR and USP in S. litura. For example, the isoforms were slightly up-regulated at the very beginning of sixth instar larvae in the epidermis rather than in both fat body and midgut (Fig. 3). The induction is apparently
C 2014
a response to the small 20E peak during each molting period (Riddiford, 1994). Interestingly, the four EcR/USP isoforms presented distinct mRNA expression profiles in the midgut as compared with those in the epidermis and fat body. In the pupae, all the four genes were significantly down-regulated in the midgut, whereas they still sustained high levels in the other two tissues (Fig. 3). These results indicate that each tissue possesses a distinctive response mechanism to 20E, or the 20E may be synthesized and secreted in an asynchronous way in different tissues. Nuclear localization is necessary for trans-activation of all nuclear receptors. The subcellular distribution of EcR/USP has been studied widely in mammalian cells, and they revealed that USP was exclusively localized in the nucleus (Nieva et al., 2005; Gw´oz´ d´z et al., 2007; Nieva et al., 2007), whereas EcR was distributed between the cytoplasm and nucleus (Nieva et al., 2007). The subcellular localization of EcR is sometimes dependent on time and cell type (Nieva et al., 2005; Gw´oz´ d´z et al., 2007). In the insect cells, USPs was distributed exclusively in the nucleus (Zheng et al., 2010); however, EcRs were localized in both the nucleus and cytoplasm (Fig. 6). The nuclear localization of both EcR and USP could be promoted by 20E treatment (Fig. 6). EcR has both NLS and NES, whereas USP has only NLS (Nieva et al., 2005; Nieva et al., 2007). Considering the different
Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
102
L. X. Huang et al.
Fig. 6 Protein-protein interaction between ecdysone receptor (EcR) and ultraspiracle (USP). The purified EcRA and EcRB1 were separated on sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto polyvinylidenedifluoride membrane. After the block and wash, the membrane was incubated with purified USP1 or USP2 at room temperature for 1.5 h. The membrane was washed with TBST (1× Tris-buffered saline, 0.05% Tween-20) and then subjected for western blotting analysis using the anti-USP antibody. An irrelevant protein Fabp (about 20 kDa, Fig. S3) was used as a negative control.
Fig. 5 Subcellular localization of four ecdysone receptor (EcR) and ultraspiracle (USP). (A) Transient expression of EcRA and EcRB1. The open reading frames of EcRA and EcRB1 were cloned into pIB-EGFP and transfected into Spli-221 cells. For the 20-hydroxyecdysone (20E) induction, the cells were treated with 0.4 μmol/L 20E (dissolved in dimethyl sulphoxide [DMSO]). The nucleus of cells was stained with 4 ,6-diamidino2-phenylindole. The subcellular localization was observed under a confocal laser scanning microscope. The nucleus and cytoplasm are denoted with “N” and “C”, respectively. (B) Immunocytochemistry of USPs. The Spli-221 cells were grown on the cover glass, and then 20E was added into the medium to a final concentration of 0.4 μmol/L and sustained for 6 h. After fixture and permeablization, anti-USP (recognizing both USP1 and USP2, Fig. S2) was added to localize the subcellular distribution of USP2. The cells treated with the same amount of DMSO were used as a control.
