Biosensors and Bioelectronics 63 (2015) 365–370
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
Ultrasensitive electrochemical detection of microRNA with star trigon structure and endonuclease mediated signal amplification Peng Miao a,b,n, Bidou Wang a, Zhiqiang Yu c,nn, Jing Zhao d, Yuguo Tang a a
CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou 215163, PR China University of Chinese Academy of Sciences, Beijing 100049, PR China c Center for BioEnergetics, The Biodesign Institute, and Department of Chemistry and Biochemistry, Arizona State University, Tempe, AZ 85287, USA d Laboratory of Biosensing Technology, School of Life Sciences, Shanghai University, Shanghai 200444, PR China b
art ic l e i nf o
a b s t r a c t
Article history: Received 14 May 2014 Received in revised form 26 July 2014 Accepted 30 July 2014 Available online 4 August 2014
MicroRNAs play important roles in gene regulation. They can be used as effective biomarkers for diagnosis and prognosis of diseases like cancers. Due to their intrinsic properties of short length, low abundance and sequence homology among family members, it is difficult to realize sensitive and selective detection with economical use of time and cost. Herein, we report an ultrasensitive electrochemical method for microRNA analysis employing two oligonucleotides and one endonuclease. Generally, a glassy carbon electrode is first covered with gold nanoparticles (AuNPs) mediated by poly (diallyldimethylammonium chloride) (PDDA). Then, thiolated capture probe (CP) with methylene blue (MB) labeled at 5′ end is modified on the pretreated electrode. Hybridization occurs among target microRNA, CP and auxiliary probe (AP), forming a star trigon structure on the electrode surface. Subsequently, endonuclease recognizes and cleaves CP on CP/AP duplex, releasing microRNA and AP back to the solution. The two regenerated elements can then form another star trigon with other CP molecules, initiating cycles of CP cleavage and MB departure. Significant decrease of electrochemical signals is thus observed, which can be used to reflect the concentration of microRNA. This proposed method has a linear response to microRNA in a wide range from 100 aM to 1 nM and the sensitivity of attomolar level can be achieved. Moreover, it has high selectivity against single-base mismatch sequences and can be used directly in serum samples. Therefore, this method shows great feasibility for the detection of microRNA and may have potential applications in cancer diagnosis and prognosis. & 2014 Elsevier B.V. All rights reserved.
Keywords: MicroRNA Gold nanoparticles Cancer Endonuclease Square wave voltammetry
1. Introduction MicroRNAs are small endogenous noncoding RNAs in animals and plants, which play great important roles in the regulation of various cellular processes such as embryonic differentiation, cardiac hypertrophy and cancer development (Aguda et al., 2008; Carthew and Sontheimer, 2009; Fabian et al., 2010). Many diseases are initiated from aberrant regulation of protein activities by microRNAs, including neurodegeneration, virus caused disorders and cancers (He et al., 2007; Hebert and De Strooper, 2007; Mori et al., 2014). So far, over 2000 microRNAs have been identified in various human cell types (Dong et al., 2013; miRBase, 2013). MicroRNA levels have been widely used as n Corresponding author at: CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou 215163, PR China. Tel.: þ86 512 69588279; fax: þ86 512 69588283. nn Corresponding author. E-mail addresses: [email protected] (P. Miao), [email protected] (Z. Yu).
http://dx.doi.org/10.1016/j.bios.2014.07.075 0956-5663/& 2014 Elsevier B.V. All rights reserved.
noninvasive and stable biomarkers in the study of specific cellular events and disease diagnosis (Mitchell et al., 2008; Williams et al., 2013; Xiao et al., 2013). However, the intrinsic properties of microRNAs such as short length, low abundance in total RNA, and sequence homology among family members also bring great challenge to the analytical methods (Wark et al., 2008). Northern blotting and in situ hybridizations are standard methods for the detection of microRNA. Nevertheless, the disadvantages of low sensitivity and time-consuming procedures may limit their applications. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) offers high sensitivity and covers broad dynamic range for microRNA expression profiling. However, it is susceptible to contamination and restricted in centralized laboratories, which is not applicable for point of care testing (POCT) (Gerasimova et al., 2010). Developing novel methods for the detection of microRNA has been paid more and more attention. Recently, many biosensors have been fabricated, such as capillary electrophoresis assay combining rolling circle amplification (Li et al., 2009), DNA-nanosilver clusters based fluorescent assay (Yang and Vosch, 2011), thin nanopore based electronic
366
P. Miao et al. / Biosensors and Bioelectronics 63 (2015) 365–370
sensor (Wanunu et al., 2010), and so on (Bardea et al., 2011; Cui et al., 2014; Ryoo et al., 2013). Nevertheless, many of these methods are still less sensitive, some involve laborious experiment procedures, others may rely on expensive instrument and welltrained personnel. Compared with the above mentioned methods, electrochemical techniques shows particularly attractive merits such as low cost, high sensitivity, ease of use, etc. (Li and Miao, 2012; Matsumae et al., 2013; Qiu et al., 2011; Sen et al., 2013; Tootoonchi et al., 2013). In this work, we have developed an electrochemical biosensor for ultrasensitive detection of microRNA in a large linear range of 7 orders of magnitude (from 100 aM to 1 nM). The detection limit is as low as 30 aM, which is much lower than northern blotting and qRT-PCR. The selectivity of this method is satisfactory which can distinguish single-base mismatch. The microRNA levels of breast cancer patients and healthy individuals have also been examined. The results obtained by the proposed method are in good accordance with those of a commercial qRTPCR kit. Moreover, this method does not require time-consuming sample pretreatment and toxic procedures, which has fine adaptability to the applications in cancer diagnosis and prognosis.
