Nucleic Acids Research, Vol. 20, No. 14 3625-3630
U1 - U2 snRNPs interaction induced by an RNA complementary to the 5' end sequence of Ul snRNA Marie-Claire Daugeron, Jamal Tazi, Philippe Jeanteur, Claude Brunel* and Guy Cathala UA CNRS 1191, Gen6tique Moleculaire, Laboratoire de Biochimie, CRLC Val d'Aurelle-Paul Lamarque, Parc Euromedecine, 34094 Montpellier Cedex 2 and Laboratoire de Biologie Moleculaire, Universite Montpellier 11, Sciences et Techniques du Languedoc, Place E. Bataillon, CP 012, 34095 Montpellier Cedex 05, France Received April 8, 1992; Revised and Accepted June 25, 1992
ABSTRACT Several lines of evidences indicate that Ul and U2 snRNPs become interacting during pre-mRNA splicing. Here we present data showing that an Ul - U2 snRNPs interaction can be mediated by an RNA only containing the consensus 5' splice site of all of the sequences characteristic of pre-mRNAs. Using monospecific antibodies (anti-(Ul) RNP and anti-(U2) RNP), we have found that a tripartite complex comprising Ul and U2 snRNPs is immunoprecipitated in the presence of a consensus 5' splice site containing RNA, either from a crude extract or from an artificial mixture enriched in Ul and U2 snRNPs. This complex does not appear in the presence of an RNA lacking the sequence complementary to the 5' terminus of Ul snRNA. Moreover, RNAse Ti protection coupled to immunoprecipitation experiments have demonstrated that only the 5' end sequence of Ul snRNA contacts the consensus 5' splice site containing RNA, arguing that U2 snRNP binding in the tripartite complex is mediated by Ul snRNP. INTRODUCTION Splicing of pre-mRNAs occurs in a ribonucleoprotein structure called the spliceosome. In vitro studies in both mammalian and yeast systems based on affinity selection and non-denaturing gel analyses have demonstrated that the abundant Ul, U2, U5 and U4 -U6 ribonucleoprotein particles (U snRNPs) are among the main components of the spliceosome apparatus (for recent reviews, see 1-5). The other actors are auxiliary non-snRNPs proteins, whose exact number is not yet definitively established and, almost certainly, ATP requiring enzymes whose association with the spliceosome could be transient (6, 7). A stepwise pathway of snRNPs and proteins binding to premRNAs is involved to assemble the functional spliceosome. Concerning the snRNPs, current models hold that Ul and U2
snRNPs interact with the 5' splice site and the branchpoint sequence, respectively, to give a pre-splicing complex and then the spliceosome is formed upon addition of a pre-assembled multisnRNP complex comprising U4 -U6 and U5 snRNPs (8-10). As to the non-snRNP proteins, it is now well established that some of them are involved at very early stages of spliceosome assembly, for example U2AF (11, 12), pPTB (13), both being most likely required for U2 snRNP binding, and SF2 (14, 15) also called ASF for alternative splicing factor (16). Other proteins have been described but their involvement in splicing is not as well documented. These include the Al and C proteins (17-19) as well as the so-designated intron binding proteins (20, 21), which all interact specifically with the polypyrimidine tract/3' splice site of pre-mRNAs, and some other components whose involvement in splicing was evidenced by monoclonal antibodies either raised against purified spliceosomes (22) or native hnRNP (23). However, the assembly of a functional spliceosome is most likely much more complicated than previously thought. For example, recent studies in the yeast Saccharomyces cerevisiae system have revealed a role for the highly conserved UACUAAC branchpoint sequence in the formation of commitment complexes containing Ul snRNP (24-26). In mammals as well, targeted depletion of Ul snRNP with 2'-OMe antisense RNA showed that Ul snRNP most likely stabilizes U2 snRNP binding to the branchpoint sequence in a fashion independent of the Ul snRNA-5' splice site interaction (27). Taking now into account these previously unrevealed early Ul -U2 snRNPs interactions at the branchpoint sequence, we asked whether, similarly, Ul and U2 snRNPs can together contact the 5' splice site of pre-mRNAs. To this aim, we have used a small synthetic RNA containing a sequence complementary to the 5' terminus of Ul snRNA as a 5' splice site and have based our investigation on the use of anti-(Ul) and anti-(U2) RNP antibodies. Here we demonstrate that a fraction of Ul and U2 snRNPs interact together in the presence of such an RNA.
