530

VECTORS FOR CLONING GENES

[46]

b a s e d libraries can be easily subcloned to examine their expression in either a sense or antisense manner. H o w e v e r , vectors having a natural SfiI site [such as those with the simian virus 40 (SV40) origin] cannot be used with this cassette. Finally, these vectors are not confined to the directional cloning of c D N A . We h a v e r e p o r t e d using these vectors to clone products of the p o l y m e r a s e chain reaction directionally. ~4An oligonucleotide primer containing an SfiI.B specificity 5' of one a m p l i m e r sequence resulted in molecules with an SfiI site with " B " specificity at one terminus of the p o l y m e r ase chain reaction (PCR) product. The product was then ligated to the SfiI.A.INS adaptor, cleaved with SfiI, and cloned into the p L I B vectors. Acknowledgment The author would like to acknowledge helpful discussions with Ronald Levy, Soshana Levy, and John Rubinstein during the development of these procedures. A.D.Z. was supported by a Clinical Investigator Award, K08 CA01396, from the National Cancer Institute. The original work was also supported by National Institutes of Health Grants CA34233 and CA33399 awarded to Ronald Levy. t4 A. D. Zelenetz, T. C. Chen, and R. Levy, J. Exp. Med. 173, 197 (1991).

[46] U s e o f C o s m i d s a n d A r r a y e d C l o n e L i b r a r i e s Genome Analysis

for

B y G L E N A . EVANS, K E N SNIDER, a n d GARY G . HERMANSON

Introduction Plasmid and bacteriophage cloning vectors h a v e been widely used for a n u m b e r o f years for the isolation and analysis of individual genes or multigene families. M o r e recently, the construction of large-scale m a p s of c o m p l e x g e n o m e s 1 and the c o m p l e t e physical mapping of g e n o m e s of model organisms 2,3 h a v e d e p e n d e d on the use of D N A fragments cloned in bacteriophage or cosmid vectors. The results of these pilot projects 1 A. Coulson, J. Sulston, S. Brenner, and J. Karn, Proc. Natl. Acad. Sci. U.S.A. 83, 7821 (1986). 2 M. V. Olson, J. E. Dutchik, M. V. Graham, G. M. Brodeur, C. Helms, M. Frank, M. MacCollin, R. Scheinman, and T. Frank, Proc. Natl. Acad. Sci. U.S.A. 83, 7826 (1986). 3 y. Kohara, K. Akiyama, and K. Isono, Cell (Cambridge, Mass.) 50, 495 (1987).

METHODS IN ENZYMOLOGY, VOL. 216

Copyright © 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

[46]

COSMIDS IN GENOME ANALYSIS

531

suggest that producing a complete physical map of the human genome, consisting of overlapping clone sets, referred to as contigs, is now feasible. Most current large-scale mapping projects designed to map the human genome utilize both cosmids,4 prepared as arrayed or chromosome-specific cosmid libraries, and large fragment clones in Saccharomyces cerevisiae carried as yeast artificial chromosomes (YACs)fl The use of cosmids and YAC clones in concert provides a powerful mechanism for genome mapping. 6 Genomic libraries constructed for large-scale genome analysis differ substantially from those constructed for single-gene isolation in several respects. For genome mapping, the criteria for representation, completeness, random distribution of clones, and frequency of cloning artifacts are perhaps more significant than with single-gene isolation and extensive characterization of genomic libraries is necessary. In addition, because a large number of analyses on individual clones will be carried out, there is some advantage in utilizing cosmid libraries as large clone arrays, rather than pooled libraries. For single-gene cloning, genomic libraries are generally prepared as a single pool of individual clones that is plated on agar, membrane filter transfers carried out, and the library screened for specific clones by hybridizatoin with a DNA probe. For genomic analysis, it is more convenient, although more time consuming and labor intensive, to prepare libraries as large arrays where each clone is stored individually as a single culture in 1 well of a 96-well microtiter dish. Replicas of the library are transferred to filter membranes for hybridization screening using manual transfer devices or automated instruments. Screening for individual clones, as well as the construction of contigs by hybridization-based fingerprinting, may then be carried out using these filter replicas. Clone arrays have been shown to be extremely useful for detecting single-copy sequences in libraries, for construction of contigs using pools of RNA or oligonucleotide probes, 7 for detecting overlapping sequences between contiguous YAC clones, for characterizing somatic cell hybrids carrying fragments of human chromosomes, and for characterization of repetitive sequences in clone libraries. 8 These reference libraries also allow for the convenient exchange of mapping information obtained using different mapping strategies and between different laboratories. Many of the uses 4 G. A. Evans and G. M. Wahl, this series, Vol. 152, p. 604. 5 D. T. Burke, G. F. Carle, and M. V. Olson, Science 236, 806 (1987). 6 A. Coulson, R. Waterson, J. Kiff, J. Sulston, and Y. Kohara, Nature (London) 335, 184 (1988). 7 G. A. Evans and K. A. Lewis, Proc. Natl. Acad. Sci. U.S.A. 86, 5030 (1989). 8 D. Nizetic, G. Zehetner, A. P. Monaco, L. Gellen, B. D. Young, and H. Lehrach, Proc. Natl. Acad. Sci. U.S.A. 88, 3233 (1991).

