Vol. 10, No. 4

MOLECULAR AND CELLULAR BIOLOGY, Apr. 1990, p. 1652-1663 0270-7306/90/041652-12$02.00/0 Copyright © 1990, American Society for Microbiology

Two Members of the Mouse mdr Gene Family Confer Multidrug Resistance with Overlapping but Distinct Drug Specificities ALAIN DEVAULT AND PHILIPPE GROS* Department of Biochemistry, McGill University, Montreal, Quebec H3G I Y6, Canada Received 8 September 1989/Accepted 14 December 1989

We report the cloning and functional analysis of a complete clone for the third member of the mouse mdr gene family, mdr3. Nucleotide and predicted amino acid sequence analyses showed that the three mouse mdr genes encode highly homologous membrane glycoproteins, which share the same length (1,276 residues), the same predicted functional domains, and overall structural arrangement. Regions of divergence among the three proteins are concentrated in discrete segments of the predicted polypeptides. Sequence comparison indicated that the three mouse mdr genes were created from a common ancestor by two independent gene duplication events, the most recent one producing mdrl and mdr3. When transfected and overexpressed in otherwise drug-sensitive cells, the mdr3 gene, like mdrl and unlike mdr2, conferred multidrug resistance to these cells. In independently derived transfected cell clones expressing similar amounts of either MDR1 or MDR3 protein, the drug resistance profile conferred by mdr3 was distinct from that conferred by mdrl. Cells transfected with and expressing MDR1 showed a marked 7- to 10-fold preferential resistance to colchicine and Adriamycin compared with cells expressing equivalent amounts of MDR3. Conversely, cells transfected with and expressing MDR3 showed a two- to threefold preferential resistance to actinomycin D over their cellular counterpart expressing MDR1. These results suggest that MDR1 and MDR3 are membrane-associated efflux pumps which, in multidrug-resistant cells and perhaps normal tissues, have overlapping but distinct substrate specificities.

with the proposition that MDR/P glycoprotein is an ATPdependent efflux pump which can act on a very broad group of substrates. In the mouse, sequence comparison of full-length cDNA clones for two members of the gene family, mdrl and mdr2, reveals that the two encoded proteins are highly homologous: both are composed of 1,276 residues, sharing 71% identical residues and the same predicted features (22). Despite their high degree of homology and parallel amplification in independently derived multidrug-resistant cell lines (38), the two encoded proteins are functionally very different. When transfected and overexpressed into drug-sensitive Chinese hamster cells, a full-length cDNA clone for mouse mdrl but not mdr2 can convey the complete multidrug resistance phenotype (20, 22). Partial cDNA clones for the third mouse mdr gene, mdr3, have been obtained (9, 25). The mdr3 gene is overexpressed in certain multidrug-resistant cell lines of reticuloendothelial (25) and lymphoblastoid (38) origins, but its capacity to confer multidrug resistance in transfection experiments has awaited the isolation of a full-length cDNA clone. The expression of the three mouse mdr genes is tightly regulated in a tissue-specific manner in the normal mouse, with a nonoverlapping distribution of their respective mRNAs (9). The structural similarities and functional differences between the cloned mdrl and mdr2, together with the specific tissue distribution of mdr mRNAs, suggest that mdr genes code for membrane proteins which may participate in similar transport functions of perhaps different products. Here, we report the cloning of a complete cDNA for mouse mdr3 and show that, like mdrl and unlike mdr2, this gene conveys multidrug resistance when introduced and overexpressed in drug-sensitive cells. The drug resistance profile conferred by mdr3 is distinct from that of mdrl, supporting the proposition that distinct members of the mdr family may transport different sets of substrates in drugresistant cells and in normal tissues.

When continuously exposed to certain cytotoxic compounds, mammalian cells can simultaneously develop resistance to a broad range of lipophilic drugs. This phenomenon, termed multidrug resistance, represents a serious limitation to the chemotherapy of human tumors, in which such compounds form part of the drug treatment (17, 33). The emergence of multidrug resistance in cultured cells is associated with the amplification of a small group of closely related genes, termed mdr or pgp, which encode highmolecular-weight membrane phosphoglycoproteins, termed P glycoproteins (12). The mammalian mdr gene family is composed of two members in humans and three members in rodents (34). Full-length cDNA clones have been obtained for the two human mdr genes (4, 48), while partial cDNA (11) and genomic clones (34) have been described for the hamster pgp family. In the mouse, full-length cDNA clones for mdrl (21) and mdr2 (22) and partial cDNA clones for mdr3 (9, 25) have been reported, and the complete genomic structure of the mdrl gene has been elucidated (37). Full-length cDNA clones for the mouse (20) and human (47) mdrl genes can directly confer multidrug resistance when introduced and overexpressed in otherwise drug-sensitive cells. In multidrug-resistant cells overexpressing mdrl, the corresponding MDR/P glycoprotein has been shown to bind drug (7, 39) and ATP analogs (8, 41) and to cause an increased ATP-dependent drug efflux, resulting in decreased drug accumulation in these cells (10, 14, 24, 29). The mdr genes have been conserved throughout the evolution of eucaryotes: an mdr homolog has been cloned from Plasmodiim falciparum and found amplified in certain chloroquine-resistant isolates of the parasite (15). The yeast Saccharomyces cerevisiae mdr homolog was recently isolated and found implicated in the transmembrane transport of the a mating factor (32). These evolutionary relationships together with the biochemical characterization of multidrug-resistant cells are consistent *

