EXPERIMENTAL

CELL

RESEARCH

199,373-377

(1992)

SHORT NOTE Assembly and Nuclear Transport of the U4 and U4/U6 snRNPs CORNELIA Max-Pkznck-Institut

fiir

WERSIG, Molekulare

ULRICH

GUDDAT,

TOMAS

Genetik, Otto- Warburg-Laboratorium,

INTRODUCTION

Small nuclear ribonucleoproteins (snRNPs) are essential components in the assembly of pre-mRNAs into spliceosomes and during nuclear pre-mRNA splicing. The four spliceosomal snRNPs, Ul, U2, U4/U6, and U5, are composed of snRNAs and a multitude of proteins, which can be divided into two classes: the Sm proteins, which are common to each of the spliceosomal snRNPs and which bind to a conserved snRNA sequence element, and snRNP-specific proteins (reviewed by Liihrmann [ 11). snRNAs undergo a series of RNA base modification and processing reactions, and the assembly of snRNPs proceeds through several stages, concomitant with nuclear-cytoplasmic translocations, before snRNPs can function as splicing factors in the nucleus. After synthesis by RNA polymerase II, Ul, U2, U4, and U5 snRNAs are exported to the cytoplasm, probably requiring their m7GpppN cap structure as a transport signal [2]. In the cytoplasm, they undergo cap trimethylation; at least in the case of Ul, U2, and U4

requests

should

AND ALBRECHT

BINDEREIF’

Zhnestrasse 73, D-l 000 Berlin 33 (Dahlem),

Germany

snRNAs, 3’ trimming to the mature length also occurs (reviewed in [3, 41). Cap trimethylation depends on prior binding of the common Sm proteins [5]; binding of snRNP-specific proteins appears to occur either in the cytoplasm or in the nucleus [6]. The subsequent cytoplasmic-nuclear migration of the Ul and U2 snRNPs depends on a bipartite signal composed of the trimethylguanosine (m,G) cap and one or several of the Sm proteins; in the case of U4 and U5 RNAs, the m,G cap is not essential for nuclear import [7-91. In contrast to the other spliceosomal RNAs, U6 RNA is transcribed by RNA polymerase III, carries a ymonomethyl cap [lo], and lacks the Sm binding site. When injected into the cytoplasm of Xenopus oocytes, U6 RNA migrates back to the nucleus, depending on an internal U6 sequence near the 5’ stem-loop [ll]. Newly transcribed U6 RNA, however, appears in Xenopus oocytes to be primarily restricted to the nucleus [12]. Nuclear import of U6 RNA, which is presumably required in dividing cells, does not depend on the y-monomethyl cap structure, and there is evidence that U6 transport occurs through a protein-mediated pathway [9,13]. As a likely candidate for a factor mediating nuclear targeting of U6 RNA, a protein binding to the 5’ terminal domain of U6 RNA has been identified and also detected as a component of the nuclear U6 snRNP, but not of the U4/U6 snRNP [ll, 141. Since U4 and U6 RNAs, when studied separately, appear to follow different pathways of transport, the question arose as to where the U4/U6 snRNP is assembled. We have therefore studied the cellular localization of U4 and U4/U6 snRNP formation in Xenopus oocytes. Our results strongly support the notion that U4/U6 snRNP assembly occurs in the nucleus.

We have analyzed the assembly of the spliceosomal U4/U6 snRNP by injecting synthetic wild-type and mutant U4 RNAs into the cytoplasm of Xenopus oocytes and determining the cytoplasmic-nuclear distribution of U4 and U4/U6 snRNPs by CsCl density gradient centrifugation. Whereas the U4 snRNP was localized in both the cytoplasmic and nuclear fractions, the U41U6 snRNP was detected exclusively in the nuclear fraction. Cytoplasmic-nuclear migration of the U4 snRNP did not depend on the stem II nor on the 5’ stem-loop region of U4 RNA. Our data provide strong evidence that, following the cytoplasmic assembly of the U4 snRNP, the interaction of the U4 snRNP with U6 RNA/ RNP occurs in the nucleus; furthermore, cytoplasmicnuclear transport of the U4 snRNP is independent of U4/U6 snRNP assembly. o 1992 Academic PRSS, IIN.