532

VECTORS FOR CLONING GENES

[46]

of clone arrays h a v e b e e n described. 9 In addition, clone arrays represent a useful and c o n v e n i e n t w a y o f archiving and distributing h u m a n c h r o m o some-specific cosmid libraries c o n s t r u c t e d from c h r o m o s o m e s purified by flow cytometry.~°'" Several specialized techniques h a v e been d e v e l o p e d for the production and use o f cosmid reference libraries maintained in arrays. This chapter will review s o m e protocols utilized in our laboratory for large-scale gen o m e mapping, including the construction of cosmid libraries, the production and archiving o f a r r a y e d cosmid libraries, the use o f robots for cosmid manipulation and processing, and the analysis of individual cosmid clones. Cosmid libraries are used in conjunction with Y A C cloning for g e n o m e analysis and techniques for the use of Y A C clones in g e n o m e mapping have b e e n r e v i e w e d elsewhere.12 Cosmid Vectors for G e n o m e Analysis C o s m i d vectors h a v e b e e n widely used for a n u m b e r of years for cloning and analyzing genomic D N A . Cosmids are plasmids that contain bacteriophage packaging sequences to enable insertion of the cloned D N A into h phage heads. T h e technique o f packaging ligated D N A into a viral protein coat provides a c o n v e n i e n t and efficient selection for uniformity in the size of cloned D N A , ensuring an insert size of b e t w e e n 35 and 45 kb. T w o types o f cosmid vectors are in general use that differ only in the structure of the packaging signals and require different methods for constructing genomic libraries. Vectors with a single bacteriophage h c o s s e q u e n c e require the extensive purification and size selection of the genomic D N A to be cloned to p r e v e n t a high rate of coligation events.13 C o s m i d s with two c o s signals, also k n o w n as " d o u b l e c o s " vectors, allow rapid and efficient cloning o f genomic D N A that is not size selected by d e p h o s p h o r y l a t i o n o f the genomic D N A to p r e v e n t coligation.~4 Double c o s v e c t o r s are particularly useful in that they m a y be used for the con9 H. Lehrach, R. Drmanac, J. Hoheisel, Z. Larin, G. Lennon, A. P. Monaco, D. Nizetic, G. Zehetner, and A. Poustka, in "Genetic and Physical Mapping" (K. Davies and S. M. Tilghman, eds.), Vol. 1, p. 39. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1990. 10j. W. Gray, J. Luca, D. Peters, D. Pinkel, B. Trask, G. van den Engh, and M. van Dilla, Cold Spring Harbor Syrup. Quant. Biol. 51, 141 (1986). N L. L. Deaven, M. A. Van Dilla, M. F. Bartholdi, A. V. Carrano, L. S. Cram, J. C. Fuscoe, J. W. Gray, C. E. Hildebrand, R. K. Moyzis, and J. Perlman, Cold Spring Harbor Syrup. Quant. Biol. LI, 159 (1986). ~2p. Heiter, C. Connelly, J. Shero, M. K. McCormick, S. Antonarakis, W. Pavan, and R. Reeves, in "Genetic and Physical Mapping" (K. Davies and S. M. Tilghman, eds.), Vol. 1, p. 83. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1990. 13W. Chia, M. R. D. Scott, and P. W. J. Rigby, Nucleic Acids Res. 10, 2503 (1982). 14p. F. Bates and R. A. Swift, Genes 26, 315 (1989).

[46]

COSMIDS IN GENOME ANALYSIS

533

struction of libraries from very small quantities of D N A , such as that obtained from purified c h r o m o s o m e s obtained by flow cytometry.15 A wide variety of cosmid vectors has been created containing many specialized functions applicable to genome analysis. Some of these functions include selectable genes for drug resistance that allow transformation and selection of cosmid vectors in mammalian cells, 16'17 bacteriophage promoters for production of end-specific R N A p r o b e s ] 8'~9 multicopy origins of replication, 2° sequences to allow efficient c h r o m o s o m e walking, 2~ rare restriction e n z y m e s flanking the insert to allow for excision of the entire insert fragment as a single piece and to allow rapid restriction map d e t e r m i n a t i o n ] 2 and structures to allow efficient D N A sequencing. 23 For use in genome analysis, we derived cosmid vectors that contain some of these functions 15(Fig. 1): p W E 15 is a single c o s vector of 8048 nucleotides; sCos I is a double c o s vector of 7939 nucleotides. Both vectors contain a multicopy ColE1 bacterial origin of replication and the complete D N A sequence of both vectors has been determined by automated cosmid sequencing. 24 Modifications of the sCosl vector containing different polylinker and cloning sites have also been constructed.15 Other widely used cosmid vectors include those of the Lorist s e r i e s , 25'26 which are similar in many respects but contain a single-copy bacteriophage ?t origin of replication. Protocols described in this chapter apply specifically to p W E or sCos vectors but may also be applicable to other vectors and systems as well. Materials Enzymes

All restriction enzymes, polynucleotide kinase, T4 D N A ligase, T3 and T7 R N A polymerases, and alkaline phosphatases were obtained from a 15 G. A. Evans, K. A. Lewis, and B. E. Rothenberg, Gene 79, 9 (1989). 16 F. G. Grosveld, T. Lund, E. J. Murray, A. L. Mellor, H. H. M. Dahl, and R. A. Flavell, Nucleic Acids Res. 10, 6715 (1982). 17y. F. Lau and Y. W. Kan, Proc. Natl. Acad. Sci. U.S.A. 80, 5225 (1983). is S. H. Cross and P. F. R. Little, Gene 49, 9 (1986). t9 G. M. Wahl, K. Lewis, J. Ruiz, B. E. Rothenberg, J. Zhao, and G. A. Evans, Proc. Natl. Acad. Sci. U.S.A. 84, 2160 (1987). 2oE. Ehrich, A. Craig, A. Poustka, A. M. Frischauf, and H. Lehrach, Gene 57, 229 (1987). 2i H. J. Breter, M. T. Knoop, and H. Kitchen, Gene 53, 181 (1987). 22p. F. R. Little and S. H. Cross, Proc. Natl. Acad. Sci. U.S.A. 82, 3159 (1985). 23A. Ahmed, Gene 61, 363 (1987).

24A. Martin-Gallardo, W. R. McCombie, J. D. Gocayne, M. G. FitzGerald, S. Wallace, B. M. B. Lee, J. Lamerdin, S. Trapp, J. M. Kelley, L.-I. Liu, M. Dubnick, L. A. JohnstonDow, A. R. Kerlavage, P. de Jong, A. Carrano, C. Fields, and J. C. Venter, Nature Genetics 1, 34 (1992). 25T. J. Gibson, A. R. Coulson, J. E. Sulston, and P. F. R. Litle, Gene 53, 275 (1987). 26T. J. Gibson, A. Rosenthal, and R. H. Waterston, Gene 53, 283 (1987).

