Vol. 178, No. 3, 1991 August 15, 1991

BIOCHEMICAL

AND BIOPHYSICAL RESEARCH COMMUNICATIONS Pages 1298-1305

TYPE II PHOSPHOLIPASE A2 RECOMBINANT ENHANCES STIMULATED ARACHIDONIC

OVEREXPRESSION ACID RELEASE

Patrick PERNAS, Joelle MASLIAH, Jean-Luc OLIVIER, Colette SALVAT, Tania RYBKINE and Gilbert BEREZIAT URA CNRS 1283, Laboratoire de Biochimie CHU Saint Antoine, Universitt Pierre et Marie Curie - 27, rue Chaligny 75571 Paris Cedex 12, France Received

June

11,

1991

The coding sequence of type II phospholipase A2 from human placenta was cloned in a bovine papilloma virus-derived eukaryotic expression vector under the control of the metallothionein promoter. Stably transfected Cl27 mouse fibroblast lines were obtained with this vector. These transfected cells overexpressed a functional 14 kDa phospholipase AZ, which was bulky secreted. However, a significant phospholipase A2 activity was measured in cell homogenates. The involvement of this 14 kDa phospholipase A2 in mechanisms related to stimulated arachidonic acid release was investigated. We could paraIIe1 the overexpression of phospholipase A2 with an increase in phorbol ester and fluoroaluminate-stimulated arachidonic acid release. Pertussis toxin inhibited this stimulation. These results suggest that the 14 kDa type JJ phospholipase A2 might contribute to stimulation of arachidonic acid release, and therefore to eicosanoid production. a 1991Academic Press.Inc.

Phospholipases A2 (EC 3.1.1.4) catalyse the hydrolysis of the sn-2 fatty acyl ester bond of phospholipids (1). PLAz are assumed to control the rate-limiting step of eicosanoid production (2). They are involved in phospholipid turn-over and in a variety of intra- and intercellular signaling processes. They are implicated in various pathophysiological events (3,4) among which inflammatory processes and related diseases were broadly investigated Wi7).

The activation of cellular PLAz might occur through G-protein-mediated processes (8). Protein kinases A, C (9,10) and tyrosine protein kinases were demonstrated to regulate cellular PLA, activity. One of these cellular PLA2 was recently purified and cloned (11). During inflammation processes, several cells, mainly hepatocytes (12), mesangial cells (13) and chondrocytes (14) express high amounts of a 14 kDa PLA2 in response to various

AlFd-: fluoroaluminate; BSA: bovine serum albumine; DMEM: Dulbecco modified Eagle’s medium; FCS: foetal calf serum; PCR: polymerase chain reaction; PLA,: phospholipase A2; PMSF: phenylmethylsulfonyl fluoride; TPA: 12 cr-tetradecanoyl phorbol acetate. ABBREVIATIONS:

0006-291X/91 $1.50 Copyright 0 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.

1298

Vol.

178,

No.

3, 1991

BIOCHEMICAL

AND

BIOPHYSICAL

RESEARCH

COMMUNICATIONS

cytokines. This PLA2 was cloned (15,16) and classified as a type II PLA2. It was implicated in the destruction of altered cell membranes (17). Whether this PLA2 is involved in eicosanoid production in target tissues or PLAZ-producing cells remains controversial. We report here the cloning of a 14 kDa type II PLA2 obtained from human placenta.The isolated cDNA had exactly the same sequences as the already described inflammatory PLA2 (15,16). We expressed it in Cl27 fibroblast line which displayed a weak basal PLA2. Weobtained a stable transfected strain overexpressing PLA2 activity. Transfected cells exhibited a higher arachidonic acid release in response to TPA and AlF4-.