2. Experimental 2.1. Materials and chemicals Gold (III) chloride trihydrate (HAuCl4 3H2O), poly(diallyldimethylammonium chloride) (PDDA), ethylenediaminetetraacetic acid (EDTA), diethypyrocarbonate (DEPC), mercaptohexanol (MCH), tris(2-carboxyethyl)phosphine hydrochloride (TCEP) were purchased from Sigma-Aldrich (USA). qRT-PCR kit was obtained from Life Technologies (Carlsbad, CA, USA). Nb.BbvCI was from New England Biolabs Ltd. (Beijing, China). Human serum samples of breast cancer patients and healthy individuals were supplied by the local hospital. The other reagents were of analytical grade and used as received. All solutions were prepared with double-distilled water with a specific resistance of 18 MΩ cm. Capture probe (CP), auxiliary probe (AP), target microRNA and single-base mismatch microRNAs (SBM) were synthesized and purified by Takara Biotechnology Co., Ltd. (Dalian, China). The sequences were listed in Table 1. miRNA-21 was chosen as a model target microRNA in this study, which had been widely used as a biomarker for cancer progression (Liu et al., 2012; Si et al., 2007). CP was thiolated with a –(CH2)6– spacer at the 3′ end. Methylene blue (MB) was N-hydroxysuccinimide ester activated and labeled on the amine-terminated CP at the 5′ end, which offered electrochemical signals (Bo et al., 2013). The extra four thymidines in CP (5′ end) could make it longer so as to reduce the influence of MB on the hybridization with target microRNA. The extra four Table 1 Sequences of capture probe, auxiliary probe, target microRNA and single-base mismatch microRNAsa. Name
Sequence (from 5′ to 3′)
CP AP Target SBM1 SBM2 SBM3
MB-TTTTTCAACATCAGCTGAGGTTTT-SH CCTCAGCTAGTCTGATAAGCTA UAGCUUAUCAGACUGAUGUUGA UTGCUUAUCAGACUGAUGUUGA UAGCUUAUCAGACUGAUGUUCA UAGCUUAUCAGTCUGAUGUUGA
a The underlined, italic and bold parts of CP, AP and target are complementary sequences. The underlined parts of SBM represent the mismatch sites which cover 5′ end, 3′ end and middle sections of the sequences.
thymidines at the 3′ end could reduce the steric hindrance between endonuclease and the electrode (Miao et al., 2009b). 2.2. Synthesis of AuNPs AuNPs were synthesized by citrate reduction of HAuCl4 as reported previously (Miao et al., 2013; Storhoff et al., 1998). Briefly, 100 mL of 0.01% (w/v) HAuCl4 solution and 3.5 mL of 1% (w/v) trisodium citrate solution were prepared. Then, the mixture of the two solutions was under stirring and boiling for 15 min. After stirring for another 30 min, the solution was left to sit and cooled down to room temperature. Finally, the formed AuNPs were purified by three cycles of centrifugation at 12,000g for 20 min and were stored in dark at 4 °C for further use. 2.3. Preparation of CP modified electrode The substrate electrode was a disk glassy carbon electrode with the diameter of 3.0 mm. Before modification, the electrode was pretreated and cleaned as described previously (Han et al., 2014). Briefly, it was soaked in fresh piranha solution (98% H2SO4:30% H2O2 ¼3:1) for 5 min so as to remove any adsorbed material (Caution: Piranha solution dangerously attacks organic matter!). After rinsed with distilled water, the electrode was polished on P3000 silicon carbide paper to a mirror-like surface. Afterward, it was sonicated in ethanol and then distilled water, each for 5 min. Consequently, it was dried with nitrogen before further use. The pretreated electrode was soaked in 4.0 g L 1 PDDA solution (containing 0.05 M NaCl) for 30 min to achieve the attachment of the positively charged precursor layer. Then, it was washed with distilled water and incubated in AuNPs for 1 h. After that, 1 μM CP was prepared for a 6 h immobilization of the electrode in 10 mM Tris–HCl (pH 7.4), 1 mM EDTA, 10 mM TCEP, 0.1 M NaCl containing 1‰ DEPC (v/v). The electrode was further treated with 1 mM MCH for 30 min to obtain well aligned DNA monolayers (Miao et al., 2009a). 2.4. Endonuclease reaction Endonuclease reaction buffer solution was prepared as follows: 0.5 unit μL 1 Nb.BbvCI, 50 mM potassium acetate, 20 mM Tris– acetate, 10 mM magnesium acetate, 100 μg ml 1 BSA, 1 μM AP and microRNA with various concentrations. In a typical microRNA assay, the modified electrode was incubated with the reaction buffer at 37 °C for 1 h. Prior to the electrochemical measurement, the electrode was rinsed with 10 mM Tris–HCl (pH 7.5) containing 0.5% Tween so as to block the adsorption of nonspecific proteins and then with distilled water. 2.5. Electrochemical measurements All electrochemical experiments were performed on an electrochemical analyzer (CHI660C, CH Instruments, Shanghai, China) at room temperature. The conventional three electrode system was used, which consisted of a saturated calomel reference electrode (SCE), a platinum wire counter-electrode and the modified electrode as the working electrode (Fig. S1). Square wave voltammetry (SWV) was conducted in 20 mM Tris–HCl (pH 7.5) upon modulation amplitude of 25 mV, frequency of 90 Hz and step potential of 4 mV. Electrochemical impedance spectroscopy (EIS) was performed in 5 mM Fe(CN)63 /4 with 1 M KCl. The experimental parameters were as follows: bias potential, 0.229 V; amplitude, 5 mV; frequency range, 1–10 kHz.
P. Miao et al. / Biosensors and Bioelectronics 63 (2015) 365–370
3. Results and discussion Scheme 1 has depicted the principle of this microRNA biosensor based on star trigon structure and endonuclease mediated signal amplification. First, AuNPs are prepared with good dispersion in water (Fig. S2), and can be self-assembled on the glassy carbon electrode with the positively charged PDDA layer as a linkage (Cao et al., 2014). Subsequently, CP is attached to the AuNPs surface via gold–sulfur chemistry (Taton et al., 2000). MB molecules at the 5′ end of CP can then provide remarkable electrochemical signals. Since target microRNA, AP and CP have partially complementary sequences, star trigon structure can be formed on the electrode surface. In the presence of endonuclease (Nb.BbvCI), which recognizes CP/AP duplex and cleave CP strand, MB, microRNA and AP are released back to the solution. As expected, hybridizations may occur among another CP and the regenerated AP and microRNA, forming another star trigon structure. With cycles of CP cleavage, a huge number of MB molecules on the surface of the electrode are removed, and the significantly decreased electrochemical signals can be used to reveal the microRNA concentration. The designed star trigon structure can not only contribute to the cleavage cycles to eliminate electrochemical species, which guarantees the sensitivity towards microRNA assay, but also make it possible to detect different microRNAs by simply modifying partial sequences of CP and AP, retaining the enzyme cutting site of the applied endonuclease. 3.1. Electrochemical characterization of modified electrode Cyclic voltammogram of the AuNPs/PDDA modified electrodes can reflect typical reversible electrochemical reaction (Fig. S3). The anodic and cathodic peak currents are both linearly proportional to the square root of the scan rate from 0.04 to 0.3 V. The fine
367
electrochemical behavior promises a diffusion-controlled process can occur on the surface of the AuNPs/PDDA modified electrode, which can be further used as ideal interface for the following experiments (Li et al., 2011). Stepwise assembly of PDDA, AuNPs, CP on the electrode and further target microRNA induced CP cleavage have been confirmed by EIS, one of the most effective methods to probe interface properties of electrodes (Ianeselli et al., 2014). As shown in Fig. 1A, Nyquist plot of bare glassy carbon electrode includes no semicircle domain, indicating limited interfacial charge transfer resistance (curve a). Due to abundant positively charged PDDA that can attract Fe(CN)63 /4 , still no semicircle domain is observed on AuNPs/PDDA modified electrode (curve b). After the modification of CP, a semicircle emerges, demonstrating that the immobilized CP can effectively repel Fe(CN)63 /4 with the balance of negatively charged DNA strand and positively charged MB (curve c). However, with the target microRNA induced cleavage, MB molecules are released and a much larger semicircle is thus obtained (curve d). The EIS results have confirmed well the interface properties of the electrode during the detection process. Square wave voltammograms are also recorded to reveal the electrochemical behavior of the modified electrode. As displayed in Fig. 1B, a significant current peak can be observed on the CP/ AuNPs/PDDA modified electrode contributed by MB, while no peaks can be observed on bare electrode, AuNPs/PDDA modified electrode and CP/AuNPs/PDDA modified electrode after microRNA induced star trigon structure formation and recycling endonuclease cleavage. 3.2. Ultrasensitive detection of target microRNA Target microRNA, CP and AP have partially complementary sequences: 8 base pairs of target/CP duplex; 8 base pairs of CP/AP
Scheme 1. Schematic illustration of the electrochemical microRNA biosensor.