* To whom correspondence should be addressed at: UA CNRS 1191, Genetique Moleculaire, Universite Montpellier II, Sciences et Techniques du Languedoc, Place E. Bataillon, CP 012, 34095 Montpellier Cedex 05, France
3626 Nucleic Acids Research, Vol. 20, No. 14
MATERIALS AND METHODS Materials T7 RNA polymerase, RNasin, restriction enzymes and DNase I (RNase-free) were from Promega Biotec, RNase TI from Calbiochem, ribonucleotides triphosphates from Boehringer Mannheim, m7G5'pppG5' Cap from Pharmacia LKB Biotechnology Inc., [a- 32P] UTP and 32p orthophosphate from Amersham Corp. All other chemicals were of analytical grade.
Plasmids, T7 transcription, nuclear extracts and oligodeoxynucleotide-directed cleavage of snRNAs The ABPA3'T7 plasmid was constructed by inserting the HindIllEcoRI fragment from the ABPA3' plasmid previously described (28) in pSP73 vector. Corresponding RNA was synthesized after cutting the plasmid at the BglIl site. Conditions for transcription were as previously described (20) using T7 RNA polymerase. Preparation of HeLa cell nuclear extracts was as originally described (29) in Triethanolamine buffer (20 mM TEA (pH 7.9), 20% [v/v] glycerol, 0.1 M KCl, 0.2 mM EDTA, 0.5 mM DTT) (20). 32P-labeled nuclear extracts were prepared from cells which were resuspended, to a concentration of 3 x 105/ml, in 3 1 of phosphate-free MEM (eagle) medium supplemented with 5 % non-dialyzed newborn calf serum and exposed to 10 mCi carrierfree H332P04 (Amersham) for at least 15 h. Oligodeoxynucleotide cleavage of U 1 and U2 snRNAs (nt 1 - 15) was as described (28).
Isolation of Ul and U2 snRNPs by glycerol gradient centrifugation 200 Al of in vivo 32p labeled nuclear extract were two-fold diluted with TEA buffer without glycerol and then layered onto a 12 ml linear 10-30% [v/v] glycerol gradient in TEA buffer. Centrifugation was in a Beckman SW 40 rotor at 29,000 rpm for 18 hours (4°C). 24 fractions of 500 ,ul were harvested from top to bottom and analyzed for snRNA contents. Those enriched in U1 and U2 snRNPs, respectively, were pooled, dialysed during 3 hours against TEA buffer containing 1 mM MgC12 and finally concentrated to about 200 p,l in Centricon 10 microconcentrators (Amicon). Each concentrated pool was referred as 'purified' Ul and 'purified' U2 snRNPs.