EXPERIMENTAL

PROCEDURES

PREPARATION OF PLAz - cDNA Placenta, collected under sterile conditions, was quickly frozen in liquid nitrogen, Total RNA were prepared by Clemens’ method (18). One gram piece of placenta was crushed in a mortar, without thawing, and diluted in a lysis solution (4 M guanidinium thiocyanate, 25 mM, pH 7 sodium citrate, 0.5% sarkosyl, 0.1 M fi-mercaptoethanol). Total RNA were then purified by cesium chloride gradient density centrifugation. Complementary DNA were generated from total RNA using reverse transcriptase from murine Moloney leukemia virus (from BRL, UK) and random hexanucleotide primers (from Pharmacia, Sweden). Primers were synthesized by the solid-phase phosphite triester method with an Applied Biosystems 380-A automated oligonucleotide synthesizer (USA), and purified on 20% polyacrylamide/7 M urea gels. cDNA were subjected to PCR amplification in 100 ,uL, with Tuq DNA polymerase (from Cetus, USA), on a Perkin-Elmer thermal cycler. Every PCR round included denaturation at 95°C for 1 min, primers annealing at 45°C for 2 min and extension at 72°C for 3 min (with implementation of 10 set per round). 35 PCR rounds were performed. Every other PCR amplification in this work were performed according to this protocol, but at 55°C primers annealing. Upstream primer: ATTAGAATTCCTCGAGGTCGACGCCAGTCCATCT contained EcoRI, .X/r01 and SalI restriction sites at the 5’ end of sequence from 98 to 109 of the target mRNA. Downstream primer: TATAAAGCTTCTCGAGAGGGAAGAGGGGACTCAG contained Hind111 and XhoI restriction sites at the 3’ end of the sequence from 584 to 567. The PCR product was purified and inserted into the pUC 19 polylinker using EcoRI and Hind111 restriction sites and was sequenced according to Sanger (19), with bacteriophage T7 DNA polymerase (Sequenase from USB, USA). TRANSFECTION OF Cl27 MOUSE FIBROBLASTS, SELECTION OF A PERMANENT RECOMBINANT Cl27-PLA2 CELL LINE The cDNA was then inserted into the unique XhoI site of the bovine papilloma virus-derived vector pBMT3X (20). pBMT3X carries the pBR 322 origin of replication, the mouse metallothionein I gene and the human metallothionein gene. Inserts are cloned in a unique genetically engineered XhoI restriction site, so they are placed under the control of the promoter of the mouse metallothionein I gene. When grown in the presence of cadmium, transfected cells can survive and overtranscribe inserted genes (see figure 1). Transfection was performed according to Graham’s phosphate-DNA coprecipitation method (21). Cl27 mouse fibroblasts were grown in DMEM containing 10% FCS. The day before transfection, 106 cells were plated in a 100 mm Petri dish. 35 pg gradient density-purified 1299

Vol.

178,

No.