‘To whom correspondence and reprint dressed. Fax: 011-49-30-8307-384.

PIELER,

MATERIALS

AND

METHODS

SP6 transcription. Human U4 RNA and mutant RNAs were obtained by SP6 transcription of the following templates: SP6-U4, SP6U4 AstemII, and SP6-U4 A5’ stem-loop, each cut with DraI [15]. Unless otherwise noted, transcripts were capped with m’GpppG. Microinjection of Xenopus oocytes. 3ZP-labeled RNA was injected into the cytoplasm of Xenopus laeuis stage V/VI oocytes (per oocyte approximately 50 nl of 50 rig/al RNA with a specific activity of lo7

be ad-

373

0014-4827192

$3.00

Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

374

SHORT

NOTE

UC u G C G

CG u cA C G G C XPP.

:!F

GACACGCAAAUUCGUGAAGCGUUCCAUAUUUU

&!a

AUAU.ACUAAAAUUGGAACGAUACAGA

G AU G CGAwGn,

G A

120

-AA

"Y-- .l

GCCCCAUAACCCUUUUC

S’O

: A

i0

i.90 A

:, a’SkIn-loop

Control Stem-loop

A G

A c UU A

G A

iO0

FIG. 1. Secondary structure model of the human U4/U6 snRNP. This model corresponds to the U4/U6 consensus secondary structure [25]; the U4 and U6 RNA sequences are taken from Bark et al. (261 and Kunkel et al. [27]. The Sm binding site of U4 RNA is indicated by the boxed sequence; the regions deleted in SP6-U4 Astern11 and SP6-U4 A5’ stem-loop RNAs are indicated by bars.

cpm/,ug). Oocytes were incubated in MBSH buffer [16] at 19°C for 5 h. Analysis of U4 and U4lU6 snRNP assembly. For each analysis by CsCl density gradient centrifugation approximately 20 whole oocytes or, after transfer to buffer J [17] and manual separation of 20 oocytes into cytoplasm and nucleus in buffer D [18], equivalent amounts of cytoplasms or nuclei were used. They were homogenized in 100 ~1 of buffer D by repeated passage through a l-ml syringe with a 25.gauge needle, and the homogenate was cleared by brief centrifugation in an Eppendorf centrifuge (3 min at 12,000 rpm). Cleared homogenates were then subjected to CsCl density gradient centrifugation (20 h; 90,000 rpm; 4°C; Beckman tabletop ultracentrifuge; l-ml TLA-100 rotor; see [19]). Ten fractions of 100 ~1 each were taken from the top to the bottom (l-10); RNA was purified and analyzed by denaturing polyacrylamide gel electrophoresis.

RESULTS

To analyze the cellular localization of U4 and U4/U6 snRNP assembly, we used microinjection of 32P-labeled, synthetic U4 RNA and mutant derivatives into the cytoplasm of Xenopus oocytes, followed by isopycnic centrifugation through CsCl gradients. As shown previously, snRNP assembly proceeds efficiently in Xenopus oocytes due to large pools of unassembled snRNP proteins in the cytoplasm ([20]; reviewed by Mattaj [3]), and intracellular transport processes can be studied conveniently by dissecting nuclear and cytoplasmic fractions. snRNPs are stable in MgCl,-containing CsCl density gradients and distribute characteristically according to their buoyant density between free proteins