Immunoblots, immunoprecipitations and immunoselection of RNase Ti RNA fragments The patient anti-(U2) RNP (Ya), the mouse monoclonal anti-(U2) RNP (4G3), the mouse monoclonal anti-(U1) RNP (2.73), the patient anti-(Ul,U2) RNP (pick U1-U2) and the anti-2,2,7 trimethyl guanosine antibodies were generous gifts respectively from Dr. Mimori (Keio University, Japan), Dr. van Venrooij (Nijmegen University), Dr. Hoch (Agouron institute, La Jolla), Dr. Mattaj (EMBL, Heidelberg) and Dr. Luhrmann (IMT, Marburg). The anti-(U 1) RNP serum Go was from the Centre de Tranfusion Sanguine, Montpellier (Dr. H.Graafland). Proteins from nuclear extracts were fractionated in SDS/10% polyacrylamide gels and electrophoretically transferred to nitrocellulose sheets (BA83 Schleicher & Schull) as described (30). After blocking the sheet in TTBS buffer (100 mM TrisHCl (pH 7.5), 0.9% NaCl, 0.1% [v/v] Tween 20, 1% bovine serum albumin, 0.5% gelatin) strips were cut and used to test antibodies diluted in TTBS buffer. Detection was using 125Ilabeled protein A and autoradiography. assays,
antibodies
were
For
immunoprecipitations
pre-bound to 25 yl protein A Sepharose
and washed four times in NET 2 buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.05% Nonidet P-40, 0.5 mM dithiothreitol). 20 Al reactions with or without 1 ig of cold ABPA3' RNA contained 15% in vivo 32P-labeled nuclear extract, 30% TEA buffer, 3.2 mM MgCl2, 1mM Dithiothreitol and 2u/4l RNasin. They were incubated for 10 min at 0°C, added to antibodies bound protein A Sepharose beads and then again incubated for two hours at 4°C. After six washes in NET 2 buffer, bound material was submitted to proteinase K digestion. Released RNAs were extracted, separated by electrophoresis in 10% polyacrylamide-urea gels in TBE buffer and finally detected by autoradiography. The so-referred 'purified' Ul and U2 snRNPs were similarly immunoprecipitated. Immunoselection of RNase TI RNA fragments were in 20 Al reactions as described (28) starting from 1 x 106 cpm (cerenkov counting) ABPA3' T7 RNA. Electrophoresis of protected fragments was on prerun 20% polyacrylamide-8 M urea gels in TBE buffer.
RESULTS The RNA complementary to the 5' end of Ul snRNA Previous work in our laboratory led to the conclusion that RNAs containing a sequence complementary to the 5' terminus of mammalian U 1 snRNA (nt 1 - 1 ) are competent to instantaneously form, at 0°C and in the absence of ATP, an abundant and stable complex depending on the integrity of the 5' terminus of Ul snRNA sequence (28). This complex is perfectly visible in non-denaturing gels under technical conditions where Ul snRNP is neither detected in pre-splicing nor in splicing complexes (31). Since the ABPA3' RNA only contains the consensus 5' splice site among all sequences characteristic of premRNAs, we surmised that it could be a suitable substrate to now determine whether U2 snRNP can contact already bound U 1 snRNP. The ABPA3' RNA has been described in a previous work (28). Here the ABPA3' sequence was inserted into the HindlIlEcoRi sites of the pSP 73 plasmid and RNA was transcribed using T7 RNA polymerase (Figure 1). An U1 -U2 interaction revealed by monospecific antibodies against U2 and Ul snRNPs Northern blot analyses from retarding gels having revealed that the U1 snRNP-depending complex formed is poorly separated from endogenous snRNPs, we have based our investigation on the use of antibodies. Should Ul - U2 snRNP contacts mediated by an RNA containing a 5' splice site exist, then an anti-(U2) RNP antibody should precipitate U1 snRNP as well as, after RNase TI digestion, an RNA fragment corresponding to the portion of sequence where Ul snRNP interacts. Reciprocally, an anti-(U 1) RNP should be able to precipitate some U2 snRNP in the presence of an RNA complementary to the 5' end of U 1 snRNA. We have used three antibodies, one from a patient serum (Go) we first listed as solely being of anti-(Ul) RNP specificity (32), a second one called 'pick Ul -U2' (33) and the anti-(U2) RNP, from patient Ya serum, known to precipitate U2 snRNP predominantly, a small amount of U1 snRNP except when diluted, but neither U4-U6 nor U5 snRNPs (34). A detailed analysis including immunoprecipitations and immunoblots was carried out to determine whether the precipitation of some Ul snRNP by the patient Ya serum could be or not an obstacle in experiments aimed at deciphering U 1 - U2 interactions in crude nuclear extracts. Figure 2A shows the RNAs that are precipitated
Nucleic Acids Research, Vol. 20, No. 14 3627 Cap
1.