3, 1991

BIOCHEMICAL

AND

BIOPHYSICAL

RESEARCH

COMMUNICATIONS

vector DNA and calcium chloride (0.25 M) were mixed and added dropwise to an equal volume of 12 mM dextrose, 42 mM Hepes, 10 mM KCl, 0.25 M NaCl, 1.5 mM pH 7.1 Na2HP04; the obtained coprecipitate was then added to the cells for 4 hours at 37°C. The cells were then washed once with a F&free medium and permeabilized for 1 min with 5 mL per 100 mm dish of 15% glycerol. Cells were then washed with FCS-free medium and cultured for 48 hours in DMEM with 10% FCS to reach to subconfluence. Then, cells were diluted and incubated in the selective medium, DMEM supplemented with 10% FCS and 10 mM CdC12. After 10 days to three weeks, clones appeared, which were isolated using cloning cylinders. Recombinant clones were assayed by northern blotting and PLA, activity assay. Protein from clone 22 cells were metabolically labelled by [s?S] methionine. 100 mm Petri dish containing confluent cells were incubated with FCS-free medium for 2 hours, and then with 0.5 mCi [ssS] methionine for 4 hours. Secreted protein were immunoprecipitated by a rabbit polyclonal anti-lvaja nuju PLA, antibody (22) according to Scheidtmann (23) and submitted to a 15% sodium-dodecyl sulfate polyacrylamide gel electrophoresis. CELL LABELING AND ACTIVATION 103 cells per 30 mm Petri dish were plated and grown to subconfluence in DMEM with FCS and then shifted to FCS-free DMEM for 48 h. In this way, cells were confluent and stopped multiplying at the beginning of the experiment. Cells were then incubated for 1 hour (37”C, 5% CO;, with 0.5 mCi/mL [14C]-arachidonic acid (specific activity = 220 Cilmmol) diluted in DMEM with 0.2% fatty acid free BSA. After arachidonic acid incorporation, cells were washed twice with saline with 0.2% fatty acid free BSA and twice with saline, to remove non incorporated arachidonic acid. Cells were then incubated with various agents diluted in DMEM with 0.2% fatty acid free BSA, at 37°C with 5% C02. After activation, dishes were cooled on ice. Cells were washed three times with phosphate buffered saline and scraped off in 1 mL of a cold buffer containing 40 mM Tris, 0.25 M sucrose, 0.1 mM PMSF. Cell homogenates were obtained by a 1 min sonication with a MSE sonifier (France). Crude membranes were separated from cytosol by a 100,000 g centrifugation at 4°C for 30 min. Media, cell homogenates, cytosols and crude membranes were assayed for protein concentration, radioactivity with an Intertechnique (France) liquid scintillation counter, and PLAz activity. PHOSPHOLIPASE A2 ASSAY Fluorescent substrate (1-palmitoyl 2-(lo-pyrenyldecanoyl)-sn glycero 3-monomethyl phosphatidic acid) was furnished by Interchim (USA), and delipidated BSA by Sigma (USA). The hydrolytic activity of PLA, was determined with a Jobin-Yvon (France) JY3 spectrofluorimeter according to Radvanyi et al (24). Typically, 10 to 50 PL of sample were incubated with 2 nmol of fluorescent substrate, in the presence of 0.1% final delipidated BSA, in 1 mL 10 mM Tris/HCl pH 9 buffer containing 10 mM CaCl,. The reaction kinetics was monitored, at room temperature, by measuring the increase of the emitted light at 397 nm, with an exciting light at 345 nm. MISCELLANEOUS All enzymes were obtained from Appligene (France) and used according to the supplier’s specifications. PCR product was used as a probe. It was labeled using the multiprime-labeling method (25). [&2P]dCTP (3000 Ci/mmol) and multiprime labeling kit were obtained from Amersham (UK) and used following the manufacturer’s protocols. Probes were purified by means of a G-50 (Pharmacia) exclusion chromatography. 1300

Vol.

178,

No.

3, 1991

BIOCHEMICAL

AND

BIOPHYSICAL

RESEARCH

COMMUNICATIONS

Chemicals were furnished by Fluka (FRG), BRL, or Sigma; nitrocellulose filters were purchased from Schleicher and Schuell, (FRG); cell culture products were acquired from Gibco-BRL. RNA from cells were prepared according to Chomczinski’s method (25). They were then subjected to electrophoresis on 1% agarose-formaldehyde gels (26) and transfered onto nitrocellulose filter. Protein concentrations were measured according to Bradford’s method (27) with Biorad reagent.