(density of 1.35 g/ml or less) and free RNA (density 1.7 g/ml) [21]; in particular, the U4 and U4/U6 snRNPs can be separated from each other and from free RNA on the basis of their different densities. Under our centrifugation conditions, the U4 snRNP peaks in fractions 2-3 and the U4/U6 snRNP in fractions 5-6, as determined by the sedimentation and immunoprecipitation behavior of the endogenous U4/U6 snRNP and of the reconstituted U4 snRNP ([19] and data not shown). First, we analyzed the assembly of wild-type SP6-U4 RNA (Fig. 1) after injection into the cytoplasm. After incubation for 5 h, extract was prepared from total oocytes and subjected to CsCl density centrifugation. Figure 2A shows the RNA analysis of gradient fractions. Approximately half of the SP6-U4 RNA had been assembled to RNP particles (fractions 1-6) running at the positions of the U4 and U4KJ6 snRNPs; the rest behaved as free RNA, a large portion of it being degraded to smaller RNA fragments (fractions 9-10). Second, in order to determine how the assembled complexes and the free RNA species distributed intracellularly, we separated oocytes, after cytoplasmic SP6-U4 RNA injection and incubation, into cytoplasmic and nuclear fractions, prepared extracts from both fractions, and analyzed them through CsCl density gradient centrifugation (Figs. 2B and 2C). We found that U4 RNPs and free U4 RNA were clearly differentially distributed. In the cytoplasm, a large fraction of U4 was in the form of the U4 snRNP (fractions 2 and 3), and most of the rest

SHORT

A

FIG. 2. snRNP assembly and intracellular distribution of SP6U4 RNA. 32P-labeled wild-type SP6-U4 RNA was injected into the cytoplasm of Xenopus oocytes; after incubation, extracts were preDared from total oocvtes (Al and from the cvtonlasmic (Bl and nu” clear fractions (C) and analyzed by CsCl density gradient centrifugation (indicated above the lanes, fractions l-10, from top to bottom). M, pBR322/HpoII marker fragments.

375

NOTE

extra nucleotides at the 3’ end of SP6-U4 RNA to the correct 3’ end [23]. In sum, these results support the idea that U4 is transported from the cytoplasm to the nucleus in the form of the U4 snRNP and is assembled with U6 to the U4KJ6 snRNP in the nucleus. To determine whether nuclear import of the U4 snRNP and U4/U6 snRNP assembly might be coupled processes, we used a mutant U4 RNA, SP6-U4 AstemII, which has the entire stem II region (nucleotides 1-16) precisely deleted (Fig. 1); as a result, this U4 deletion derivative can no longer interact with U6 RNA in vitro, yet binds Sm proteins as efficiently as wild-type U4 RNA [15]. After injection into the cytoplasm of Xenopus oocytes, snRNP assembly and cytoplasmic-nuclear distribution were analyzed (Fig. 3). As observed with wild-type SP6-U4 RNA, the nuclease-resistant RNP complex as well as partially degraded RNAs were present exclusively in the cytoplasm (Fig. 3A, fractions l-4 and 9, 10, respectively). Intact SP6-U4 Astern11 RNA was assembled to RNP complexes; in contrast to wildtype U4 RNA, however, in both the cytoplasmic and the nuclear fraction only RNP complexes running at the position of the U4 snRNP were found (compare Figs. 3A and 3B). No nuclear complexes were observed at the position of the U4/U6 snRNP (Fig. 3B, fractions 5 and 6). We obtained identical results when wild-type U4 RNA as an internal marker was coinjected together with SP6-U4 Astern11 RNA (data not shown). This result demonstrates that the Sh6-U4 Astern11 RNA does not interact with U6 RNA in duo, confirming our previous analysis in an in vitro system [15]. However, SP6-U4

B

A Ml234567891012345678910

ran as free, partially degraded RNA (fractions 9 and 10). In addition, a small fraction of U4 was in the form of RNP complexes containing degraded U4 RNA of between 70 and 90 nt (fractions l-3); most likely these partial RNP complexes contain the relatively nucleaseresistant Sm domain ([21, 221; see also below). The extent of RNA degradation is somewhat variable, as can be seen in the analysis of total and fractionated oocytes (Fig. 2); furthermore, the efficiency of U4/U6 snRNP formation may also depend on the exact amount of injected U4 RNA. Strikingly, in the nuclear fraction we could not detect any degraded nor any free RNA. U4 was exclusively in the form of RNP complexes, the distribution of which clearly peaked in fractions 2,3 and 5, 6, correspon&ng to the positions of the U4 and jJ4/U6 snRNPsi respectively. We consistently observed that U4 RNA in the nuclear fraction ran slightly faster than the major cytoplasmic U4 RNA band (compare Figs. 2B and 2C); most likely this reflects degradation of the few

FIG. 3. snRNP assembly and intracellular distribution of SP6U4 Astern11 RNA. “P-labeled SP6-U4 Astern11 RNA was injected into the cytoplasm of Xenopus oocytes; after incubation and nuclear-cytoplasmic dissection, extracts were prepared from the cytoplasmic (A) and nuclear fractions (B) and analyzed by CsCl density gradient centrifugation (indicated above the lanes, fractions l-10, from top to bottom). M, pBR322/HpaII marker fragments.