368
P. Miao et al. / Biosensors and Bioelectronics 63 (2015) 365–370
Fig. 1. (A) Nyquist plots and (B) square wave voltammograms corresponding to (a) bare glassy carbon electrode, (b) AuNPs/PDDA modified electrode, (c) CP/AuNPs/ PDDA modified electrode, and (d) CP/AuNPs/PDDA modified electrode after target microRNA (1 nM) induced star trigon structure formation and recycling endonuclease cleavage.
duplex and 14 base pairs of target/AP duplex. The star trigon structure can be formed only in the presence of both target microRNA and AP. Since the resulted CP/AP duplex contains the site for Nb.BbvCI cutting, endonuclease reaction can then be carried out to eliminate electrochemical species. However, in the absence of microRNA or AP, the CP/AP duplex cannot be formed on the electrode surface, which then causes a nearly unchanged square wave voltammogram peak (Fig. S4). Kinetic study has also been conducted by SWV technique to obtain the optimum time for endonuclease reaction. With longer incubation duration, weaker electrochemical signals are obtained and a plateau is reached in 60 min, which is then chosen as the optimum reaction time for subsequent experiments (Fig. S5). Fig. 2A depicts the square wave voltammograms for the CP/ AuNPs/PDDA modified electrode after star trigon structure formation and endonuclease cleavage triggered by microRNA with different concentrations. The peak current is linearly proportional to the logarithmic microRNA concentration in a large dynamic range (from 100 aM to 1 nM) with the regression equation of y¼ 0.28x 2.36 (y is the peak current, x is the microRNA concentration, R2 ¼0.99, n ¼5). The detection limit of 30 aM is
Fig. 2. (A) Square wave voltammograms corresponding to CP/AuNPs/PDDA modified electrode after star trigon structure formation and recycling endonuclease cleavage induced by 100 aM, 1 fM, 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, and 1 nM target microRNA (from top to bottom). (B) Calibration curve of peak current vs. logarithmic microRNA concentration.
obtained at S/N ¼3. The sensitivity of the proposed biosensor exceeds those measured by northern blotting, quantitative PCR and recently developed biosensors (Table S1). The assay time of about 1 h is also relatively short. The average relative standard deviation (RSD) of this biosensor for five replicate measurements is 4.31%, which demonstrates fine reproducibility of the method. 3.3. Selectivity performance of the biosensor Another important feature of a good biosensor is high selectivity. To verify the great utility of the proposed method, single-base mismatch microRNAs have been compared in this detection system. SBM1, SBM2 and SBM3 have single-base mismatch with target microRNA at 3′ end, 5′ end and middle sections, respectively. As shown in Fig. 3, the peak currents of experiments for SBM are nearly unchanged after endonuclease cleavage, which are also 10 times larger than that of target microRNA experiments. The sharp contrasts promise this biosensor good performance to distinguish single-base mismatch. 3.4. MicroRNA assays in complex biological samples Serum has long been the sample of studies aiming at sensitive detection of cancer biomarkers for the diagnosis and prognosis of
P. Miao et al. / Biosensors and Bioelectronics 63 (2015) 365–370
369
are also promised. This biosensor may have many other advantages, such as fast response, low cost, convenient operation and redesign. Due to continuous discovery of vast impact of microRNAs on diseases, this biosensor can have immense applications in the diagnosis and prognosis of many diseases.
Acknowledgments This work is supported by the National Key Instrument Developing Project of China (Grant no. ZDYZ2013-1), the National Natural Science Foundation of China (Grant no. 31200745) and the Natural Science Foundation of Jiangsu Province of China (Grant no. BK20141204).
Fig. 3. Comparison of square wave voltammograms signal intensity in the cases of target microRNA, SBM1, SBM2 and SBM3 with the concentration of 1 nM.
the diseases. To confirm the practical value of the biosensor in complex biological fluids, attempts are also made in utilizing it in the detection of microRNA in human serum samples. The typical levels of circulating microRNAs in serum is in the range of 200 aM to 20 pM (Tsujiura et al., 2010), which is a subset of the detection range of this proposed method. As shown in Fig. 4, the results of this method for the detection of microRNA in serum samples are in good agreement with those of a commercial qRT-PCR kit. In addition, we have spiked different amount of microRNA in the samples. The obtained results demonstrate that the spiked microRNA with the concentration as low as 10 fM can be successfully distinguished in healthy human serums (Fig. S6). Moreover, the selectivity of the biosensor is further checked in serum samples with satisfactory results (Table S2).
4. Conclusions In summary, we have fabricated a novel strategy for ultrasensitive detection of microRNA using electrochemical techniques. A star trigon structure comprised of target, AP and CP is designed for endonuclease assisted signal amplification. Experiment results have well confirmed the remarkable high sensitivity and selectivity. Great utility in the applications to human serum sample assays
Fig. 4. Assays of microRNA concentrations in serum samples from breast cancer patients (A, B) and healthy individuals (C, D). Black columns are the results obtained by the proposed method and gray columns stands for the results of qRT-PCR.
Appendix A. Supplementary information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2014.07.075.