534

VECTORS FOR CLONING GENES

[46]

A. I

kb

'

2

3

I

I

4

5

6

7

8

DWE 1 5 ~.

BamHl

sCosl

SCOS 1 + Insert

SV40 origin

r xbal

Sfil

IBssH2ISmal ,

COS

~,

COS

SV40 origin

.

neo/kan phosphotransferase

lactamase

r pvul .

neo/kan phosphotransferase

cos

SV40 omgin

ColE I or]g~n

neo/kan phosphotransferase

C01£1

• ColEI origin

I[ sc°l 13-1actarnase

;3-1actamase

oMg~n

B. EcoRI

Notl

BamHl

Notl

GAATTCGCGGCCGCAATTAACCCTCACTAAAGGATCCCTATAGTGAGTCGTATTAT

FIG. 1. (A) Structure of cosmid vectors for genomic analysis. The feature map, based on the complete nucleotide sequence, is shown for vectors pWE15, sCosl, and sCosl with insert. Because of the duplication of the c o s site in the sCosl vector and the elimination of one copy during the packaging reaction, the restriction map of the cloning vector and the resulting vector with genomic insert are different. The locations of the ColE 1 bacterial origin of replication, the SV40 origin and promoter, and the neomycin/kanamycin phosphotransferase and the/3-1actamase genes are shown, as are sequences derived from bacteriophage X. (B) DNA sequence of the polylinker cloning site. The cloning sites of cosmid vectors pWE 15 and sCos 1, showing the locations of flanking N o t I sites, the unique B a m H I cloning site, and T3 and T7 bacteriophage promoters, are annotated.

number of suppliers including New England BioLabs (Beverly, MA), Bethesda Research Laboratories (Gaithersburg, MD), and Stratagene Cloning Systems (La Jolla, CA). High-efficiency in vitro packaging extracts (Gigapak Gold) were obtained from Stratagene. All enzymes were used under conditions recommended by manufacturers. Strains

Cosmid libraries were constructed using bacterial strain DH 1 or DH5a. Media

TB (terrific broth): 1.2% (w/v) Tryptone, 2.4% (w/v) yeast extract, 0.4% (v/v) glycerol, 70 mM phosphate buffer, pH 7.0

[46]

COSMIDS IN GENOME ANALYSIS

535

LB: 10 g Bacto-tryptone, 5 g bacto-yeast extract, 10 g NaC1 per liter of distilled water Solutions

SSC: 0.15 M NaC1, 0.015 N trisodium citrate, pH 7.6 STET: 8% (w/v) sucrose, 5% (v/v) Triton X-100, 50 mM Tris-HC1 at pH 8.0, 50 mM ethylenediaminetetraacetic acid (EDTA) STE: 0.1 M NaCI, 1 mM Na2EDTA, 50 mM Tris-HC1, pH 7.6 TE: 50 mM Tris-HC1, pH 8.0, 5 mM EDTA Lysozyme solution: 10 mg/ml in STET buffer Agarose gel dye: 40% (v/v) glycerol, 10% (v/v) Ficoll, 25 mM EDTA, 0.15% (v/v) xylene cyanol, 0.25% (v/v) bromphenol blue Phenol-chloroform: Phenol-chloroform for extraction of nucleic acids is prepared as phenol-chloroform-isoamyl alcohol (25:24: 1, saturated with 50 mM Tris-HC1 at pH 8.0 All solutions are made in doubly distilled water treated with diethyl pyrocarbonate (DEPC) to eliminate RNase activity. Other Materials

Flat-bottom and V-bottom microtiter plates are from Corning (Corning, NY). Nytran nylon filter membranes are from Schleicher & Schuell (Keene, NH).

Methods Preparation o f Genomic Cosmid Libraries

Genomic cosmid libraries may be rapidly produced using double cos vectors from quantities of DNA as small as 50 ng. The following is a protocol used for the production of cosmid genomic libraries from nonsize-selected DNA. Alternate protocols must be used for the construction of libraries using single cos vectors. 4'27 Construction o f Genomic Cosmid Libraries in sCosl. High molecular weight genomic DNA for cosmid cloning is prepared using proteinase K digestion and gentle phenol extraction, z7 Cells from 15 ml of whole blood, o r 10 6 tissue culture cells, are suspended in 15 ml of STE and adjusted to I00 txg/ml proteinase K and 0.5% (w/v) sodium dodecyl sulfate (SDS). The solution is gently mixed and incubated for 6 hr at 50°. The DNA is gently extracted with phenol-chloroform and dialyzed against TE overnight. Following preparation, the average size of the genomic DNA is 27 A. DiLella and S. L. C. Woo, this series, Vol. 152, p. 199.

536

VECTORS FOR CLONING GENES

[46]