RESULTS AND DISCUSSION Since Kramer et al. demonstrated a high placental content of type II-PLA,! mRNA by northern analysis (16) we used RNA from human placenta to clone PLA, cDNA. The presence of a high PLA2 content in placenta is relevant with the role played by prostaglandins in the onset of labour (3). It may also account for the ability of the placenta to concentrate arachidonic acid in order to deliver it to the fetus (28). We therefore submitted extracted RNA to reverse transcription and enzymatic amplification by PCR using primers designed according to the recently published sequences (15,16). They surrounded the coding region including the signal peptide and they included restriction sites needed for the insertion of the PCR product into pUC 19 and then into pBMT3X (fig 1). After the PCR step, we obtained a DNA product of the expected size, i.e. 525 bp (fig 1). Sequencing of the pUC 19 inserted cDNA demonstrated its complete homology with the coding sequence of the type II-PLA, gene (15,16). To raise permanent cell lines, we inserted the PLAz-cDNA under the control of the murine metallothioneine promoter in the pBMT3X vector (fig 1). 48 hours after confluency, evidence of transcription of type II PLA2 was provided in some recombinant clones by the hybridisation of [32P] labelled cDNA with the mRNA extracted from these cell lines, by northern analysis (fig 2B). Cells and culture media of PLA2 cDNA - pBMT3X transfected clones exhibited a high PLA2 activity as compared with the control clones or with clones transfected with apo AII-cDNA-pBMT3X which were used as transfected control cells (fig 2A). The secreted enzyme had the same properties as type II-PLA2: it required 10 mM Ca2+ for maximal activity and was optimally active at pH 8-10. It should be emphasized that the cadmium concentration we used to screen positive clones did not inhibit PLA2 activity (unshown results). Furthermore, [35S] methionine-labelled secreted proteins were immunoprecipitated by antibodies raised against Naja nuju PLA, (22). Electrophoresis of the immunoprecipitated proteins showed a band of approximately 14 kDa that we assumed to be the recombinant PLA2 produced by the transfected cells (fig 2C). In addition to secreted PLA2 detected in the culture medium, a significant PLA2 activity was found associated with cytosol and membrane in transfected cells, but was very low in control cells (fig 3A). To determine whether the cellular PLA;! observed in transfected cells might have a functional significance, we studied the arachidonic acid release by prelabelled cells. PLA2-transfected cells exhibited the same incorporation rate of [l-14C] arachidonic acid 1301

Vol.

178,

No.

BIOCHEMICAL

3, 1991

AND

BIOPHYSICAL

RESEARCH

COMMUNICATIONS

bp

615 492

q

123

-

525

/puc-pLA2 \ b

PLA 2 coding

m

region

mMT-I = promoter

)

pBMT3X-PLA2

u Cloningstrategyof the humanplacentaltype II-PLA, into the vector pBMT3X. The 525bp codingcDNA obtainedby PCR wasinsertedinto the XhoI site to be underthe control of the promoterof murinemetallothioneine in pBMT3X. Transfectedcellsare protectedfrom cadmiumby thehumanmetallothioneine genestimulatedby its promoter.

as control cells and apo AII-transfected cells (result not shown). There was no difference in the basal arachidonic acid release (6.0 + 1.5 % of the total radioactivity incorporated per hour). When TPA was added to the incubation medium, the stimulation of arachidonic acid release was significantly higher in PLA2 transfectedcells than in control cells or in apo AR-transfected

cells (fig 3B). That treatment had no effect on morphology and trypan blue exclusion. Treatment of the cells by 10 mM AlFa, an activator of G proteins (29), resulted in a higher arachidonic acid release in PLAZ-transfected cells which was inhibited by a 3 hours Pertussis toxin pretreatment of the cells (fig 3C), suggesting an involvement of a Gi/Go protein in this stimulation (30). Our results indicate that a part of the cDNA product is not exported outside of the cells but is sorted to the intracellular compartment by an as yet unknown mechanism. This result is puzzling since the sequenceof the transfected cDNA contains a signal peptide which should

ensure the total secretion of the protein. Such a discrepancy has already been pointed out by Ishizaki for the membrane-bound type II rat spleen PLA2 (31) and by Kurihara in vascular smooth muscle cells (32). Two hypothesis might be proposed to explain these results. Firstly, observing the expected sequenceof the signal peptide: Met Lys Thr Leu Leu Leu Leu Ala Val Ile Met Ile Phe Gly Leu Leu Gln Ala His Gly we can postulate the existence of an alternative

translation start codon at Met 11 placed immediately 1302

downstream from the hydrophobic

Vol. 178, No. 3, 1991

BIOCHEMICAL

AND BIOPHYSICAL RESEARCH COMMUNICATIONS

A Activity (1 mU = 1 nmollmin) Clone 18, culture medium Clone 19, culture medium Clone 22, culture medium Clone 23, culture medium non tmnsfected Cl27 culture medium Cl27 - ape Alt, culture medium

75 mu/ml 80 mu/ml 120 mu/ml 90 mu/ml undetectable undetectable

Clone 22, cell homogenates (5.106 cells) non transfected C127, cell homogenates (5.106 cells) Cl27 ape AIM, cell homogenates (5.106 cells)