References Aguda, B.D., Kim, Y., Piper-Hunter, M.G., Friedman, A., Marsh, C.B., 2008. Proc. Natl. Acad. Sci. USA 105 (50), 19678–19683. Bardea, A., Burshtein, N., Rudich, Y., Salame, T., Ziv, C., Yarden, O., Naaman, R., 2011. Anal. Chem. 83 (24), 9418–9423. Bo, B., Miao, P., Xu, Y.Y., Shu, Y.Q., Li, G.X., 2013. Electrochem. Commun. 34, 142–145. Cao, Y., Chen, D.H., Chen, W.W., Yu, J.C., Chen, Z., Li, G.X., 2014. Anal. Chim. Acta 812, 45–49. Carthew, R.W., Sontheimer, E.J., 2009. Cell 136 (4), 642–655. Cui, L., Zhu, Z., Lin, N.H., Zhang, H.M., Guan, Z.C., Yang, C.Y.J., 2014. Chem. Commun. 50 (13), 1576–1578. Dong, H.F., Lei, J.P., Ding, L., Wen, Y.Q., Ju, H.X., Zhang, X.J., 2013. Chem. Rev. 113 (8), 6207–6233. Fabian, M.R., Sonenberg, N., Filipowicz, W., 2010. Annu. Rev. Biochem. 79, 351–379. Gerasimova, Y.V., Peck, S., Kolpashchikov, D.M., 2010. Chem. Commun. 46 (46), 8761–8763. Han, K., Miao, P., Tong, H., Liu, T., Cheng, W.B., Zhu, X.L., Tang, Y.G., 2014. Appl. Phys. Lett. 104 (5), 053101. He, L., He, X.Y., Lim, L.P., De Stanchina, E., Xuan, Z.Y., Liang, Y., Xue, W., Zender, L., Magnus, J., Ridzon, D., Jackson, A.L., Linsley, P.S., Chen, C.F., Lowe, S.W., Cleary, M.A., Hannon, G.J., 2007. Nature 447 (7148), 1130–1134. Hebert, S.S., De Strooper, B., 2007. Science 317 (5842), 1179–1180. Ianeselli, L., Grenci, G., Callegari, C., Tormen, M., Casalis, L., 2014. Biosens. Bioelectron. 55, 1–6. Li, G.X., Miao, P., 2012. Electrochemical Analysis of Proteins and Cells. Springer, Berlin, Germany. Li, N., Jablonowski, C., Jin, H.L., Zhong, W.W., 2009. Anal. Chem. 81 (12), 4906–4913. Li, Q.F., Tang, D.P., Tang, J.A., Su, B.L., Huang, J.X., Chen, G.N., 2011. Talanta 84 (2), 538–546. Liu, R., Chen, X., Du, Y.Q., Yao, W.Y., Shen, L., Wang, C., Hu, Z.B., Zhuang, R., Ning, G., Zhang, C.N., Yuan, Y.Z., Li, Z.S., Zen, K., Ba, Y., Zhang, C.Y., 2012. Clin. Chem. 58 (3), 610–618. Matsumae, Y., Arai, T., Takahashi, Y., Ino, K., Shiku, H., Matsue, T., 2013. Chem. Commun. 49 (58), 6498–6500. Miao, P., Liu, L., Li, Y., Li, G.X., 2009a. Electrochem. Commun. 11 (10), 1904–1907. Miao, P., Liu, L., Nie, Y.J., Li, G.X., 2009b. Biosens. Bioelectron. 24 (11), 3347–3351. Miao, P., Ning, L.M., Li, X.X., 2013. Anal. Chem. 85 (16), 7966–7970. miRBase, 〈http://www.mirbase.org/index.shtml〉, Release 20: June 2013. Mitchell, P.S., Parkin, R.K., Kroh, E.M., Fritz, B.R., Wyman, S.K., Pogosova-Agadjanyan, E.L., Peterson, A., Noteboom, J., O’Briant, K.C., Allen, A., Lin, D.W., Urban, N., Drescher, C.W., Knudsen, B.S., Stirewalt, D.L., Gentleman, R., Vessella, R.L., Nelson, P.S., Martin, D.B., Tewari, M., 2008. Proc. Natl. Acad. Sci. USA 105 (30), 10513–10518. Mori, M., Triboulet, R., Mohseni, M., Schlegelmilch, K., Shrestha, K., Camargo, F.D., Gregory, R.I., 2014. Cell 156 (5), 893–906. Qiu, Y.H., Yi, S., Keifer, A.E., 2011. Org. Lett. 13 (7), 1770–1773. Ryoo, S.R., Lee, J., Yeo, J., Na, H.K., Kim, Y.K., Jang, H., Lee, J.H., Han, S.W., Lee, Y., Kim, V.N., Min, D.H., 2013. ACS Nano 7 (7), 5882–5891. Sen, M., Ino, K., Inoue, K.Y., Arai, T., Nishijo, T., Suda, A., Kunikata, R., Shiku, H., Matsue, T., 2013. Biosens. Bioelectron. 48, 12–18. Si, M.L., Zhu, S., Wu, H., Lu, Z., Wu, F., Mo, Y.Y., 2007. Oncogene 26 (19), 2799–2803. Storhoff, J.J., Elghanian, R., Mucic, R.C., Mirkin, C.A., Letsinger, R.L., 1998. J. Am. Chem. Soc. 120 (9), 1959–1964. Taton, T.A., Mirkin, C.A., Letsinger, R.L., 2000. Science 289 (5485), 1757–1760. Tootoonchi, M.H., Yi, S., Kaifer, A.E., 2013. J. Am. Chem. Soc. 135 (29), 10804–10809.
370
P. Miao et al. / Biosensors and Bioelectronics 63 (2015) 365–370
Tsujiura, M., Ichikawa, D., Komatsu, S., Shiozaki, A., Takeshita, H., Kosuga, T., Konishi, H., Morimura, R., Deguchi, K., Fujiwara, H., Okamoto, K., Otsuji, E., 2010. Br. J. Cancer 102 (7), 1174–1179. Wanunu, M., Dadosh, T., Ray, V., Jin, J.M., McReynolds, L., Drndic, M., 2010. Nat. Nanotechnol. 5 (11), 807–814. Wark, A.W., Lee, H.J., Corn, R.M., 2008. Angew. Chem. Int. Ed. 47 (4), 644–652.
Williams, Z., Ben-Dov, I.Z., Elias, R., Mihailovic, A., Brown, M., Rosenwaks, Z., Tuschl, T., 2013. Proc. Natl. Acad. Sci. USA 110 (11), 4255–4260. Xiao, B., Wang, Y., Li, W., Baker, M., Guo, J., Corbet, K., Tsalik, E.L., Li, Q.J., Palmer, S. M., Woods, C.W., Li, Z.G., Chao, N.J., He, Y.W., 2013. Blood 122 (19), 3365–3375. Yang, S.W., Vosch, T., 2011. Anal. Chem. 83 (18), 6935–6939.