376 A

SHORT B

M1234567691012345670910

NOTE

stronger in the case of SP6-U4 A5’ stem-loop RNA than for wild-type SP6-U4 RNA ([15]; compare the gradient distribution of RNP complexes in Figs. 4B and 2B). DISCUSSION

FIG. 4. snRNP assembly and intracellular distribution of SP6U4 A5’ stem-loop RNA. “P-labeled SP6-U4 Astern11 RNA was injected together with “P-labeled SP6-U4 Astern11 RNA into the cytoplasm of Xenopus oocytes; after incubation and nuclear-cytoplasmic dissection, extracts were prepared from the cytoplasmic (A) and nuclear fractions (B) and analyzed by CsCl density gradient centrifugation (indicated above the lanes, fractions l-10, from top to bottom). M, pBR322/HpaII marker fragments.

Astern11 RNA is transported into the nucleus with an efficiency similar to that of wild-type U4 RNA (compare cytoplasmic-nuclear ratio of full-length U4 RNA in Figs. 2 and 3). Therefore we conclude that nuclear import of U4 RNA and U4-U6 interaction can be uncoupled from each other. Finally we tested a mutant U4 RNA derivative, SP6U4 A5’ stem-loop, which has the 5’ stem-loop region (nucleotides 19-55) deleted (Fig. 1); this mutant RNA still binds Sm proteins and interacts in vitro with U6 RNA at an efficiency somewhat above that of wild-type U4 RNA [15]. However, the 5’ stem-loop is important for the interaction of the U4/U6 and the U5 snRNPs in U4/U5/ U6 multi-snRNP formation ([24], C. Wersig and A. Bindereif, unpublished results). Assembly of SP6-U4 A5 stem-loop RNA into RNP complexes and their cellular distribution were assayed as before, using SP6-U4 Astern11 as an internal marker (Fig. 4). Again, free RNA and complexes of partially degraded RNAs were excluded from the nucleus and present only in the cytoplasmic fraction (Fig. 4A). SP6-U4 A5’ stem-loop RNA formed complexes with a cellular distribution similar to that of wild-type SP6-U4 RNA. We interpret this behavior by the cytoplasmic formation of RNP complexes of SP6-U4 A5’ stem-loop RNA containing the Sm proteins (Fig. 4A, fractions l-4) and the subsequent transport of these complexes into the nucleus, where they interact with U6 RNA (Fig. 4B, fractions 4-6). Significantly, in the nuclear fraction we found U4 A5’ stem-loop RNA to be almost exclusively complexed with U6 RNA, confirming our in vitro data that the U4-U6 interaction is

We have analyzed the cellular localization of U4 and U4/U6 snRNP assembly in Xenopus oocytes, using synthetic U4 RNA derivatives. Our results strongly argue for cytoplasmic U4 snRNP assembly followed by U4-U6 interaction in the nucleus. Nuclear migration and U4U6 interaction are not mechanistically linked with each other, as a U4 mutant RNA defective in U4-U6 interaction is still efficiently translocated into the nucleus. An alternative explanation would be that the U4KJ6 snRNP is assembled in the cytoplasm, but transported rapidly into the nucleus. Since we detected a large fraction of the U4 snRNP in the nucleus, we consider this possibility to be very unlikely. In addition, we have tried to arrest nuclear import by using U4 RNA that cannot be trimethylated. However, unlike the case of the Ul snRNP [7], ApppG-capped U4 RNA was not completely blocked from being transported into the nucleus ([9] and data not shown); yet even in this case no cytoplasmic U4/U6 snRNP could be detected, confirming our main conclusion that U4/U6 snRNP assembly takes place in the nucleus and consistent with previous results of Vankan et al. [12] that U6 RNA does not leave the nucleus. Before entering the spliceosome, the U4/U6 snRNP most likely has to interact with the U5 snRNP to result in the U4/U5/U6 multi-snRNP. For further studies of the cellular localization of snRNP assembly it will therefore be particularly interesting to dissect the transport processes of the U5 snRNP and of its protein components. We acknowledge Thomas Weissensteiner for experimental support in the early phase of this project. This work was supported by the Deutsche Forschungsgemeinschaft (SFB 344X5 and A5).