determined by analysis on pulsed-field gel electrophoresis using the HEXC H E F electrode configuration, z8'29 For efficient cloning, the average size of the DNA should be from 500 kb to greater than 3 Mb. The DNA is suspended at a concentration of 500/zg/ml and digested with MboI at 5 U/ml in 1 M NaC1, 100 mM Tris-HCl, pH 7.4, 100 mM MgCI2, 10 mM dithiothreitol (DTT) at 37° for 5 to 20 min. The exact time of digestion is determined by a titration experiment to generate partial fragments of average size 50 to 100 kb. Following digestion, the reaction is terminated by phenol-chloroform extraction and the DNA analyzed by pulsed field gel electrophoresis to determine the average size of the products. Vector cloning arms are prepared by first digesting purified sCos 1 DNA with XbaI followed by treatment with calf intestinal alkaline phosphatase. The reaction is then terminated by phenol-chloroform extraction and the DNA collected by ethanol precipitation. The linearized, dephosphorylated vector DNA is digested with BamHI. Following digestion, the DNA is extracted with phenol-chloroform and stored at a concentration of 1 mg/ ml in 20 mM Tris-HCl, pH 7.6, 1 mM EDTA. Ligations are performed using 1 /zg of vector arms and 50 ng to 3/~g of MboI-digested genomic DNA. Reactions are incubated with 2 Weiss units of T4 DNA ligase and packaged using commercial in vitro packaging lysates. Cloning efficiencies using this protocol routinely range from 1 × 105 to 2 × 10 7 colonies per microgram of genomic insert DNA. Archiving and Storage of Libraries. Genomic libraries have been traditionally stored in pooled, amplified cultures frozen in glycerol at - 7 0 °. For genome analysis, it is ultimately more convenient, although initially more labor intensive, to store libraries as archive clones in individual cultures. One convenient method is to plate the library on LB agar with 20/~g/ml kanamycin at a density so that most colonies do not touch or overlap surrounding colonies, about 10 clones/cm z. A 96-well fiat-bottom microtiter plate is filled with 100/zl of LB/kanamycin medium per well. Each colony is touched with a toothpick and transferred to the medium in the well. When a complete plate has been picked, the 96-well plate is incubated at 37° for 6 or 8 hr in a humidified, sealed chamber. Following growth of the bacteria, 15/zl of glycerol is added to each well, mixed, and the plate sealed with Parafilm or with adhesive acetate plate sealing material (Linbro, Flow Laboratories, McLean, VA). The plate is then stored at - 7 0 or - 8 0 °. For recovering clones, a toothpick or 96-prong transfer device is touched to the surface of the frozen medium and used to inoculate fresh agar or LB medium. To simplify the many repetitive pipetting steps, z8 G. Chu, D. Vollrath, and R. W. Davis, Science 234, 1582 (1986). z9 G. Chu, Methods: Companion Methods Enzymol. 1, 129 (1990).

[46]

COSMIDSIN GENOMEANALYSIS

537

a 12- or 8-well multiple pipetting device or a Beckman Biomek I000 laboratory robotics workstation may be used. Archived cosmid libraries have been stored in this way for over 5 years without noticeable loss of viability or clone rearrangements. For chromosome-specific cosmid libraries, or libraries prepared from a model organism with a limited genome size, it is convenient to pick and archive every clone. For some applications, such as the selection of clones from a specified region of the genome carried in a somatic cell hybrid, it is useful to carry out a membrane transfer and hybridization screen. When a library is constructed from genomic DNA from a rodent cell carrying a portion of a human chromosome, hybridization screening with a human repetitive probe will allow the clones containing human DNA to be selected and archived, resulting in a library of limited complexity representing a small region of the genome. 7 Preparation of Cosmid Arrays Using Manual Techniques. Following storage in 96-well plates, replicas of clones may be conveniently produced on membrane filters using a 96-prong transfer device (or "hedgehog"). Replica transfers are made from the surface of frozen medium in wells using a device with floating pins, so that contact with uneven surfaces always occurs. After each transfer, the aluminum transfer device is sterilized in 60% ethanol and dried. A membrane filter is cut to the required shape and placed on the surface of an agar plate containing LB plus kanamycin. Replica transfer from frozen colonies is made onto the surface of the membrane and the filters covered and placed at 37° for 12 to 15 hr, or until colonies are visible and of the appropriate size for further analysis. For fixation, the filter is removed and placed sequentially on the surface of Whatman (Clifton, NJ) 3MM paper sheets wet with 0.5 M NaOH for 15 sec, to 0.1 M Tris-HC1, pH 8.0, for 25 sec, and finally 0.5 M NaC1, 0.1 M Tris-HCl, pH 8.0, for 15 sec. The filters are air dried and baked at 65° for 30 min. Filters are stored between paper towels until used for hybridization analysis. A cosmid array prepared in this way is shown in Fig. 2. Automated Preparation of Cosmid Arrays. Using manual methods, it is possible to prepare filters with a density of 384 clones/72 cm 2 by interleaving the patterns of four 96-well plates on a single membrane filter (Fig. 2). However, for large libraries, this necessitates the use of a large number of filters and is time consuming to produce. Higher clone densities can be produced on membrane filters by using a robotic device to carry out automated transfer. A 16x interleaved pattern, placing the contents of 16 96-well plates in the space of 1, may be produced using an automated laboratory robotic device such as the Beckman Biomek 1000 and a 96-pin arraying tool. Detailed use of these

538

[46]

VECTORS FOR CLONING GENES

A

000000000000000000000000 O00000000000000000000000 O0000000000000000000OO00 O00000000000000000000000 0000000000000000000000001 000000000000000000000000 000 0 0 000 OC

8888888°o8888888 8888888 888888888888888888888888 O000000000OO00000000OOOC ©O0000OO000000000000000O O00000OO00000OO00000000O B

t

0

I

0

FIG. 2. Cosmid array prepared by manual methods. An array of 384 cosmids was prepared using four 96-well microtiter plate archives. Transfer to a nylon membrane was carried out using a 96-prong aluminum transfer device. (A) Grid pattern. (B) Hybridization of a unique copy DNA probe to a set of chromosome-specific cosmids.

robotic devices will not be described here and is outlined elsewhere 3° but a general procedure for automated preparation of clone grids using the Biomek robot is as follows. 3o G. Hermanson, P. Lichter, L. Selleri, K. Lewis, D. Ward, and G. A. Evans, Genomics in press (1990).