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
Ultrasensitive electrochemical detection of microRNA with star trigon structure and endonuclease mediated signal amplification Peng Miao a,b,n, Bidou Wang a, Zhiqiang Yu c,nn, Jing Zhao d, Yuguo Tang a a
CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou 215163, PR China University of Chinese Academy of Sciences, Beijing 100049, PR China c Center for BioEnergetics, The Biodesign Institute, and Department of Chemistry and Biochemistry, Arizona State University, Tempe, AZ 85287, USA d Laboratory of Biosensing Technology, School of Life Sciences, Shanghai University, Shanghai 200444, PR China b
art ic l e i nf o
a b s t r a c t
Article history: Received 14 May 2014 Received in revised form 26 July 2014 Accepted 30 July 2014 Available online 4 August 2014
MicroRNAs play important roles in gene regulation. They can be used as effective biomarkers for diagnosis and prognosis of diseases like cancers. Due to their intrinsic properties of short length, low abundance and sequence homology among family members, it is difficult to realize sensitive and selective detection with economical use of time and cost. Herein, we report an ultrasensitive electrochemical method for microRNA analysis employing two oligonucleotides and one endonuclease. Generally, a glassy carbon electrode is first covered with gold nanoparticles (AuNPs) mediated by poly (diallyldimethylammonium chloride) (PDDA). Then, thiolated capture probe (CP) with methylene blue (MB) labeled at 5′ end is modified on the pretreated electrode. Hybridization occurs among target microRNA, CP and auxiliary probe (AP), forming a star trigon structure on the electrode surface. Subsequently, endonuclease recognizes and cleaves CP on CP/AP duplex, releasing microRNA and AP back to the solution. The two regenerated elements can then form another star trigon with other CP molecules, initiating cycles of CP cleavage and MB departure. Significant decrease of electrochemical signals is thus observed, which can be used to reflect the concentration of microRNA. This proposed method has a linear response to microRNA in a wide range from 100 aM to 1 nM and the sensitivity of attomolar level can be achieved. Moreover, it has high selectivity against single-base mismatch sequences and can be used directly in serum samples. Therefore, this method shows great feasibility for the detection of microRNA and may have potential applications in cancer diagnosis and prognosis. & 2014 Elsevier B.V. All rights reserved.
Keywords: MicroRNA Gold nanoparticles Cancer Endonuclease Square wave voltammetry
1. Introduction MicroRNAs are small endogenous noncoding RNAs in animals and plants, which play great important roles in the regulation of various cellular processes such as embryonic differentiation, cardiac hypertrophy and cancer development (Aguda et al., 2008; Carthew and Sontheimer, 2009; Fabian et al., 2010). Many diseases are initiated from aberrant regulation of protein activities by microRNAs, including neurodegeneration, virus caused disorders and cancers (He et al., 2007; Hebert and De Strooper, 2007; Mori et al., 2014). So far, over 2000 microRNAs have been identified in various human cell types (Dong et al., 2013; miRBase, 2013). MicroRNA levels have been widely used as n Corresponding author at: CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou 215163, PR China. Tel.: þ86 512 69588279; fax: þ86 512 69588283. nn Corresponding author. E-mail addresses: [email protected] (P. Miao), [email protected] (Z. Yu).
http://dx.doi.org/10.1016/j.bios.2014.07.075 0956-5663/& 2014 Elsevier B.V. All rights reserved.
noninvasive and stable biomarkers in the study of specific cellular events and disease diagnosis (Mitchell et al., 2008; Williams et al., 2013; Xiao et al., 2013). However, the intrinsic properties of microRNAs such as short length, low abundance in total RNA, and sequence homology among family members also bring great challenge to the analytical methods (Wark et al., 2008). Northern blotting and in situ hybridizations are standard methods for the detection of microRNA. Nevertheless, the disadvantages of low sensitivity and time-consuming procedures may limit their applications. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) offers high sensitivity and covers broad dynamic range for microRNA expression profiling. However, it is susceptible to contamination and restricted in centralized laboratories, which is not applicable for point of care testing (POCT) (Gerasimova et al., 2010). Developing novel methods for the detection of microRNA has been paid more and more attention. Recently, many biosensors have been fabricated, such as capillary electrophoresis assay combining rolling circle amplification (Li et al., 2009), DNA-nanosilver clusters based fluorescent assay (Yang and Vosch, 2011), thin nanopore based electronic
366
P. Miao et al. / Biosensors and Bioelectronics 63 (2015) 365–370
sensor (Wanunu et al., 2010), and so on (Bardea et al., 2011; Cui et al., 2014; Ryoo et al., 2013). Nevertheless, many of these methods are still less sensitive, some involve laborious experiment procedures, others may rely on expensive instrument and welltrained personnel. Compared with the above mentioned methods, electrochemical techniques shows particularly attractive merits such as low cost, high sensitivity, ease of use, etc. (Li and Miao, 2012; Matsumae et al., 2013; Qiu et al., 2011; Sen et al., 2013; Tootoonchi et al., 2013). In this work, we have developed an electrochemical biosensor for ultrasensitive detection of microRNA in a large linear range of 7 orders of magnitude (from 100 aM to 1 nM). The detection limit is as low as 30 aM, which is much lower than northern blotting and qRT-PCR. The selectivity of this method is satisfactory which can distinguish single-base mismatch. The microRNA levels of breast cancer patients and healthy individuals have also been examined. The results obtained by the proposed method are in good accordance with those of a commercial qRTPCR kit. Moreover, this method does not require time-consuming sample pretreatment and toxic procedures, which has fine adaptability to the applications in cancer diagnosis and prognosis.