20 mU undetectable undetectable

B

18s 21.5

obcdef

Fig. 2. Characterizationof PLA2 stablerecombinantCl27 clones.A: PLA, activities. B: Northern blot analysisof mRNA. (a: PLA, transfectedC127, clone 22; b: untransfected C127; c,d,e: PLAz transfeetedC127, clones18, 19, and23; f: apoAI1 transfectedC127.) C: SDS-PAGEanalysisof immunopreeipitated [35S] methioninelabelledprotein from clone22. (a,b: from culture media;c,d: from cell homogenates; e: molecularweightmarkers)

region. Such an alternative start codon also exists in the signal peptide of secretedrat spleen

PLA2 (Met 12) described by Ishizaki (31). Secondly, TPA or diacylglycerol generated in cellular activation might induce PLA;! stimulation in the secretory compartment itself through G protein or protein kinase C-mediated processes. An effect on the secretion process is unlikely sinceTPA treatment did not increasePLA2 secretion(result not shown). The participation of type II-PLA;! in arachidonic acid release is consistent with the

observation by Narasimhan et al (33) that Nuju nuj~ or pancreatic PLA;! induced a G proteinmediated arachidonic acid releasein permeabilized RBL-243 cells. The activation may occur through the action of protein kinase C, as already reported in several cell types (9,10,34). Further investigation is necessaryto elucidate the actual mechanismof G protein-mediated PLA2 activation in Cl27 cells. As the releaseof arachidonic acid neededa 1 hour AlFd- or 1303

Vol.

178,

No. 3, 1991

BIOCHEMICAL

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS

Fig. 3. CellularPLAz activity and arachidonicacid releasein PLAz-transfectedCl27 cells. A: PLAz activity; TPA did not changethe PLA, distributionbetweencytosoland membranes. B: TPA stimulatedarachidonicacid release.C: A1F4--stimulated arachidonicacid releaseand inhibitionby Pertussistoxin pretreatment. a: untransfectedCl27 cells; b: PLA,-pBMT3X-transfected cells; c: apo All-pBMT3Xtransfectedcells.

TPA treatment to increase significantly, it may involve mechanismsreleasing Ca2+ from

internal pools or decreasing the requirement of PLA2 for calcium ion as demonstrated in RBL243 cells.

ACKNOWLEDGMENTS: PP was supported by a grant from Groupement d’Etude et de Recherche sur le Placenta. We are grateful to V. Zannis for providing us with the pBMT3X vector, to J. Chambaz for donating apo AIt-transfected Cl27 cells, and to J.M. Cheynier from HBpital des Metallurgistes for providing placenta.

REFERENCES 1. Van Den Bosch, H.; Aarsman, A.J.; Van Schaik, R.H.N.; Schalkwijk, C.G.; Neijs, F.W. and Sturk, A. (1990) B&hem. Sot. Trans. 18, 781-786 2. Irvine, R.F. (1982) Biochem. J. 204, 3-16 3. Wilson T. (1990) Reprod. Fertil. Dev. 2, 511-521 Vadas, P. (1984) J. Lab. Clin. Med. 104, 873-881 Z: Higgs, G.A.; Moncada, S. and Vane, J.R. (1984) Ann. Clin. Res. 16, 287-299 6. Greaves, M.W. and Camp, P.R. (1988) Arch. Dermatol. 280, 533-541 7. Vadas, P. and Pruzanski, W. (1985) Lab. Invest. 55, 391-404 8. Burch, R.M. (1989) Mol. Neurobiol. 3, 155-171 1304