[46]

COSMIDS IN GENOME ANALYSIS

539

To prepare high-density grids, a replica of each frozen microtiter plate is created by the inoculation of a fresh 96-well plate containing LB medium with 25/zg/ml kanamycin using a 96-prong replicator. These replica plates are incubated in a humidified atmosphere for 12 hr at 37° and stored at 4 ° before use. Biotran membranes (8 x 12 cm; ICN, Irvine, CA) are cut to size with a razor blade, rinsed in sterile water, and then soaked in LB medium for 15 min. The filters are then placed on the surface of LB agar containing 25 /xg/ml kanamycin poured in the lid of a Corning 96-well microtiter plate. A Beckman Biomek 1000 robot equipped with a highdensity array tool and sterilization unit is used to array cosmids onto nylon membranes. Using the high-density array tool, the equivalent of sixteen 96-well plates (1536 clones) is arrayed on the 8 x 12 cm filter. The spacing between clones is 2 mm and a diagram is shown in Fig. 3. After transfer of each 96-well plate, the transfer tool is sterilized by a 5-sec rinse in household bleach, a 10-sec rinse in distilled water, and a 15-sec rinse in 95% ethanol. The tool is then dried over a fan for 50 sec to remove the alcohol. Following arraying, the membranes are removed from the robot and incubated at 37° for 6 to 12 hr, or until the colonies are about 1 mm in diameter. The colonies are fixed by placing the membrane on Whatman 3MM paper wet with 0.5 M NaOH, 1 M Tris-HCl, pH 7.6, and 1 M Tris, pH 7.6, 1.5 M NaCI. The membranes are then allowed to air dry and baked in a vacuum for 1 hr at 80°, after which they are cross-linked with ultraviolet (UV) light. Membranes are stored at room temperature between the sheets of clean paper towels before use. An example of a high-density grid prepared using the Biomek robot is shown in Fig. 3. Hybridization to Arrayed Cosmid Filters. Hybridization with DNA probes is carried out using a preannealing step to block the signal of repetitive sequences in the probe. After labeling of the probe using random hexamer-primed synthesis, 3~the labeling reaction is terminated by extracting with phenol-chloroform and 100/zl of blocking mixture added. Blocking mixture consists of 5 mg/ml of plasmid pBlur8 containing a cloned human Alu repetitive element, and 2.5 mg/ml human placental DNA. The DNA mixture is prepared by sonication to an average size of 50 to 100 bp and resuspended in I0 mM Tris-HCl, pH 7.6, 1 mM EDTA, and denatured by placing in a boiling water bath for 5 min prior to use. Alternatively, human repetitive sequences prepared by preparative hybridization (Cot 1 DNA) may be used. The 32p probe mixed with blocking mixture is precipitated with 20/zl of 0.9 M NaCI, 50 mM sodium phosphate, pH 8.0, 5 mM EDTA, 0.1% (w/v) SDS, and 600/xl of 95% ethanol at - 2 0 °, collected by centrifugation in a microfuge, dried under vacuum, and resuspended in 20 3~ A. Feinberg and B. Vogelstein, Anal. Biochem. 132, 6 (1983).

540

VECTORS FOR CLONING GENES

A.

3.

'oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo oooo 0ooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo ooo0 oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

ooo0

oooo

oo0o

oooo

oooo

oooo

00o0

oooo

oooo

oooo

oooo

oo0o

0ooo

ooo0

0ooo

o0o0

0000

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo

oooo

oooo

oooo oooo

oooo oooo oooo

oooo

oooo

oooo

oooo

oooo

o0oo

oo0o

oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

0ooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

0ooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo oooo oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo o0oo oooo

oooo oooo oooo

oooo oooo oooo

oooo oooo oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

oooo

te o* • __*~°"

p ~ o ~ * e o e o , l * l • • .**e . ° ~ ~l • o-,

-° * ~ * ~ ~ * l , ~ . . . . . . ° , , * e o ~

.°,. • ., . . . ,,o

o, i, • *

g l e . ° , , oee. 0,, • oo ..,

° . . o o o e o , , * • .., ee.,

. . . . . . * ,,. . . . ..~

° J •

0.. • .e* • -e. • .*

e.e • . . . . . . . . * e o t i e g . , .... • e, oeee eo. . . . . ,ee, • ,e I . , . . . . . . •

o,Jo• .~

• *,~*

• eaee

o.~ , . - . oop. ," -

....

;,;.

....

; .......

,e.. • e ,e

eeo

e,eo.

•

., . , . -i

t.~° . . . . . . . • . . . . . . . . ° , * . . . . . . . . . • ° . . . . . °~, °-~ ° • • .e.o o,-e

o,. *,. • . . . . . . • .o -

-

•

~, , •

• *,

-., • ..

.I

qPe *

, I . . *e .

* . . t , .o.

. ,°

. •

. , .

.

.

.

,.;,, .*

.

.

-

:.,.

-, ~e* °

,

loom • *eoeeme ,6~ olo.

•

•

oie. • .e

. . . . . . . * ..e -.°~ , . * e . * ~ 0., • , , ,, • . . . . . . , , - '

..-e • ee ~,.* , * .

. , , , ~ , . i l , . , ~o,

.

.

.

.,,.

.

.

•

.

• ~eet . . . . e.

.

.

.

.

•

• •

e.o eo, e6 ee*

:i •

,,. • "*.

.

, ..a

,~

,.~°

°

. **.

~,

,°

°l

• . . . . . . . . . . . . Q . . . . . . . . . -*~ • , , , ° • . . . . , . , . .

o,** IQ • . . . . . . .

.

*°** *°.J • • "l*°

.,

ii.'ii, ...........................

°.lo . oeo 1,~* ,o** .*. .,e • ,,. - . , e . o • lee ,e,, - * , , • • ~ . ~ * o , * * • . . . . . , .. • o . , . oo .*e *a.e . . . . o.,

C.