10
20
30
40
50
60
70
80
100
90
GGAGACCGGCCUCGAGCAGCUGIcAGCUUGGGCUGCAGGUCGAACAGGUAAGUAUCUAGAGGAUCCCCGGGCGAGCUCGAAUCAUCGAUGAUAUCAGAUCOH
5 ' ss
Figure 1. Sequence of the ABPA3'RNA. The sequence has been numbered counting the cap as nucleotide 0. A segment refers to the RNAse TI fragment protected already identified (ref.28 and Figure 5). Box refers to the sequence complementary to the 5' end of Ul snRNA.
from 32P-labeled HeLa cells nuclear extracts by the patient Go serum (lane 1), the patient Ya serum (lane 2) and pick Ul -U2 (lane 3). As expected, the patient Ya serum predominantly precipitates U2 snRNA and some U1, while 'pick U1 -U2' precipitates considerable amounts of both. Surprisingly, the first listed anti-(Ul) RNP serum Go also precipitates some U2 snRNA suggesting that nuclear extracts competent for splicing contain some complexes where Ul and U2 snRNPs are already interacting. Other immunoprecipitations were carried out using a fraction from glycerol gradients depleted of all but Ul snRNP (Materials and Methods) as source of antigen. This isolated Ul snRNP was precipitated by the Go (lane 4) but not at all by the Ya serum (lane 5) although being native since containing all of the antigenic 70 Kd, A and C proteins (not shown). It has been demonstrated previously that the Ul RNP-specific A and the U2 RNP-specific B" proteins share at least one common epitope (35) therefore possibly explaining why the serum Ya precipitates a small amount of Ul snRNA in addition to U2 snRNA. However, the Ya serum identifies the U2 RNP-specific A' and much more weakly the U2 RNP-specific B' proteins (ref. 34 and Figure 2B, lane 3). It does not recognizes the Ul snRNPspecific A protein from crude nuclear extracts (Figure 2B, lane 3) in contrast to what was observed by Mimori et al. (34) from a Ul snRNP enriched sample. However, our finding that 'purified' Ul snRNP is not at all precipitated by serum Ya rather agrees with our observation and provides evidence that the presence of the Ul snRNP-specific A protein cannot explain why serum Ya precipitates Ul snRNP from crude extracts. Our immunoblots could lead to the conclusion that the sera 'pick U1-U2' and Go share common specificities since both recognize the U1 snRNP-specific 70 Kd and A proteins and what is most likely the U2 snRNP-specific B" at least in the case of pick 'U1-U2' (Figure 2B, lanes 4, 5 respectively). However, serum Go is unable to precipitate U2 snRNP either -from a glycerol gradient fraction mainly containing U2 snRNP or from a mixture made of 'purified' Ul and U2 snRNPs (see below in Figure 5) in contrast to pick U1-U2 (not shown). One can note also that pick Ul -U2 decorates another band below the U1 snRNP-spcific 70 Kd protein (lane 5). In brief, our results argue that the already described coprecipitation of U1 and U2 snRNAs by serum Ya (34) cannot be solely explained by the presence of a low level of anti-(Ul) RNP antibodies or by common epitope sharing of A and B" proteins (35). It seems also likely that some snRNP complexes containing both Ul and U2 snRNAs could exist in nuclear extracts or be created upon incubation. This is supported by two independent results. The first one is that serum Go, described as being of U1 snRNP specificity, also precipitates a small amount of U2 from these nuclear extracts (fig. 2A, lane 1). The second one is that the U2-specific monoclonal antibody 4G3 was, in our
-.