2. Experimental 2.1. Materials and chemicals Gold (III) chloride trihydrate (HAuCl4 3H2O), poly(diallyldimethylammonium chloride) (PDDA), ethylenediaminetetraacetic acid (EDTA), diethypyrocarbonate (DEPC), mercaptohexanol (MCH), tris(2-carboxyethyl)phosphine hydrochloride (TCEP) were purchased from Sigma-Aldrich (USA). qRT-PCR kit was obtained from Life Technologies (Carlsbad, CA, USA). Nb.BbvCI was from New England Biolabs Ltd. (Beijing, China). Human serum samples of breast cancer patients and healthy individuals were supplied by the local hospital. The other reagents were of analytical grade and used as received. All solutions were prepared with double-distilled water with a specific resistance of 18 MΩ cm. Capture probe (CP), auxiliary probe (AP), target microRNA and single-base mismatch microRNAs (SBM) were synthesized and purified by Takara Biotechnology Co., Ltd. (Dalian, China). The sequences were listed in Table 1. miRNA-21 was chosen as a model target microRNA in this study, which had been widely used as a biomarker for cancer progression (Liu et al., 2012; Si et al., 2007). CP was thiolated with a –(CH2)6– spacer at the 3′ end. Methylene blue (MB) was N-hydroxysuccinimide ester activated and labeled on the amine-terminated CP at the 5′ end, which offered electrochemical signals (Bo et al., 2013). The extra four thymidines in CP (5′ end) could make it longer so as to reduce the influence of MB on the hybridization with target microRNA. The extra four Table 1 Sequences of capture probe, auxiliary probe, target microRNA and single-base mismatch microRNAsa. Name
Sequence (from 5′ to 3′)
CP AP Target SBM1 SBM2 SBM3
MB-TTTTTCAACATCAGCTGAGGTTTT-SH CCTCAGCTAGTCTGATAAGCTA UAGCUUAUCAGACUGAUGUUGA UTGCUUAUCAGACUGAUGUUGA UAGCUUAUCAGACUGAUGUUCA UAGCUUAUCAGTCUGAUGUUGA
a The underlined, italic and bold parts of CP, AP and target are complementary sequences. The underlined parts of SBM represent the mismatch sites which cover 5′ end, 3′ end and middle sections of the sequences.
thymidines at the 3′ end could reduce the steric hindrance between endonuclease and the electrode (Miao et al., 2009b). 2.2. Synthesis of AuNPs AuNPs were synthesized by citrate reduction of HAuCl4 as reported previously (Miao et al., 2013; Storhoff et al., 1998). Briefly, 100 mL of 0.01% (w/v) HAuCl4 solution and 3.5 mL of 1% (w/v) trisodium citrate solution were prepared. Then, the mixture of the two solutions was under stirring and boiling for 15 min. After stirring for another 30 min, the solution was left to sit and cooled down to room temperature. Finally, the formed AuNPs were purified by three cycles of centrifugation at 12,000g for 20 min and were stored in dark at 4 °C for further use. 2.3. Preparation of CP modified electrode The substrate electrode was a disk glassy carbon electrode with the diameter of 3.0 mm. Before modification, the electrode was pretreated and cleaned as described previously (Han et al., 2014). Briefly, it was soaked in fresh piranha solution (98% H2SO4:30% H2O2 ¼3:1) for 5 min so as to remove any adsorbed material (Caution: Piranha solution dangerously attacks organic matter!). After rinsed with distilled water, the electrode was polished on P3000 silicon carbide paper to a mirror-like surface. Afterward, it was sonicated in ethanol and then distilled water, each for 5 min. Consequently, it was dried with nitrogen before further use. The pretreated electrode was soaked in 4.0 g L 1 PDDA solution (containing 0.05 M NaCl) for 30 min to achieve the attachment of the positively charged precursor layer. Then, it was washed with distilled water and incubated in AuNPs for 1 h. After that, 1 μM CP was prepared for a 6 h immobilization of the electrode in 10 mM Tris–HCl (pH 7.4), 1 mM EDTA, 10 mM TCEP, 0.1 M NaCl containing 1‰ DEPC (v/v). The electrode was further treated with 1 mM MCH for 30 min to obtain well aligned DNA monolayers (Miao et al., 2009a). 2.4. Endonuclease reaction Endonuclease reaction buffer solution was prepared as follows: 0.5 unit μL 1 Nb.BbvCI, 50 mM potassium acetate, 20 mM Tris– acetate, 10 mM magnesium acetate, 100 μg ml 1 BSA, 1 μM AP and microRNA with various concentrations. In a typical microRNA assay, the modified electrode was incubated with the reaction buffer at 37 °C for 1 h. Prior to the electrochemical measurement, the electrode was rinsed with 10 mM Tris–HCl (pH 7.5) containing 0.5% Tween so as to block the adsorption of nonspecific proteins and then with distilled water. 2.5. Electrochemical measurements All electrochemical experiments were performed on an electrochemical analyzer (CHI660C, CH Instruments, Shanghai, China) at room temperature. The conventional three electrode system was used, which consisted of a saturated calomel reference electrode (SCE), a platinum wire counter-electrode and the modified electrode as the working electrode (Fig. S1). Square wave voltammetry (SWV) was conducted in 20 mM Tris–HCl (pH 7.5) upon modulation amplitude of 25 mV, frequency of 90 Hz and step potential of 4 mV. Electrochemical impedance spectroscopy (EIS) was performed in 5 mM Fe(CN)63 /4 with 1 M KCl. The experimental parameters were as follows: bias potential, 0.229 V; amplitude, 5 mV; frequency range, 1–10 kHz.
P. Miao et al. / Biosensors and Bioelectronics 63 (2015) 365–370
3. Results and discussion Scheme 1 has depicted the principle of this microRNA biosensor based on star trigon structure and endonuclease mediated signal amplification. First, AuNPs are prepared with good dispersion in water (Fig. S2), and can be self-assembled on the glassy carbon electrode with the positively charged PDDA layer as a linkage (Cao et al., 2014). Subsequently, CP is attached to the AuNPs surface via gold–sulfur chemistry (Taton et al., 2000). MB molecules at the 5′ end of CP can then provide remarkable electrochemical signals. Since target microRNA, AP and CP have partially complementary sequences, star trigon structure can be formed on the electrode surface. In the presence of endonuclease (Nb.BbvCI), which recognizes CP/AP duplex and cleave CP strand, MB, microRNA and AP are released back to the solution. As expected, hybridizations may occur among another CP and the regenerated AP and microRNA, forming another star trigon structure. With cycles of CP cleavage, a huge number of MB molecules on the surface of the electrode are removed, and the significantly decreased electrochemical signals can be used to reveal the microRNA concentration. The designed star trigon structure can not only contribute to the cleavage cycles to eliminate electrochemical species, which guarantees the sensitivity towards microRNA assay, but also make it possible to detect different microRNAs by simply modifying partial sequences of CP and AP, retaining the enzyme cutting site of the applied endonuclease. 3.1. Electrochemical characterization of modified electrode Cyclic voltammogram of the AuNPs/PDDA modified electrodes can reflect typical reversible electrochemical reaction (Fig. S3). The anodic and cathodic peak currents are both linearly proportional to the square root of the scan rate from 0.04 to 0.3 V. The fine
367
electrochemical behavior promises a diffusion-controlled process can occur on the surface of the AuNPs/PDDA modified electrode, which can be further used as ideal interface for the following experiments (Li et al., 2011). Stepwise assembly of PDDA, AuNPs, CP on the electrode and further target microRNA induced CP cleavage have been confirmed by EIS, one of the most effective methods to probe interface properties of electrodes (Ianeselli et al., 2014). As shown in Fig. 1A, Nyquist plot of bare glassy carbon electrode includes no semicircle domain, indicating limited interfacial charge transfer resistance (curve a). Due to abundant positively charged PDDA that can attract Fe(CN)63 /4 , still no semicircle domain is observed on AuNPs/PDDA modified electrode (curve b). After the modification of CP, a semicircle emerges, demonstrating that the immobilized CP can effectively repel Fe(CN)63 /4 with the balance of negatively charged DNA strand and positively charged MB (curve c). However, with the target microRNA induced cleavage, MB molecules are released and a much larger semicircle is thus obtained (curve d). The EIS results have confirmed well the interface properties of the electrode during the detection process. Square wave voltammograms are also recorded to reveal the electrochemical behavior of the modified electrode. As displayed in Fig. 1B, a significant current peak can be observed on the CP/ AuNPs/PDDA modified electrode contributed by MB, while no peaks can be observed on bare electrode, AuNPs/PDDA modified electrode and CP/AuNPs/PDDA modified electrode after microRNA induced star trigon structure formation and recycling endonuclease cleavage. 3.2. Ultrasensitive detection of target microRNA Target microRNA, CP and AP have partially complementary sequences: 8 base pairs of target/CP duplex; 8 base pairs of CP/AP
Scheme 1. Schematic illustration of the electrochemical microRNA biosensor.