[46]

..~

,°,°

•

,o.•

•

•_

[46]

COSMIDS IN GENOME ANALYSIS

541

/zl of sodium phosphate, pH 8.0, 5 mM EDTA, 0.1% (w/v) SDS. Annealing is carried out for 10 min at 42 °, then the probe mixture is diluted into hybridization buffer [500 mM sodium phosphate, pH 7.6, 7% (w/v) SDS, I mM EDTA]. Hybridization is carried out by sealing filters in plastic SealA-Meal bags, adding hybridization buffer containing probe, and incubating at 65 ° in a water bath for 12 hr. Filters are washed in 2 × SSC followed by 0.I × SSC at 65 °. Hybridization to a cosmid grid is shown in Fig. 3. Phenol Emulsion R T Hybridization. An alternative hybridization approach utilizes accelerated hybridization in phenol emulsion 32as described by Djabali et al. 33 Following labeling of the probe with 3zp, and denaturing at 95 ° for 5 min, 100/zg of blocking mixture or Cot ! DNA is added to the probe and the volume adjusted to 1 ml with 100 mM sodium phosphate, pH 7.2 Water-equilibrated phenol (500/zl, pH 8.0) is added and the mixture shaken vigorously with a Vortex (Cleveland, OH) mixer for 15 hr at room temperature. The phenol is removed by centrifugation in a microfuge and the aqueous phase added to the hybridization buffer as described above. Hybridization is carried out in 500 mM sodium phosphate, pH 7.6, 7% (w/v) SDS, 1 mM EDTA at 65 °.

Analysis of Cosmid Libraries Following the creation of an arrayed genomic cosmid library, several types of analysis are possible, including screening the library with singlecopy DNA probes, screening with pooled or degenerate probes containing repetitive sequences that must be blocked in the hybridization reaction, analysis of individual or collections of clones for specified restriction sites, or detection of ovrelapping cosmids for the construction of contigs. Cosmid DNA Preparation from Minilysates. Most analyses of cosmids can be carried out using DNA isolated from 2.5-m1 cultures. A culture tube containing LB broth containing 20/zg/ml kanamycin sulfate is inoculated with a single bacterial colony, or a streak from the surface of a frozen 3.' D. E. Kohne, S. A. Levison, and M. J. Byers, Biochemistry 16, 5329 (1977). 3~ M. Djabali, C. Nguyen, D. Roux, J. Demengeot, H. M. Yang, and B. R. Jordan, Nucleic Acids Res. 18, 6166.

FIG. 3. High-density cosmid array. An array of 1536 cosmids prepared using sixteen 96well microtiter plate archives. Transfer to nylon membrane was carried out using the Beckman Biomek 1000 robot with a 96-prong high-density array tool and sterilization unit. (A) Grid pattern produced with the Biomek robot. (B) Hybridization of a human repetitive Alu sequence to an array of 1536 cosmids from human chromosome 11. (C) Hybridization of a unique-copy DNA probe.

542

VECTORS FOR CLONING GENES

[46]

archive well. The culture is incubated at 37 ° for no longer than 6-8 hr with vigorous shaking. L o n g e r incubation periods give consistently lower yields o f cosmid DNA. D N A is prepared using a modified boiling procedure. Bacterial cells are collected by centrifugation for 2 min in a 1.5-ml microfuge tube. The supernatant is r e m o v e d by aspiration and cells resuspended in 300/xl of S T E T buffer prepared in DEPC-treated water. Fresh lysozyme solution (25/xl) is added to the resuspended cells and the suspension vigorously mixed using a Vortex mixer. The microfuge tube containing the mixture is heated in boiling water for 2 min to lyse the bacteria. The solution is allowed to cool for 2-5 min and the precipitate collected by centrifugation in a microfuge for 10 min. The gelatinous pellet is removed from the tube with a sterile toothpick and discarded. 2-Propanol (325/zl) is added to the cleared lysate, mixed, and the nucleic acid precipitated at room temperature for 5 min. The nucleic acid is collected by centrifugation in the microfuge for 10 min. The alcohol is r e m o v e d by aspiration, the pellet air dried for 10 min, and the D N A resuspended in 25 /zl of sterile DEPCtreated water. This preparation yields 1 to 10/xg of cosmid D N A from a 1.5-ml culture and 2 to 4/zl of the D N A solution is usually sufficient for restriction endonuclease analysis. Additional deproteinization may be necessary if the D N A preparation is to be used as a template for bacteriophage polymerases or fluorescence in situ hybridization. 34'35To r e m o v e contaminating ribonucleases that may affect these procedures, the D N A must be extracted once with phen o l - c h l o r o f o r m and once with chloroform. Following removal of the organic phase, the aqueous phase is adjusted to 0.4 M sodium acetate (pH 5.5) and precipitated with ethanol. The precipitated D N A is dissolved in DEPC-treated sterile water at a concentration of 1 mg/ml and stored at 20 o. Restriction Map Determination by Oligonucleotide E n d Labeling. Restriction mapping of genomic D N A carried in cosmid vectors pWE15 or sCosl may be rapidly and efficiently determined using a modification of a method of Smith and Birnstei136 for D N A fragments, and a method of Rackwitz et al. for cosmids digested with h-terminase. 37 Radiolabeled T3 and TT-specific oligonucleotides, commercially available as D N A sequencing primers, can be used to detect the ends of the insert following excision _

34p. Lichter, C.-J. C. Tan, K. Call, G. Hermanson, G. A. Evans, D. Housman, and D. C. Ward, Science 85, 9664 (1990). 35L. Selleri, J. Eubanks, G. Hermanson, and G. Evans, Gene. Anal. Tech. Appl. 8, 59 (1991). t6 H. O. Smith and M. L. Birnsteil, Nucleic Acids Res. 3, 2387 (1976). 37H. R. Rackwitz, G. Zehetner, H. Murialdo, H. Delius, J. H. Chai, A. Poustka, and A. M. Frischauf, Gene 40, 259 (1985).