- -
A
t
C
ZZ
U1 - U2 snRNPs interaction induced by an RNA complementary to the 5' end sequence of Ul snRNA Marie-Claire Daugeron, Jamal Tazi, Philippe Jeanteur, Claude Brunel* and Guy Cathala UA CNRS 1191, Gen6tique Moleculaire, Laboratoire de Biochimie, CRLC Val d'Aurelle-Paul Lamarque, Parc Euromedecine, 34094 Montpellier Cedex 2 and Laboratoire de Biologie Moleculaire, Universite Montpellier 11, Sciences et Techniques du Languedoc, Place E. Bataillon, CP 012, 34095 Montpellier Cedex 05, France Received April 8, 1992; Revised and Accepted June 25, 1992
ABSTRACT Several lines of evidences indicate that Ul and U2 snRNPs become interacting during pre-mRNA splicing. Here we present data showing that an Ul - U2 snRNPs interaction can be mediated by an RNA only containing the consensus 5' splice site of all of the sequences characteristic of pre-mRNAs. Using monospecific antibodies (anti-(Ul) RNP and anti-(U2) RNP), we have found that a tripartite complex comprising Ul and U2 snRNPs is immunoprecipitated in the presence of a consensus 5' splice site containing RNA, either from a crude extract or from an artificial mixture enriched in Ul and U2 snRNPs. This complex does not appear in the presence of an RNA lacking the sequence complementary to the 5' terminus of Ul snRNA. Moreover, RNAse Ti protection coupled to immunoprecipitation experiments have demonstrated that only the 5' end sequence of Ul snRNA contacts the consensus 5' splice site containing RNA, arguing that U2 snRNP binding in the tripartite complex is mediated by Ul snRNP. INTRODUCTION Splicing of pre-mRNAs occurs in a ribonucleoprotein structure called the spliceosome. In vitro studies in both mammalian and yeast systems based on affinity selection and non-denaturing gel analyses have demonstrated that the abundant Ul, U2, U5 and U4 -U6 ribonucleoprotein particles (U snRNPs) are among the main components of the spliceosome apparatus (for recent reviews, see 1-5). The other actors are auxiliary non-snRNPs proteins, whose exact number is not yet definitively established and, almost certainly, ATP requiring enzymes whose association with the spliceosome could be transient (6, 7). A stepwise pathway of snRNPs and proteins binding to premRNAs is involved to assemble the functional spliceosome. Concerning the snRNPs, current models hold that Ul and U2
snRNPs interact with the 5' splice site and the branchpoint sequence, respectively, to give a pre-splicing complex and then the spliceosome is formed upon addition of a pre-assembled multisnRNP complex comprising U4 -U6 and U5 snRNPs (8-10). As to the non-snRNP proteins, it is now well established that some of them are involved at very early stages of spliceosome assembly, for example U2AF (11, 12), pPTB (13), both being most likely required for U2 snRNP binding, and SF2 (14, 15) also called ASF for alternative splicing factor (16). Other proteins have been described but their involvement in splicing is not as well documented. These include the Al and C proteins (17-19) as well as the so-designated intron binding proteins (20, 21), which all interact specifically with the polypyrimidine tract/3' splice site of pre-mRNAs, and some other components whose involvement in splicing was evidenced by monoclonal antibodies either raised against purified spliceosomes (22) or native hnRNP (23). However, the assembly of a functional spliceosome is most likely much more complicated than previously thought. For example, recent studies in the yeast Saccharomyces cerevisiae system have revealed a role for the highly conserved UACUAAC branchpoint sequence in the formation of commitment complexes containing Ul snRNP (24-26). In mammals as well, targeted depletion of Ul snRNP with 2'-OMe antisense RNA showed that Ul snRNP most likely stabilizes U2 snRNP binding to the branchpoint sequence in a fashion independent of the Ul snRNA-5' splice site interaction (27). Taking now into account these previously unrevealed early Ul -U2 snRNPs interactions at the branchpoint sequence, we asked whether, similarly, Ul and U2 snRNPs can together contact the 5' splice site of pre-mRNAs. To this aim, we have used a small synthetic RNA containing a sequence complementary to the 5' terminus of Ul snRNA as a 5' splice site and have based our investigation on the use of anti-(Ul) and anti-(U2) RNP antibodies. Here we demonstrate that a fraction of Ul and U2 snRNPs interact together in the presence of such an RNA.