subcellular localizations, EcR and USP can form heterodimers in only the nucleus. This may retain EcRs in the nucleus and avoid them from returning to the cytoplasm, and therefore increases the trans-activation of EcRs. EcR and USP form heterodimers to perform their functions in steroid signaling. However, the detailed compo C
nents of EcR/USP heterodimer have not been fully discovered. The purified EcRs (EcRA and EcRB1) interacted with both USP1 and USP2 (Fig. 6). This suggests that four possible types of heterodimers, including EcRA/USP1, EcRA/USP2, EcRB1/USP1 and EcRB1/USP2, can form in vitro. However, the true situation in vivo is not clear. In Aedes aegypti, EcRB and USP-A (more like USP1 of lepidopteran species) mRNAs were detected during larval stages in larval cells, and EcRA and USP-B (more like USP2) mRNAs were detected during pupal stages in imaginal cells. These data suggest that EcRB/USP1 heterodimer is adopted in the larvae while EcRA/USP2 is in the pupae (Parthasarathy & Palli, 2007). The situation in lepidopteran insects seems to be different. In M. sexta, the MHR3 was activated by the application of EcRB1 and USP1 but not by EcRB1 and USP2 (Lan et al., 1999). However, EcRA and USP2 rather than EcRB1 and USP1 were deduced to be components of the EcR/USP complex in the anterior silk gland of B.mori (Sekimoto et al., 2006). These findings indicate that two types of heterodimers (EcRB1/USP1 and EcRA/USP2) could be adopted by lepidopteran insects and the effective combination may vary in different tissues. This hypothesis is supported by our results. The four isoforms of EcR/USP revealed two distinct mRNA expression patterns, one in EcRA and USP2 and the other in EcRB1 and USP1 (Fig. 3). It is likely that two different types of EcR/USP heterodimer (EcRA/USP2 and EcRB1/USP1) exist in the common cutworm. Even though two different heterodimers exist, their 2014 Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
Characteristics of four isoforms of EcR/USP
importance may vary from each other. It is apparent that the mRNA abundance of both EcRB1 and USP1 was significantly higher than that of the other two genes during metamophosis (Fig. 3). The higher mRNA abundance of EcRB1and USP1was also found in other insects, such as Plutella xylostella (Tang et al., 2012) and Tribolium castaneum (Tan & Palli, 2008). In addition, the trans-activation activity of EcRB1 was higher than EcRA (Ruff et al., 2009), and USP1 showed stronger 20E induction than USP2 (Fig. 4). These results suggest that EcRA/USP2 and EcRB1/USP1 heterodimers may exist simultaneously in common cutworm, and the latter should be the major combination during larval–pupal metamorphosis. However, other combinations of EcR/USP complex cannot be excluded. The presence of EcRA reduced the binding of EcRB1/USP1 complex to EcRE, because EcRA/USP1 showed no binding activity to EcRE1 (Hiruma & Riddiford, 2004). Therefore, other types of EcR/USP heterodimers may exist and play their roles in regulating the trans-activation of the effective EcR/USP by competing for the DNA binding sites. In conclusion, EcRB1 and USP1 showed identical transcriptional expression profiles, and a similar situation was also applied to EcRA and USP2. Both EcRB1 and USP1 showed higher transcription activity upon 20E induction than EcRA and USP2. The two EcRs could interact with either USP1 or USP2 in vitro. These results suggest that two types of heterodimers (EcRA/USP2 and EcRB1/USP1) may exist simultaneously in the common cutworm, and the latter should play more important roles during larval– pupal metamorphosis. In addition, the types of EcR/USP heterodimer do not vary in the tissues which undergo histolysis and regeneration during metamorphosis. These findings will be a valuable supplement and help for elucidating the mechanism of EcR/USP function. Acknowledgments The research was supported by the grants from National Natural Science Foundation of China (Grant No. 31172154) and the National Basic Research Program of China (973 Program, No. 2012CB114101). Disclosure The authors declare no conflicts of interest. References Asahina, M., Jindra, M. and Riddiford, L.M. (1997) Developmental expression of ultraspiracle proteins in the epidermis C 2014