368
P. Miao et al. / Biosensors and Bioelectronics 63 (2015) 365–370
Fig. 1. (A) Nyquist plots and (B) square wave voltammograms corresponding to (a) bare glassy carbon electrode, (b) AuNPs/PDDA modified electrode, (c) CP/AuNPs/ PDDA modified electrode, and (d) CP/AuNPs/PDDA modified electrode after target microRNA (1 nM) induced star trigon structure formation and recycling endonuclease cleavage.
duplex and 14 base pairs of target/AP duplex. The star trigon structure can be formed only in the presence of both target microRNA and AP. Since the resulted CP/AP duplex contains the site for Nb.BbvCI cutting, endonuclease reaction can then be carried out to eliminate electrochemical species. However, in the absence of microRNA or AP, the CP/AP duplex cannot be formed on the electrode surface, which then causes a nearly unchanged square wave voltammogram peak (Fig. S4). Kinetic study has also been conducted by SWV technique to obtain the optimum time for endonuclease reaction. With longer incubation duration, weaker electrochemical signals are obtained and a plateau is reached in 60 min, which is then chosen as the optimum reaction time for subsequent experiments (Fig. S5). Fig. 2A depicts the square wave voltammograms for the CP/ AuNPs/PDDA modified electrode after star trigon structure formation and endonuclease cleavage triggered by microRNA with different concentrations. The peak current is linearly proportional to the logarithmic microRNA concentration in a large dynamic range (from 100 aM to 1 nM) with the regression equation of y¼ 0.28x 2.36 (y is the peak current, x is the microRNA concentration, R2 ¼0.99, n ¼5). The detection limit of 30 aM is
Fig. 2. (A) Square wave voltammograms corresponding to CP/AuNPs/PDDA modified electrode after star trigon structure formation and recycling endonuclease cleavage induced by 100 aM, 1 fM, 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, and 1 nM target microRNA (from top to bottom). (B) Calibration curve of peak current vs. logarithmic microRNA concentration.
obtained at S/N ¼3. The sensitivity of the proposed biosensor exceeds those measured by northern blotting, quantitative PCR and recently developed biosensors (Table S1). The assay time of about 1 h is also relatively short. The average relative standard deviation (RSD) of this biosensor for five replicate measurements is 4.31%, which demonstrates fine reproducibility of the method. 3.3. Selectivity performance of the biosensor Another important feature of a good biosensor is high selectivity. To verify the great utility of the proposed method, single-base mismatch microRNAs have been compared in this detection system. SBM1, SBM2 and SBM3 have single-base mismatch with target microRNA at 3′ end, 5′ end and middle sections, respectively. As shown in Fig. 3, the peak currents of experiments for SBM are nearly unchanged after endonuclease cleavage, which are also 10 times larger than that of target microRNA experiments. The sharp contrasts promise this biosensor good performance to distinguish single-base mismatch. 3.4. MicroRNA assays in complex biological samples Serum has long been the sample of studies aiming at sensitive detection of cancer biomarkers for the diagnosis and prognosis of
P. Miao et al. / Biosensors and Bioelectronics 63 (2015) 365–370
369
are also promised. This biosensor may have many other advantages, such as fast response, low cost, convenient operation and redesign. Due to continuous discovery of vast impact of microRNAs on diseases, this biosensor can have immense applications in the diagnosis and prognosis of many diseases.
Acknowledgments This work is supported by the National Key Instrument Developing Project of China (Grant no. ZDYZ2013-1), the National Natural Science Foundation of China (Grant no. 31200745) and the Natural Science Foundation of Jiangsu Province of China (Grant no. BK20141204).
Fig. 3. Comparison of square wave voltammograms signal intensity in the cases of target microRNA, SBM1, SBM2 and SBM3 with the concentration of 1 nM.
the diseases. To confirm the practical value of the biosensor in complex biological fluids, attempts are also made in utilizing it in the detection of microRNA in human serum samples. The typical levels of circulating microRNAs in serum is in the range of 200 aM to 20 pM (Tsujiura et al., 2010), which is a subset of the detection range of this proposed method. As shown in Fig. 4, the results of this method for the detection of microRNA in serum samples are in good agreement with those of a commercial qRT-PCR kit. In addition, we have spiked different amount of microRNA in the samples. The obtained results demonstrate that the spiked microRNA with the concentration as low as 10 fM can be successfully distinguished in healthy human serums (Fig. S6). Moreover, the selectivity of the biosensor is further checked in serum samples with satisfactory results (Table S2).
4. Conclusions In summary, we have fabricated a novel strategy for ultrasensitive detection of microRNA using electrochemical techniques. A star trigon structure comprised of target, AP and CP is designed for endonuclease assisted signal amplification. Experiment results have well confirmed the remarkable high sensitivity and selectivity. Great utility in the applications to human serum sample assays
Fig. 4. Assays of microRNA concentrations in serum samples from breast cancer patients (A, B) and healthy individuals (C, D). Black columns are the results obtained by the proposed method and gray columns stands for the results of qRT-PCR.
Appendix A. Supplementary information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2014.07.075.