* To whom correspondence should be addressed at: UA CNRS 1191, Genetique Moleculaire, Universite Montpellier II, Sciences et Techniques du Languedoc, Place E. Bataillon, CP 012, 34095 Montpellier Cedex 05, France
3626 Nucleic Acids Research, Vol. 20, No. 14
MATERIALS AND METHODS Materials T7 RNA polymerase, RNasin, restriction enzymes and DNase I (RNase-free) were from Promega Biotec, RNase TI from Calbiochem, ribonucleotides triphosphates from Boehringer Mannheim, m7G5'pppG5' Cap from Pharmacia LKB Biotechnology Inc., [a- 32P] UTP and 32p orthophosphate from Amersham Corp. All other chemicals were of analytical grade.
Plasmids, T7 transcription, nuclear extracts and oligodeoxynucleotide-directed cleavage of snRNAs The ABPA3'T7 plasmid was constructed by inserting the HindIllEcoRI fragment from the ABPA3' plasmid previously described (28) in pSP73 vector. Corresponding RNA was synthesized after cutting the plasmid at the BglIl site. Conditions for transcription were as previously described (20) using T7 RNA polymerase. Preparation of HeLa cell nuclear extracts was as originally described (29) in Triethanolamine buffer (20 mM TEA (pH 7.9), 20% [v/v] glycerol, 0.1 M KCl, 0.2 mM EDTA, 0.5 mM DTT) (20). 32P-labeled nuclear extracts were prepared from cells which were resuspended, to a concentration of 3 x 105/ml, in 3 1 of phosphate-free MEM (eagle) medium supplemented with 5 % non-dialyzed newborn calf serum and exposed to 10 mCi carrierfree H332P04 (Amersham) for at least 15 h. Oligodeoxynucleotide cleavage of U 1 and U2 snRNAs (nt 1 - 15) was as described (28).
Isolation of Ul and U2 snRNPs by glycerol gradient centrifugation 200 Al of in vivo 32p labeled nuclear extract were two-fold diluted with TEA buffer without glycerol and then layered onto a 12 ml linear 10-30% [v/v] glycerol gradient in TEA buffer. Centrifugation was in a Beckman SW 40 rotor at 29,000 rpm for 18 hours (4°C). 24 fractions of 500 ,ul were harvested from top to bottom and analyzed for snRNA contents. Those enriched in U1 and U2 snRNPs, respectively, were pooled, dialysed during 3 hours against TEA buffer containing 1 mM MgC12 and finally concentrated to about 200 p,l in Centricon 10 microconcentrators (Amicon). Each concentrated pool was referred as 'purified' Ul and 'purified' U2 snRNPs.
