352 Human Molecular Genetics, Vol. 1, No. 5
SAM 1.1 and JOSH 4.4: two RFLPs within the human DCC gene J.W.Simons, J.D.OIiner, K.R.Cho, K.W.Kinzler and B.Vogelstein* The Johns Hopkins Oncology Center, 424 N.Bond Street, Baltimore, MD21231, USA
SAM 1.1:
Polymorphism: EcoRl identifies a two allele polymorphism (Al: 9.2 kb, A2: 1.1 kb). Frequencies: Allele Al: 0.40 Allele A2: 0.60 N = 40 unrelated Americans, heterozygosity = 0.48.
S.Cottrell* and W.F.Bodmer Cancer Genetics Laboratory, Imperial Cancer Research Fund, Lincoln's Inn Fields, London WC2A 3PX, UK
Source/Description: The probe FB54D is a 2.3 kb cDNA fragment made with £coRI linkers and inserted into the EcoRl site of Bluescript SK. This fragment contains part of exon 15 of the APC gene (1). Polymorphism: Mspl identifies two independent two allele polymorphisms. Al: 5.4 kb Bl: 3.1 kb A2: 4.7 kb B2: 2.2 kb Frequency: Studied in 30 unrelated Caucasians. Al: 0.05 Bl: 0.65 A2: 0.95 B2: 0.35 Heterozygosity = 0.42.
JOSH 4.4:
Not Polymorphic For: BamHl, HindUl, BglR, Pvull, Taql, Pstl, all tested on a panel of 6 unrelated individuals.
Source and Description of Clone: JOSH 4.4 is a 4.4 kb Pstl genomic DNA fragment that contains exon 17 of the human DCC gene subcloned into the Pstl site of Bluescript SK.
Chromosomal Localisation: The human APC gene maps to 5q21-22.
Polymorphism: Pstl identifies a two allele polymorphism (Al: 15 kb, A2: 10 kb and 5 kb). Frequencies: Allele Al: 0.44 Allele A2: 0.56 N = 36 unrelated Americans, heterozygosity = 0.49. Chromosomal Localization: DCC has been localized to 18q21.3 by a variety of mapping methods. Mendelian Inheritance: Mendelian inheritance for JOSH 4.4 has been observed in 7 two-generation families. Probe Availability: Freely available upon request to Dr Bert Vogelstein, The Johns Hopkins Oncology Center, 424 N. Bond Street, Baltimore, MD 21231, USA Other Comments: Preassociation with human placental DNA (2) is required prior to hybridization and washing using standard conditions.
Mendelian Inheritance: Co-dominant segregation was observed in 3 families for Al, A2 and 16 families for Bl, B2. Probe Availability: Contact K.W.Kinzler (Johns Hopkins Oncology Center, 424 North Bond Street, Baltimore, MD 21231, USA) or Y.Nakamura (Cancer Institute, Tokyo 170, Japan). Primers: The Bl and B2 alleles can also be detected by PCR using primer sequences from exon 15. 5' ATGATGTTGACCTTTCCAGGG 3' 5' CITTTTTGGCATTGCGGAGCT 3' PCR Conditions: 200 ng of genomic DNA was amplified in a 25 iA reaction mix containing dNTPs (0.2 mM), oligos (1 /tM), Taq buffer (Promega) and 1 unit Taq polymerase (Promega). After heating for 5 min at 92°C, 35 cycles of 1 min 92°C, 1 min 60°C and 1 min 72 °C were carried out. The PCR products were digested with Mspl and analysed on a 2% agarose gel. Comments: Mspl digestions were carried out at room temperature. This is the fourth RFLP to be reported in the APC gene (2, 3).
Acknowledgements: Supported by NIH grant CA01495 and CA35494.
Acknowledgements: We thank B.Vogelstein, K.W.Kinzler and Y.Nakamura for sending us the probe.
References: 1) Fearon et al. (1989) Science 2A7, 49-56. 2) Sealey et al. (1985) Nucleic Acids Res. 13, 1905-1922.
References: 1) Kinzler.K.W. et al (1991) Science 253, 661 -665. 2) Heighway,J. et al. (1991) Nucleic Acids Res. 19, 6966. 3) Kraus,C. and Ballhausen.W.G. (1992) Hum. Genet. 88, 705-706.
* To whom correspondence should be addressed
•To whom correspondence should be addressed
Downloaded from http://hmg.oxfordjournals.org/ at University of Birmingham on March 20, 2015
Source and Description of Clone: SAM 1.1 is a 1.1 kb EcoRl genomic DNA fragment that contains exon 15 of the human DCC gene subcloned into the £coRI site of Bluescript SK.