References Aguda, B.D., Kim, Y., Piper-Hunter, M.G., Friedman, A., Marsh, C.B., 2008. Proc. Natl. Acad. Sci. USA 105 (50), 19678–19683. Bardea, A., Burshtein, N., Rudich, Y., Salame, T., Ziv, C., Yarden, O., Naaman, R., 2011. Anal. Chem. 83 (24), 9418–9423. Bo, B., Miao, P., Xu, Y.Y., Shu, Y.Q., Li, G.X., 2013. Electrochem. Commun. 34, 142–145. Cao, Y., Chen, D.H., Chen, W.W., Yu, J.C., Chen, Z., Li, G.X., 2014. Anal. Chim. Acta 812, 45–49. Carthew, R.W., Sontheimer, E.J., 2009. Cell 136 (4), 642–655. Cui, L., Zhu, Z., Lin, N.H., Zhang, H.M., Guan, Z.C., Yang, C.Y.J., 2014. Chem. Commun. 50 (13), 1576–1578. Dong, H.F., Lei, J.P., Ding, L., Wen, Y.Q., Ju, H.X., Zhang, X.J., 2013. Chem. Rev. 113 (8), 6207–6233. Fabian, M.R., Sonenberg, N., Filipowicz, W., 2010. Annu. Rev. Biochem. 79, 351–379. Gerasimova, Y.V., Peck, S., Kolpashchikov, D.M., 2010. Chem. Commun. 46 (46), 8761–8763. Han, K., Miao, P., Tong, H., Liu, T., Cheng, W.B., Zhu, X.L., Tang, Y.G., 2014. Appl. Phys. Lett. 104 (5), 053101. He, L., He, X.Y., Lim, L.P., De Stanchina, E., Xuan, Z.Y., Liang, Y., Xue, W., Zender, L., Magnus, J., Ridzon, D., Jackson, A.L., Linsley, P.S., Chen, C.F., Lowe, S.W., Cleary, M.A., Hannon, G.J., 2007. Nature 447 (7148), 1130–1134. Hebert, S.S., De Strooper, B., 2007. Science 317 (5842), 1179–1180. Ianeselli, L., Grenci, G., Callegari, C., Tormen, M., Casalis, L., 2014. Biosens. Bioelectron. 55, 1–6. Li, G.X., Miao, P., 2012. Electrochemical Analysis of Proteins and Cells. Springer, Berlin, Germany. Li, N., Jablonowski, C., Jin, H.L., Zhong, W.W., 2009. Anal. Chem. 81 (12), 4906–4913. Li, Q.F., Tang, D.P., Tang, J.A., Su, B.L., Huang, J.X., Chen, G.N., 2011. Talanta 84 (2), 538–546. Liu, R., Chen, X., Du, Y.Q., Yao, W.Y., Shen, L., Wang, C., Hu, Z.B., Zhuang, R., Ning, G., Zhang, C.N., Yuan, Y.Z., Li, Z.S., Zen, K., Ba, Y., Zhang, C.Y., 2012. Clin. Chem. 58 (3), 610–618. Matsumae, Y., Arai, T., Takahashi, Y., Ino, K., Shiku, H., Matsue, T., 2013. Chem. Commun. 49 (58), 6498–6500. Miao, P., Liu, L., Li, Y., Li, G.X., 2009a. Electrochem. Commun. 11 (10), 1904–1907. Miao, P., Liu, L., Nie, Y.J., Li, G.X., 2009b. Biosens. Bioelectron. 24 (11), 3347–3351. Miao, P., Ning, L.M., Li, X.X., 2013. Anal. Chem. 85 (16), 7966–7970. miRBase, 〈http://www.mirbase.org/index.shtml〉, Release 20: June 2013. Mitchell, P.S., Parkin, R.K., Kroh, E.M., Fritz, B.R., Wyman, S.K., Pogosova-Agadjanyan, E.L., Peterson, A., Noteboom, J., O’Briant, K.C., Allen, A., Lin, D.W., Urban, N., Drescher, C.W., Knudsen, B.S., Stirewalt, D.L., Gentleman, R., Vessella, R.L., Nelson, P.S., Martin, D.B., Tewari, M., 2008. Proc. Natl. Acad. Sci. USA 105 (30), 10513–10518. Mori, M., Triboulet, R., Mohseni, M., Schlegelmilch, K., Shrestha, K., Camargo, F.D., Gregory, R.I., 2014. Cell 156 (5), 893–906. Qiu, Y.H., Yi, S., Keifer, A.E., 2011. Org. Lett. 13 (7), 1770–1773. Ryoo, S.R., Lee, J., Yeo, J., Na, H.K., Kim, Y.K., Jang, H., Lee, J.H., Han, S.W., Lee, Y., Kim, V.N., Min, D.H., 2013. ACS Nano 7 (7), 5882–5891. Sen, M., Ino, K., Inoue, K.Y., Arai, T., Nishijo, T., Suda, A., Kunikata, R., Shiku, H., Matsue, T., 2013. Biosens. Bioelectron. 48, 12–18. Si, M.L., Zhu, S., Wu, H., Lu, Z., Wu, F., Mo, Y.Y., 2007. Oncogene 26 (19), 2799–2803. Storhoff, J.J., Elghanian, R., Mucic, R.C., Mirkin, C.A., Letsinger, R.L., 1998. J. Am. Chem. Soc. 120 (9), 1959–1964. Taton, T.A., Mirkin, C.A., Letsinger, R.L., 2000. Science 289 (5485), 1757–1760. Tootoonchi, M.H., Yi, S., Kaifer, A.E., 2013. J. Am. Chem. Soc. 135 (29), 10804–10809.
370
P. Miao et al. / Biosensors and Bioelectronics 63 (2015) 365–370
Tsujiura, M., Ichikawa, D., Komatsu, S., Shiozaki, A., Takeshita, H., Kosuga, T., Konishi, H., Morimura, R., Deguchi, K., Fujiwara, H., Okamoto, K., Otsuji, E., 2010. Br. J. Cancer 102 (7), 1174–1179. Wanunu, M., Dadosh, T., Ray, V., Jin, J.M., McReynolds, L., Drndic, M., 2010. Nat. Nanotechnol. 5 (11), 807–814. Wark, A.W., Lee, H.J., Corn, R.M., 2008. Angew. Chem. Int. Ed. 47 (4), 644–652.
Williams, Z., Ben-Dov, I.Z., Elias, R., Mihailovic, A., Brown, M., Rosenwaks, Z., Tuschl, T., 2013. Proc. Natl. Acad. Sci. USA 110 (11), 4255–4260. Xiao, B., Wang, Y., Li, W., Baker, M., Guo, J., Corbet, K., Tsalik, E.L., Li, Q.J., Palmer, S. M., Woods, C.W., Li, Z.G., Chao, N.J., He, Y.W., 2013. Blood 122 (19), 3365–3375. Yang, S.W., Vosch, T., 2011. Anal. Chem. 83 (18), 6935–6939.