Immunoblots, immunoprecipitations and immunoselection of RNase Ti RNA fragments The patient anti-(U2) RNP (Ya), the mouse monoclonal anti-(U2) RNP (4G3), the mouse monoclonal anti-(U1) RNP (2.73), the patient anti-(Ul,U2) RNP (pick U1-U2) and the anti-2,2,7 trimethyl guanosine antibodies were generous gifts respectively from Dr. Mimori (Keio University, Japan), Dr. van Venrooij (Nijmegen University), Dr. Hoch (Agouron institute, La Jolla), Dr. Mattaj (EMBL, Heidelberg) and Dr. Luhrmann (IMT, Marburg). The anti-(U 1) RNP serum Go was from the Centre de Tranfusion Sanguine, Montpellier (Dr. H.Graafland). Proteins from nuclear extracts were fractionated in SDS/10% polyacrylamide gels and electrophoretically transferred to nitrocellulose sheets (BA83 Schleicher & Schull) as described (30). After blocking the sheet in TTBS buffer (100 mM TrisHCl (pH 7.5), 0.9% NaCl, 0.1% [v/v] Tween 20, 1% bovine serum albumin, 0.5% gelatin) strips were cut and used to test antibodies diluted in TTBS buffer. Detection was using 125Ilabeled protein A and autoradiography. assays,
antibodies
were
For
immunoprecipitations
pre-bound to 25 yl protein A Sepharose
and washed four times in NET 2 buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.05% Nonidet P-40, 0.5 mM dithiothreitol). 20 Al reactions with or without 1 ig of cold ABPA3' RNA contained 15% in vivo 32P-labeled nuclear extract, 30% TEA buffer, 3.2 mM MgCl2, 1mM Dithiothreitol and 2u/4l RNasin. They were incubated for 10 min at 0°C, added to antibodies bound protein A Sepharose beads and then again incubated for two hours at 4°C. After six washes in NET 2 buffer, bound material was submitted to proteinase K digestion. Released RNAs were extracted, separated by electrophoresis in 10% polyacrylamide-urea gels in TBE buffer and finally detected by autoradiography. The so-referred 'purified' Ul and U2 snRNPs were similarly immunoprecipitated. Immunoselection of RNase TI RNA fragments were in 20 Al reactions as described (28) starting from 1 x 106 cpm (cerenkov counting) ABPA3' T7 RNA. Electrophoresis of protected fragments was on prerun 20% polyacrylamide-8 M urea gels in TBE buffer.
RESULTS The RNA complementary to the 5' end of Ul snRNA Previous work in our laboratory led to the conclusion that RNAs containing a sequence complementary to the 5' terminus of mammalian U 1 snRNA (nt 1 - 1 ) are competent to instantaneously form, at 0°C and in the absence of ATP, an abundant and stable complex depending on the integrity of the 5' terminus of Ul snRNA sequence (28). This complex is perfectly visible in non-denaturing gels under technical conditions where Ul snRNP is neither detected in pre-splicing nor in splicing complexes (31). Since the ABPA3' RNA only contains the consensus 5' splice site among all sequences characteristic of premRNAs, we surmised that it could be a suitable substrate to now determine whether U2 snRNP can contact already bound U 1 snRNP. The ABPA3' RNA has been described in a previous work (28). Here the ABPA3' sequence was inserted into the HindlIlEcoRi sites of the pSP 73 plasmid and RNA was transcribed using T7 RNA polymerase (Figure 1). An U1 -U2 interaction revealed by monospecific antibodies against U2 and Ul snRNPs Northern blot analyses from retarding gels having revealed that the U1 snRNP-depending complex formed is poorly separated from endogenous snRNPs, we have based our investigation on the use of antibodies. Should Ul - U2 snRNP contacts mediated by an RNA containing a 5' splice site exist, then an anti-(U2) RNP antibody should precipitate U1 snRNP as well as, after RNase TI digestion, an RNA fragment corresponding to the portion of sequence where Ul snRNP interacts. Reciprocally, an anti-(U 1) RNP should be able to precipitate some U2 snRNP in the presence of an RNA complementary to the 5' end of U 1 snRNA. We have used three antibodies, one from a patient serum (Go) we first listed as solely being of anti-(Ul) RNP specificity (32), a second one called 'pick Ul -U2' (33) and the anti-(U2) RNP, from patient Ya serum, known to precipitate U2 snRNP predominantly, a small amount of U1 snRNP except when diluted, but neither U4-U6 nor U5 snRNPs (34). A detailed analysis including immunoprecipitations and immunoblots was carried out to determine whether the precipitation of some Ul snRNP by the patient Ya serum could be or not an obstacle in experiments aimed at deciphering U 1 - U2 interactions in crude nuclear extracts. Figure 2A shows the RNAs that are precipitated
Nucleic Acids Research, Vol. 20, No. 14 3627 Cap
1.