103
of the tobacco hornworm, Manduca sexta, during larval life and the onset of metamorphosis. Development Genes and Evolution, 207, 381–388. Bender, M., Imam, F.B., Talbot, W.S., Ganetzky, B. and Hogness, D.S. (1997) Drosophila ecdysone receptor mutations reveal functional differences among receptor isoforms. Cell, 91, 777–788. Bonneton, F., Zelus, D., Iwema, T., Robinson-Rechavi, M. and Laudet, V. (2003) Rapid divergence of the ecdysone receptor in Diptera and Lepidoptera suggests coevolution between ECR and USP-RXR. Molecular Biology and Evolution, 20, 541–553. Cheng, D., Xia, Q., Duan, J., Wei, L., Huang, C., Li, Z., Wang, G. and Xiang, Z. (2008) Nuclear receptors in Bombyx mori: insights into genomic structure and developmental expression. Insect Biochemistry and Molecular Biology, 38, 1130– 1137. Cherbas, L., Hu, X., Zhimulev, I., Belyaeva, E. and Cherbas, P. (2003) EcR isoforms in Drosophila: testing tissue-specific requirements by targeted blockade and rescue. Development, 130, 271–284. Davis, M.B., Carney, G.E., Robertson, A.E. and Bender, M. (2005) Phenotypic analysis of EcR-A mutants suggests that EcR isoforms have unique functions during Drosophila development. Developmental Biology, 282, 385–396. Fujiwara, H., Jindra, M., Newitt, R., Palli, S.R., Hiruma, K. and Riddiford, L.M. (1995) Cloning of an ecdysone receptor homolog from Manduca sexta and the developmental profile of its mRNA in wings. Insect Biochemistry and Molecular Biology, 25, 845–856. Gr¨asser, F.A., LaMontagne, K., Whittaker, L., Stohr, S. and Lipsick, J.S. (1992) A highly conserved cysteine in the v-Myb DNA-binding domain is essential for transformation and transcriptional trans-activation. Oncogene, 7, 1005–1009. Gu, J., Huang, L.X., Gong, Y.J., Zheng, S.C., Liu, L., Huang, L.H. and Feng, Q.L. (2013) De novo characterization of transcriptome and gene expression dynamics in epidermis during the larval–pupal metamorphosis of common cutworm. Insect Biochemistry and Molecular Biology, 43, 794–808. Gw´oz´ d´z, T., Dutko-Gw´oz´ d´z, J., Nieva, C., Betanska, K., Orlowski, M., Kowalska, A., Dobrucki, J., Spindler-Barth, M., Spindler, K.D. and Ozyhar, A. (2007) EcR and Usp, components of the ecdysteroid nuclear receptor complex, exhibit differential distribution of molecular determinants directing subcellular trafficking. Cell Signaling, 19, 490–503. Henrich, V.C. (2009) The ecdysteroid receptor. Insect Development: Morphogenesis, Molting and Metamorphosis (ed. L.I. Gilbert), pp. 61–303. Academic Press, London. Hiruma, K. and Riddiford, L.M. (2004) Differential control of MHR3 promoter activity by isoforms of the ecdysone receptor and inhibitory effects of E75A and MHR3. Developmental Biology, 272, 510–521.
Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
104
L. X. Huang et al.
Hiruma, K., Shinoda, T., Malone, F. and Riddiford, L.M. (1999) Juvenile hormone modulates 20-hydroxyecdysone-inducible ecdysone receptor and ultraspiracle gene expression in the tobacco hornworm, Manduca sexta. Development Genes and Evolution, 209, 18–30. Huang, Y.F., Xu, Z.B., Lin, X.Y., Feng, Q.L. and Zheng, S.C. (2011) Structure and expression of glutathione S-transferase genes from the midgut of the common cutworm, Spodoptera litura (Noctuidae) and their response to xenobiotic compounds and bacteria. Journal of Insect Physiology, 57, 1033– 1044. Huang, Z.Q., Zhou, D.H., Gao, G.P., Zheng, S.C., Feng, Q.L. and Liu, L. (2012) Cloning and characterization of a midgutspecific fatty acid binding protein in Spodoptera litura. Archives of Insect Biochemistry and Physiology, 79, 1–17. Jindra, M., Huang, J.Y., Malone, F., Asahina, M. and Riddiford, L.M. (1997) Identification and mRNA developmental profiles of two ultraspiracle isoforms in the epidermis and wings of Manduca sexta. Insect Molecular Biology, 6, 41–53. Jindra, M., Malone, F., Hiruma, K. and Riddiford, L.M. (1996) Developmental profiles and ecdysteroid regulation of the mRNAs for two ecdysone receptor