[46]

COSMIDS IN GENOME ANALYSIS

543

by NotI. 38 Using this method, the insert is separated from the vector by NotI digestion followed by partial digestion with one or more restriction enzymes. The digestion products are separated by gel electrophoresis on an agarose gel, transferred to a filter membrane, and fragments are detected by hybridization to end-specific oligomers. The restriction map may be determined from the pattern of bands detected by oligomers on the gel (Fig. 4). This method is fast and convenient but not applicable to clones containing internal NotI sites. Automated Screening for Restriction Sites. Another use for arrayed cosmid libraries is the detection of all clones having rare restriction sites. This is particularly useful for the detection and isolation of linking clones, clones containing rare restriction sites that may be used as mapping landmarks. Several methods for detecting or cloning linking clones have been described, including hybridization of arrayed cosmid libraries with short oligonucleotides complementary to r a r e s e q u e n c e s . 39 However, many of these methods are complicated by cross-hybridization, high background, and give a high false-positive rate. An alternative method for identifying rare restriction sites is the repetitive automated screening of cosmids for restriction sites using a robot (Fig. 5). Automated DNA preparation and restriction site analysis of arrayed cosmid clones can be carried out using the Beckman Biomek 1000 automated robotic workstation using cosmids grown in 96-well microtiter plates. For this application, the platform of the Biomek robot is modified so that one of the plate positions can hold an 8 × 12 cm 1% (w/v) agarose gel with 12 wells matching the pattern of the wells of a 96-well microtiter plate. Agarose gels are poured on 8 x 12 cm frosted Plexiglas plates to prevent wandering of the gel during movement of the Biomek platform and inserted into the standard Biomek platform in place of a 96-well plate. This system will prepare DNA from cosmid microcultures in 96-well plates using an abbreviated procedure, add a single restriction enzyme to the DNA preparation, allow digestion, and then load the products on 12-well agarose minigels. Cosmid DNA is prepared as follows using an automated procedure: Bacterial cultures are prepared by replica transfer of bacterial colonies from frozen stocks using a 96-well aluminum transfer device into Corning 96-well V-bottom microtiter plates containing 200/zl of fresh TB containing 25 p.g/ml kanamycin sulfate. Cultures are incubated for 8 hr at 37 ° with gentle shaking in a humidified atmosphere and the bacterial pellet collected by centrifugation at 3000 rpm for 20 min in a Beckman T J-6 centrifuge. 38 G. A. Evans, K. A. Lewis, and G. M. Lawless, Immunogenetics 79, 9 (1988). 39 X. Estivill and R. Williamson, Nucleic Acids Res. 15, 1415 (1987).

544

VECTORS FOR CLONING GENES T3 PROBE

T7 PROBE

2

Smal

EcoR1

Xhol 1

3

1

2

3

[46]

1

2

1

2

Sinai

EcoR1

Xhol 3

3

1

2

3

1

2

3

23--

!25

w

--

O

4

9--

3

4--

i

FIG. 4. Restriction map analysis of cosmid clones by partial endonuclease digestion and hybridization with end-specific oligonucleotides ("oligo end labeling").38 The restriction map of a single cosmid in vector pWE 15 was determined from D N A prepared from 1.5-ml bacterial cultures. Cosmid D N A was digested with NotI to separate the vector from insert, then digested with XhoI, EcoRI, or Sinai under conditions determined to generate partial digestion products. Restriction fragments were separate on an agarose gel, transferred to nitrocellulose membrane, and hybridized with 32p-labeled oligonucleotides specific for the bacteriophage T3 or T7 promoters. Lanes 1-3 represent decreasing concentrations of the indicated restriction enzyme. The T3 and T7 probes are commercially available as DNA sequencing primers.

The plate is inverted over paper towels to remove growth medium and then placed on the platform of the Biomek. Cosmid DNA preparation uses a modified version of the alkaline lysis procedure 4° modified for robotic processing. Under robotic control, the following reagents are added sequentially to each well: 25/xl of STET, 50/zl of 0.2 M NaOH, and 25/xl of 4 M sodium acetate, pH 4.8. The suspension is mixed by repetitive 4o H. C. Birnboim and J. Doly, Nucleic Acids Res. 7, 1513 (1979).

[46]

COSMIDS IN GENOME ANALYSIS

545

pipetting after each addition and the microtiter plate is removed from the robot and centrifuged at 3000 rpm for 10 rain. The plate is replaced in the Biomek and the supernatant transferred to a flesh 96-well flat-bottom plate. 2-Propanol (100/zl) is added to each well and the plate again removed from the robot. The plate is centrifuged at 3000 rpm for 10 min, inverted to remove 2-propanol, and replaced in the robot. TE (15/A) and an appropriate amount of restriction enzyme, usually NotI (Stratagene), are added. Amounts of restriction enzyme necessary for complete digestion range from 5/A (14 U//zl) to 1 /~1 (1 U//A). The enzyme, buffer, and DNA are mixed by pipetting and incubated for 30 min at room temperature. Gel dye (10/A) is added, the reaction again mixed by repetitive pipetting, and the 96 reactions loaded on 8 agarose gels containing 12 lanes each. Electrophoresis of the robot-prepared loaded 12-well agarose minigels is carried out in a custom-designed electrophoresis chamber holding 8 of the 12-well gels. Electrophoresis is carried out for 4 hr at 180 V in 40 mM Tris-borate buffer and DNA visualized by staining with 25/zg/ml ethidium bromide. Using this system, which requires operator intervention at centrifugation steps and for replacement of pipette tips and gels, 2 or 3 sets of 96 cosmids can be analyzed per day. The yield of DNA from an individual 200-tzl culture is 200-400 ng. The yield and purity of DNA are critically dependent on both the cosmid vector used and the host bacterial strain. Best results are obtained using sCosl carried in host strain DH5a. Preparation of End-Specific RNA Probes. sCos and pWE vectors contain T3 and T7 bacteriophage promoters flanking the insertion site that allow for the synthesis of radiolabeled RNA probes from the extreme ends of the insert. RNA probes may be prepared from minilysate DNA following digestion with one of a number of restriction enzymes (RsaI, HaeIII, HindIII, or BamHI). Restriction enzyme digestion limits the size of the resulting probe and assures recognition of the end of the insert. One to 2.5 /zg of DNA is added to a reaction containing a final concentration of 36 mM Tris-HCl, pH 7.6, 6 mM MgCI z, 2 mM spermidine, 1.5 U RNasin, 0.01 M DTT, 0.5 mM GTP, ATP, and CTP, 12 /zM UTP, and 100 Ci [a-32p]UTP (800 Ci/mmol) in a final reaction volume of 25/zl. T7 or T3 polymerase (10-20 U) is added and the reaction continued for 60 rain at 37 °. Following the incubation, the reaction is terminated by extraction with phenol-chloroform and, if necessary, the probe collected by precipitation with ethanol. Multiplex Hybridization Analysis. Cosmid arrays are not only useful for detecting individual genes or DNA sequences, but for the determination of overlaps between different clones and the construction of contigs. One approach to detecting overlaps involves the use of end-specific RNAs, synthesized as described above. Overlapping contiguous cosmid clones