10
20
30
40
50
60
70
80
100
90
GGAGACCGGCCUCGAGCAGCUGIcAGCUUGGGCUGCAGGUCGAACAGGUAAGUAUCUAGAGGAUCCCCGGGCGAGCUCGAAUCAUCGAUGAUAUCAGAUCOH
5 ' ss
Figure 1. Sequence of the ABPA3'RNA. The sequence has been numbered counting the cap as nucleotide 0. A segment refers to the RNAse TI fragment protected already identified (ref.28 and Figure 5). Box refers to the sequence complementary to the 5' end of Ul snRNA.
from 32P-labeled HeLa cells nuclear extracts by the patient Go serum (lane 1), the patient Ya serum (lane 2) and pick Ul -U2 (lane 3). As expected, the patient Ya serum predominantly precipitates U2 snRNA and some U1, while 'pick U1 -U2' precipitates considerable amounts of both. Surprisingly, the first listed anti-(Ul) RNP serum Go also precipitates some U2 snRNA suggesting that nuclear extracts competent for splicing contain some complexes where Ul and U2 snRNPs are already interacting. Other immunoprecipitations were carried out using a fraction from glycerol gradients depleted of all but Ul snRNP (Materials and Methods) as source of antigen. This isolated Ul snRNP was precipitated by the Go (lane 4) but not at all by the Ya serum (lane 5) although being native since containing all of the antigenic 70 Kd, A and C proteins (not shown). It has been demonstrated previously that the Ul RNP-specific A and the U2 RNP-specific B" proteins share at least one common epitope (35) therefore possibly explaining why the serum Ya precipitates a small amount of Ul snRNA in addition to U2 snRNA. However, the Ya serum identifies the U2 RNP-specific A' and much more weakly the U2 RNP-specific B' proteins (ref. 34 and Figure 2B, lane 3). It does not recognizes the Ul snRNPspecific A protein from crude nuclear extracts (Figure 2B, lane 3) in contrast to what was observed by Mimori et al. (34) from a Ul snRNP enriched sample. However, our finding that 'purified' Ul snRNP is not at all precipitated by serum Ya rather agrees with our observation and provides evidence that the presence of the Ul snRNP-specific A protein cannot explain why serum Ya precipitates Ul snRNP from crude extracts. Our immunoblots could lead to the conclusion that the sera 'pick U1-U2' and Go share common specificities since both recognize the U1 snRNP-specific 70 Kd and A proteins and what is most likely the U2 snRNP-specific B" at least in the case of pick 'U1-U2' (Figure 2B, lanes 4, 5 respectively). However, serum Go is unable to precipitate U2 snRNP either -from a glycerol gradient fraction mainly containing U2 snRNP or from a mixture made of 'purified' Ul and U2 snRNPs (see below in Figure 5) in contrast to pick U1-U2 (not shown). One can note also that pick Ul -U2 decorates another band below the U1 snRNP-spcific 70 Kd protein (lane 5). In brief, our results argue that the already described coprecipitation of U1 and U2 snRNAs by serum Ya (34) cannot be solely explained by the presence of a low level of anti-(Ul) RNP antibodies or by common epitope sharing of A and B" proteins (35). It seems also likely that some snRNP complexes containing both Ul and U2 snRNAs could exist in nuclear extracts or be created upon incubation. This is supported by two independent results. The first one is that serum Go, described as being of U1 snRNP specificity, also precipitates a small amount of U2 from these nuclear extracts (fig. 2A, lane 1). The second one is that the U2-specific monoclonal antibody 4G3 was, in our
-.
- -
A
t
C
ZZ