isoforms in the epidermis and wings of the tobacco hornworm, Manduca sexta. Devopmental Biology, 180, 258–272. Kamimura, M., Tomita, S., Kiuchi, M. and Fujiwara, H. (1997) Tissue-specific and stage-specific expression of two silkworm ecdysone receptor isoforms–ecdysteroid-dependent transcription in cultured anterior silk glands. European Journal of Biochemistry, 248, 786–793. Kim, S., Park, J.G. and Lee, C.C. (1999) Transcript titers of ecdysteroid receptor components vary between tissues and stages during Drosophila development. Molecular Cells, 28, 61–66. Lammerding-K¨oppel, M., Spindler-Barth, M., Steiner, E., Lezzi, M., Drews, U. and Spindler, K.D. (1998) Immunohistochemical localization of ecdysteroid receptor and ultraspiracle in the epithelial cell line from Chironomus tentans (Insecta, Diptera). Tissue and Cell, 30, 187–194. Lan, Q., Hiruma, K., Hu, X., Jindra, M. and Riddiford, L.M. (1999) Activation of a delayed-early gene encoding MHR3 by the ecdysone receptor heterodimer EcR-B1-USP-1 but not by EcR-B1-USP-2. Molecular and Cellular Biology, 19, 4897– 4906. Nakagawa, Y. and Henrich, V.C. (2009) Arthropod nuclear receptors and their role in molting. FEBS Journal, 276, 6128– 6157. Nieva, C., Gw´oz´ d´z, T., Dutko-Gw´oz´ d´z, J., Wiedenmann, J., Spindler-Barth, M., Wieczorek, E., Dobrucki, J., Du´s, D., Henrich, V., Ozyhar, A. and Spindler, K.D. (2005) Ultraspiracle promotes the nuclear localization of ecdysteroid receptor in mammalian cells. Biological Chemistry, 386, 463–470.
C
Nieva, C., Spindler-Barth, M., Azoitei, A. and Spindler, K.D. (2007) Influence of hormone on intracellular localization of the Drosophila melanogaster ecdysteroid receptor (EcR). Cell Signaling, 19, 2582–2587. Parthasarathy, R. and Palli, S.R. (2007) Stage- and cell-specific expression of ecdysone receptors and ecdysone-induced transcription factors during midgut remodeling in the yellow fever mosquito, Aedes aegypti. Journal of Insect Physiology, 53, 216–229. Perera, S.C., Ladd, T.R., Dhadialla, T.S., Krell, P.J., Sohi, S.S., Retnakaran, A. and Palli, S.R. (1999) Studies on two ecdysone receptor isoforms of the spruce budworm, Choristoneura fumiferana. Molecular and Cellular Endocrinology, 152, 73– 84. Riddiford, L.M. (1994) Cellular and molecular actions of juvenile hormone I. General considerations and premetamorphic actions. Advances in Insect Physiology, 24, 213–274. Riddiford, L.M., Hiruma, K., Lan, Q. and Zhou, B. (1999) Regulation and role of nuclear receptors during larval molting and metamorphosis of Lepidoptera. American Zoology, 39, 736–746. Riddihough, G. and Pelham, H.R. (1987) An ecdysone response element in the Drosophila hsp27 promoter. The EMBO Journal, 6, 3729–3734. Robinow, S., Talbot, W.S., Hogness, D.S. and Truman, J.W. (1993) Programmed cell death in the Drosophila CNS is ecdysone-regulated and coupled with a specific ecdysone receptor isoform. Development, 119, 1251–1259. Ruff, H., Tremmel, C. and Spindler-Barth, M. (2009) Transcriptional activity of ecdysone receptor isoforms is regulated by modulation of receptor stability and interaction with Ab- and C-domains of the heterodimerization partner ultraspiracle. Archives of Insect Biochemistry and Physiology, 72, 154– 171. Sekimoto, T., Iwami, M. and Sakurai, S. (2006) Coordinate responses of transcription factors to ecdysone during programmed cell death in the anterior silk gland of the silkworm, Bombyx mori. Insect Molecular Biology, 15, 281–292. Shen, Y., Gu, J., Huang, L.H., Zheng, S.C., Liu, L., Xu, W.H., Feng, Q.L. and Kang, L. (2011) Cloning and expression analysis of six small heat shock protein genes in the common cutworm, Spodoptera litura. Journal of Insect Physiology, 57, 908–914. Talbot, W.S., Swyryd, E.A. and Hogness, D.S. (1993) Drosophila tissues with different metamorphic responses to ecdysone express different ecdysone receptor isoforms. Cell, 73, 1323–1337. Tan, A. and Palli, S.R. (2008) Edysone receptor isoforms play distinct roles in controlling molting and metamorphosis in the red flour beetle, Tribolium castaneum. Molecular and Cellular Endocrinology, 291, 42–49.