546

VECTORS FOR CLONING GENES

A P-200 tool (single tip)

\

250 Ixl pipette tips

P-200 tool (8 tip)

[46]

1,5 ml microcentrifuge tubes (reagents/enzymes)

/

l 000000000000 000000000000 000000000000 000000000000 000000000000 000000000000 000000000000 000000000000

000000 000000 000000 000000

000000000000 000000000000 000000000000 000000000000 000000000000 000000000000 000000000000 000000000000

P-20 toot (single tip)

L

P-20 tool (8 tip)

96-well microtitre plates (reactions)

1% agarose gel

FIG. 5. Semiautomated robotic system for restriction site analysis of cosmid clones. (A) Diagram of the Beckman Biomek 1000 worktable modified to hold an 8 x 12 cm agarose gel in place of 1 of the 96-well microtiter plates. This system allows automated DNA preparation, digestion, and loading of agarose gels for large-scale mapping projects 3°. (B) Analysis of cosmid clones for NotI restriction sites. Individual cosmid clones were grown in 200-/zl cultures in individual wells of a 96-well microtiter plate, DNA prepared by an alkaline lysis procedure simplified for robotic preparation, and digested with NotI. Separation of the cosmid vector (7 kb) from the insert (>35 kb) allows an internal control for restriction enzyme activity. Following digestion, the products were automatically loaded on a 12-lane 8 × 12 cm 1% (w/v) agarose gel. A set of 16 gels, containing 192 samples, is then run in a single electrophoresis apparatus, stained with ethidium bromide, and photographed under ultraviolet illumination. Shown are the products of restriction digestion reactions of 192 individual cosmids. V, Location of the sCos 1 vector DNA migrating at 6.2 kb; I, location of the excised NotI fragment representing the genomic DNA insert. Where an internal NotI site is present, multiple insert bands are observed.

a r r a n g e d o n an o r g a n i z e d m a t r i x m a y be d e t e c t e d by the s y n t h e s i s o f an e n d - s p e c i f i c R N A p r o b e a n d h y b r i d i z a t i o n o f the p r o b e to a r e p l i c a o f the m a t r i x filter. T h i s m a y b e c a r r i e d o u t u s i n g i n d i v i d u a l c l o n e s , t h r o u g h the use o f a m u l t i p l e x s t r a t e g y in w h i c h t h e R N A p r o b e s are p r e p a r e d f r o m pools of multiple cosmid templates. The templates are pooled such

[46]

COSMIDS IN GENOME ANALYSIS

547

B V ---I~

I --..~ V---~

I ,......1~

V-'~

FIG. 5.

(continued

that each two pools contain only one cosmid m common; thus comparison of the results of hybridization of two different probes to a matrix filter will ensure that clones detected by both pools represent hybridizing to the common clone. A simple way to prepare these mixed probes is to pool all of the cosmid clones corresponding to a row of the two-dimensional matrix, prepare end-specific RNA probes, and carry out a hybridization reaction to a replica of the organized matrix. Each probe will hybridize to its own template, resulting in the detection of a complete row and, in addition, a collection representing all of the clones overlapping with templates. A probe prepared from the pool of cosmids representing a column detects a similar pattern. Those hybridizing clones that appear in both data sets but are not in a template row or column result from hybridization of the common template and indicate physical overlap with the clone that is located at the intersection of the template row and column of the matrix. Thus, if probes are prepared from pools of all of the rows and columns, a large number of overlapping clones in the collection can be rapidly detected. Thus, N clones organized in a two-dimensional array could be analyzed using 2(N ~/2) reactions. Alternate pooling strategies for hybrid-

548

VECTORS FOR CLONING GENES

[46]

ization b a s e d detection of overlaps have also been described. Further details on this a p p r o a c h are given in Refs. 5 and 41. Discussion G e n o m i c cosmid libraries m a y be used for isolating and characterizing individual genes or gene families, or as the basis for constructing largescale m a p s o f c h r o m o s o m e s or entire genomes. Techniques and strategies for the creation and manipulation of cosmid libraries for these two goals differ substantially. Cosmid libraries for isolating single genes m a y be stored as pools of clones and replated for each screening. F o r large-scale mapping, h o w e v e r , w h e r e large numers of clones will be analyzed, it is often m u c h m o r e c o n v e n i e n t to p r o d u c e cosmid libraries that are c h r o m o s o m e or region specific, and which are stored as individual clones archived in high-density microtiter plates. Similar strategies are useful for the production, screening, and distribution of Y A C libraries. 4z Methods for replicating, distributing, and analyzing clones f r o m these arrayed libraries also differ in that simplified m e t h o d s for D N A preparation requiring a minimal n u m b e r of steps, the use of automation and robotics for manipulating and distributing clones, and strategies for rapid restriction mapping and production of p r o b e s are all essential. Acknowledgments We are grateful to our many colleagues in the Molecular Genetics Laboratory at the Salk Institute, especially L. Selleri, D. McElligott, C. Wagner-McPherson, J. Zhao, M. Djabali, G. Huhn, K. Lewis, and S. Maurer, and to J. Longmire, C. E. Hildebrand, T. Beuglesdijk, and L. Deaven (Los Alamos National Laboratories) for many helpful discussions. We are also grateful to Stratagene Cloning Systems for reagents, and to the National Institutes of Health, the Department of Energy, and the G. Harold and Leila Y. Mathers Charitable Foundation for support.

41 G. Evans, BioEssays 13, 39 (1991). 42 E. D. Green and M. V. Olson, Proc. Natl. Acad. Sci. U.S.A. 87, 1213 (1990).