Two Mspl polymorphisms within the APC gene
SAM 1.1 and JOSH 4.4: two RFLPs within the human DCC gene J.W.Simons, J.D.OIiner, K.R.Cho, K.W.Kinzler and B.Vogelstein* The Johns Hopkins Oncology Center, 424 N.Bond Street, Baltimore, MD21231, USA
SAM 1.1:
Polymorphism: EcoRl identifies a two allele polymorphism (Al: 9.2 kb, A2: 1.1 kb). Frequencies: Allele Al: 0.40 Allele A2: 0.60 N = 40 unrelated Americans, heterozygosity = 0.48.
S.Cottrell* and W.F.Bodmer Cancer Genetics Laboratory, Imperial Cancer Research Fund, Lincoln's Inn Fields, London WC2A 3PX, UK
Source/Description: The probe FB54D is a 2.3 kb cDNA fragment made with £coRI linkers and inserted into the EcoRl site of Bluescript SK. This fragment contains part of exon 15 of the APC gene (1). Polymorphism: Mspl identifies two independent two allele polymorphisms. Al: 5.4 kb Bl: 3.1 kb A2: 4.7 kb B2: 2.2 kb Frequency: Studied in 30 unrelated Caucasians. Al: 0.05 Bl: 0.65 A2: 0.95 B2: 0.35 Heterozygosity = 0.42.
JOSH 4.4:
Not Polymorphic For: BamHl, HindUl, BglR, Pvull, Taql, Pstl, all tested on a panel of 6 unrelated individuals.
Source and Description of Clone: JOSH 4.4 is a 4.4 kb Pstl genomic DNA fragment that contains exon 17 of the human DCC gene subcloned into the Pstl site of Bluescript SK.
Chromosomal Localisation: The human APC gene maps to 5q21-22.
Polymorphism: Pstl identifies a two allele polymorphism (Al: 15 kb, A2: 10 kb and 5 kb). Frequencies: Allele Al: 0.44 Allele A2: 0.56 N = 36 unrelated Americans, heterozygosity = 0.49. Chromosomal Localization: DCC has been localized to 18q21.3 by a variety of mapping methods. Mendelian Inheritance: Mendelian inheritance for JOSH 4.4 has been observed in 7 two-generation families. Probe Availability: Freely available upon request to Dr Bert Vogelstein, The Johns Hopkins Oncology Center, 424 N. Bond Street, Baltimore, MD 21231, USA Other Comments: Preassociation with human placental DNA (2) is required prior to hybridization and washing using standard conditions.
Mendelian Inheritance: Co-dominant segregation was observed in 3 families for Al, A2 and 16 families for Bl, B2. Probe Availability: Contact K.W.Kinzler (Johns Hopkins Oncology Center, 424 North Bond Street, Baltimore, MD 21231, USA) or Y.Nakamura (Cancer Institute, Tokyo 170, Japan). Primers: The Bl and B2 alleles can also be detected by PCR using primer sequences from exon 15. 5' ATGATGTTGACCTTTCCAGGG 3' 5' CITTTTTGGCATTGCGGAGCT 3' PCR Conditions: 200 ng of genomic DNA was amplified in a 25 iA reaction mix containing dNTPs (0.2 mM), oligos (1 /tM), Taq buffer (Promega) and 1 unit Taq polymerase (Promega). After heating for 5 min at 92°C, 35 cycles of 1 min 92°C, 1 min 60°C and 1 min 72 °C were carried out. The PCR products were digested with Mspl and analysed on a 2% agarose gel. Comments: Mspl digestions were carried out at room temperature. This is the fourth RFLP to be reported in the APC gene (2, 3).
Acknowledgements: Supported by NIH grant CA01495 and CA35494.
Acknowledgements: We thank B.Vogelstein, K.W.Kinzler and Y.Nakamura for sending us the probe.
References: 1) Fearon et al. (1989) Science 2A7, 49-56. 2) Sealey et al. (1985) Nucleic Acids Res. 13, 1905-1922.
References: 1) Kinzler.K.W. et al (1991) Science 253, 661 -665. 2) Heighway,J. et al. (1991) Nucleic Acids Res. 19, 6966. 3) Kraus,C. and Ballhausen.W.G. (1992) Hum. Genet. 88, 705-706.
* To whom correspondence should be addressed
•To whom correspondence should be addressed
Downloaded from http://hmg.oxfordjournals.org/ at University of Birmingham on March 20, 2015
Source and Description of Clone: SAM 1.1 is a 1.1 kb EcoRl genomic DNA fragment that contains exon 15 of the human DCC gene subcloned into the £coRI site of Bluescript SK.
Two Mspl polymorphisms within the APC gene