2014 Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
Characteristics of four isoforms of EcR/USP Tang, B.Z., Dong, W., Liang, P., Zhou, X.G. and Gao, X.W. (2012) Cloning, ligand-binding, and temporal expression of ecdysteroid receptors in the diamondback moth, Plutella xylostella. BMC Molecular Biology, 13: 32. Truman, J.W., Talbot, W.S., Fahrbach, S.E. and Hogness, D.S. (1994) Ecdysone receptor expression in the CNS correlates with stage-specific responses to ecdysteroids during Drosophila and Manduca development. Development, 120, 219–234. Vafopoulou, X., Steel, C.G.H. and Terry, K.L. (2005) Edysteroid receptor (EcR) shows marked differences in temporal patterns between tissues during larval–adult development in Rhodnius prolixus: correlations with haemolymph ecdysteroid titres. Journal of Insect Physiology, 51, 27–38. Wang, S.F., Li, C., Zhu, J., Miura, K., Miksicek, R.J. and Raikhel, A.S. (2000) Differential expression and regulation by 20hydroxyecdysone of mosquito ultraspiracle isoforms. Developmental Biology, 218, 99–113. Zheng, W.W., Yang, D.T., Wang, J.X., Song, Q.S., Gilbert, L.I. and Zhao, X.F. (2010) Hsc70 binds to ultraspiracle resulting in the upregulation of 20-hydroxyecdsone-responsive genes in Helicoverpa armigera. Molecular and Cellular Endocrinology, 315, 282–291. Accepted December 12, 2013
C 2014
105
Supporting Information Additional Supporting Information may be found in the online version of this article at the publisher’s web-site: Fig. S1 Alignment of steroid nuclear receptors. The full amino acids were aligned using DNAMAN software. The DNA-binding domain was underlined, and the conserved cysteine residues were marked with asterisk (*) on the top. AR: androgen receptor (Gallus gallus, NP_001035179), ER: estrogen receptor (Homo sapiens, NP_000116), GR: glucocorticoid receptor (Rattus norvegicus, NP_036708), MR: mineralocorticoid receptor (Rattus norvegicus, NP_037263), PR: progesterone receptor (Bos taurus, NP_001192285). Fig. S2 Western blotting of four isoforms of EcR and USP. The four purified proteins were separated in the SDS-PAGE and transferred onto PVDF membrane. AntiUSP was added to test its specificity. The anti-USP was generated in our lab using the full length protein of B. mori USP1 (NM_001044005) as the antigen. It recognizes both USP1 and USP2 of S. litura. Fig. S3 SDS-PAGE of EcRs, USPs and Fabp. The five purified proteins were separated in the SDS-PAGE to reveal their comparative molecular weights.
Institute of Zoology, Chinese Academy of Sciences, 22, 95–105
Copyright of Insect Science is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