REFERENCES 1. 2. 3. 4.

Ltihrmann, R. (1990) Biochim. Biophys. Actu 1087,265292. Hamm, J., and Mattaj, I. W. (1990) Cell 63, 109-118. Mattaj, I. W. (1988) in Small Nuclear Ribonucleoprotein Particles (Birnstiel, M., Ed.), pp. 100-114, Springer-Verlag, Berlin. Zieve, G. W., and Feeney, R. J. (1990) Prog. Mol. Subcell. Biol.

11,51-85. 5. 6. 7. 8. 9.

Mattaj, I. W. (1986) Cell 46, 905-911. Feeney, R. J., and Zieve, G. W. (1990) J. Cell Biol. 110,871-881. Fischer, II., and Ltihrmann, R. (1990) Science 249,786-790. Hamm, J., Darzynkiewicz, E., Tahara, S. M., and Mattaj, I. W. (1990) Cell 62,569-577. Fischer, U., Darzynkiewicz, Tahara, S. M., Dathan, N. A.,

SHORT Liihrmann, R., and Mattaj, I. W. (1991) J. Cell Biol. 113, 705714. 10. Singh, R., and Reddy, R. (1989) Proc. N&l. Acad. Sci. USA 86, 8280-8283. 11. Hamm, J., and Mattaj, I. W. (1989) EMBOJ. 8.4179-4187. 12. Vankan, P., McGuigan, C., and Mattaj, I. W. (1990) EMEO J. 9, 3397-3404. 13. Michaud, N., and Goldfarb, D. S. (1991) J. Cell Biol. 112, 215223. 14. Groning, K., Palfi, Z., Gupta, S., Cross, M., Wolff, T., and Bindereif, A. (1991) Mol. Cell. Biol. 11, 2026-2034. 15. Wersig, C., and Bindereif, A. (1990) Nucleic Acids Res. 18,6223-

6229. 16. 17. 18.

19. 20. 21. 22. 23. 24. 25.

Gurdon, J. B. (1977) Methods Cell Biol. 16, 125-139. Birkenmeier, E. H., Brown, D. D., and Jordan, E. (1978) Cell 16, 1077-1086. Dignam, D. L., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489.

Received October 29,199l Revised version received December

NOTE

6, 1991

26. 27.

377 Pikielny, C. W., Bindereif, A., and Green, M. R. (1989) Genes Dev. 3,479-487. Zeller, R., Nyffenegger, T., and DeRobertis, E. M. (1983) Cell 32,425-434. Lelay-Taha, M.-N., Reveillaud, I., Sri-Widada, J., Brunel, C., and Jeanteur, P. (1986) J. Mol. Biol. 189,519-532. Liautard, J.-P., Sri-Widada, J., Brunel, C., and Jeanteur, P. (1982) J. Mol. Biol. 162, 623-643. Madore, S. J., Wieben, E. D., Kunkel, G. R., and Pederson, T. (1984) J. Cell Biol. 99, 1140-1144. Bordonne, R., Banroques, J., Abelson, J., and Guthrie, C. (1990) Genes Dev. 4,1185-1196. Guthrie, C., and Patterson, B. (1988) Annu. Rev. Genet. 22,387419. Bark, C., Weller, P., Zabielski, J., and Pettersson, U. (1986) Gene 50, 333-344. Kunkel, G. R., Maser, R. L., Calvet, J. P., and Pederson, T. (1986) Proc. Natl. Acad. Sci. USA 83.8575-8579.