Vol. 178, No. 3, 1991

BIOCHEMICAL

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS

9. Kadiri, C.; Cherqui, G.; Masliah, J.; Rybkine, T.; Etienne, J. and Bereziat, G. (1990) Mol. Pharmacol. 38, 418-425 10. Halenda, S.P.; Zavoico, G.B. and Feinstein, M.B. (1985) J. Biol. Chem. 260, 1248412491 11. Clark, J.D., Lin, L.L., Sultzmann, L.A., Lin, A.Y., Kruz, R.W., Ramesha, C., Milma, N., Martin, D.M., Yuan, Z. & Knopf, J.L., Cell, (1991) in the press 12. Crowl, R.M.; Stoller, T.J.; Conroy, R.R. and Stoner, C.R. (1991) J. Biol. Chem. 266, 2647-265 1 13. Schalkwijk, C.; Pfeilschifter, J.; Marki, F. and Van den Bosch, H. (1991) Biochem. Biophys. Res. Commun. 174, 268-275 14. Kerr, J.S.; Stevens, T.W.; Davis, G.L.; McLaughlin, J.A. and Harris, R.R. (1989) Biochem. Biophys. Res. Commun. 165, 1079-1084 15. Seilhamer, J.J.; Pruzanski, W.; Vadas, P.; Plant, S.; Meller, J.A.; Klost, J. and Johnson, L.K. (1989) J. Biol. Chem. 264, 5335-5338 16. Kramer, R.M.; Hession, C.; Johansen, B.; Hayes, G.; MC Cray, P.; Chow, E.P.; Tizard, R. and Pepinski, R.B. (1989) J. Biol. Chem. 264, 5768-5775 17. Wright, G.; Weiss, J.; Kim, K.S.; Verheij, H. and Elsbach, P. (1990) J. Clin. Invest. 85, 1925- 1935 18. Clemens, M.J. (1984) in Transcription and translation. A practical approach (Hames, B.D. and Higgins, S.J. Eds.), pp 211-229. IRL Press, Oxford, Washington, DC. 19. Sanger, F.; Miklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 54635467 20. Krystal, M.; Li, R.; Lyles, D.; Pavlakis, G. and Palese, P. (1986) Proc. Natl. Acad. Sci. USA 83, 2709-2713 21. Graham, F.M. and Van der Eb, P. (1973) Virology, 52, 456-467 22. Masliah, J.; Kadiri, C.; Pepin, D.; Rybkine, T.; Etienne, J.; Chambaz, J. and Bereziat, G. (1987) FEBS L&t. 222, 11-16 23. Scheidtmann, K.H. (1989) in Protein Structure. A practical approach (Creighton, T.E. Ed.) pp 93-114. IRL press, Oxford Washington, DC. 24. Radvanyi, F.; Jordan, L.; Russo-Marie, F. and Bon, C. (1989) Anal. Biochem. 177, 103109 25. Sambrook, J.; Fritsch, E.F. and Maniatis, T., (1989) in Molecular Cloning, a laboratory manual. Cold Spring Harbor Laboratory Press, NY. 26. Chomczynski, P. and Sacchi, N. (1987) Anal. Biochem. 162, 156-159 27. Bradford, M.M. (1976) Anal. Biochem. 72, 248-251 28. Ravel, D.; Chambaz, J.; Pepin, D.; Manier, M.C. and BCrCziat, G. (1985) Biochim. Biophys. Acta 833, 161-164 29. Stemweis, P.C. and Gilman, A.G. (1982) Proc. Natl. Acad. Sci. USA 79, 4888-4891 30. Okajima, F. and Ui, M. (1984) J. Biol. Chem. 259, 13863-13871 31. Ishizaki, J.; Ohara, 0.; Nakamura, E. ; Tamaki, M. ; Ono, T.; Kauda, A.; Yoshida, N.; Teraoka, M; Tojo, H. and Okamoto, M. (1989) Biochem. Biophys. Res. Commun. 162, 1030-1036 32. Kurihara, H.; Nakano, T.; Takasu, N. and Arita, H. (1991) Biochim. Biophys. Acta 1082, 285-292 33. Narasimhan, V.; Holowska, D. and Baird, B. (1990) J. Biol. Chem. 264, 1459-1464 34. Volpi, M.; Molski, T.P.F.; Naccache, P.H.; Feinstein, M.B. and Shaafi, R.I.L. (1985) Biochem. Biophys. Res. Commun. 128, 560-594

1305