Corresponding author. 1652

VOL. 10. 1990

MULTIDRUG RESISTANCE CONFERRED BY mdr GENES

MATERIALS AND METHODS Isolation and characterization of mdr3 cDNA clones. Partial cDNA clones for mouse mdr3 (XDR13) were initially isolated (9) from a cDNA library constructed from drug-sensitive cell RNA (20), using an oligonucleotide probe (GACTTGATC GTGGTGATTGAG; probe a, Fig. 1: positions 3709 to 3729, Fig. 2), the sequence of which is precisely conserved within the C-terminal domain of md)rl and mndr2. Additional clones overlapping the 5' end of the mdr3 cDNA were isolated from a cDNA library constructed with mRNA isolated from the multidrug-resistant P388-ADM2 cells (gift of D. E. Housman, Massachusetts Institute of Technology, Cambridge) which overexpress the mndr3 gene (38). The cDNA library was constructed by a modification of standard protocols (23). Briefly, 10 p.g of P388-ADM2 poly(A+) RNA was used as template for the first-strand cDNA synthesis, using avian myeloblastosis virus reverse transcriptase and an indr3specific oligonucleotide of sequence GAATGCTCCAAT TAACACG (Fig. 1, probe c; positions 1017 to 999, Fig. 2). The second strand was synthesized with Escherichia coli DNA polymerase I, RNase H, and E. coli DNA ligase. The double-stranded DNA was purified, blunt-ended with T4 DNA polymerase, treated with EcoRI methylase, and adapted with EcoRI linkers. Following EcoRI digestion, the double-stranded cDNA population was cloned in the EcoRI site of bacteriophage lambda gtll and the library was plated on indicator E. coli Y1088 cells. All enzymes used for cDNA cloning were obtained from Pharmacia/LKB, Montreal, Quebec, Canada. An m77dr3 cDNA clone overlapping the 5' end of the mRNA was also isolated from normal mouse intestinal mRNA by polymerase chain reaction amplification (36): 20 ,ug of intestinal RNA and the indr3-specific oligonucleotide CACAAGGGTTAGCTTCCAGCCACGGG (Fig. 2, positions 639 to 614) was used for first-strand cDNA synthesis. The mdr3 single-stranded cDNA molecules were then amplified by using the same oligonucleotide and another mndr3-specific amplimer of sequence AACAGCGGTTTCCA GGAGCTGCTGG (Fig. 2, positions -125 to -105) and Thermius aquaticius (Taq) DNA polymerase (New England BioLabs, Inc., Beverly, Mass.). The conditions for polymerase chain reaction were 1 min at 95°C, 2 min at 52°C, and 7 min at 70°C for 30 cycles. The nucleotide sequence of the full-length mnd)3 cDNA clone, pDR16, was determined on both strands or on the same strand in two independent subclones by the chemical base modification method (31) or the chain termination method (40). All sequence treatments and analyses were carried out with the DNAsis program of LKB. Cell culture and DNA transfection. Chinese hamster ovary LR73 cells (35) were used in all transfection assays and were grown in alpha-minimal essential medium supplemented with 10% fetal calf serum, 5 mM glutamine, penicillin (50 U/ml), and streptomycin (50 Kg/ml). The LR73-1A cell line is a multidrug-resistant rndrl-transfected clone of LR73 cells (41) which expresses high levels of MDR1 protein and which was used as a control in some experiments. This clone was cultured in medium containing Adriamycin (Adria Laboratories, Columbus, Ohio) at 0.1 Kg/ml. For transfection experiments, portions of the 5'- and 3'-untranslated regions of the mdr3 cDNA insert of clone pDR16 were removed by partial digestion with AccI (position -59) and complete digestion with DraI (position 4254). The cohesive end of the AccI-DraI insert was repaired with T4 DNA polymerase and cloned in the sense and antisense orientations into the mammalian expression vector pMT2 (gift of R. Kaufman.

1653

Genetics Institute, Cambridge, Mass.), a derivative of plasmid p91023 (50). The full-length mndrl cDNA insert of phage clone XDR11 (20) was also cloned in pMT2. The mdrl and mdr3 pMT2 constructs were introduced into LR73 cells by cotransfection with indicator plasmid pSV2neo (molar ratio, 10:1, test/indicator plasmid), using the calcium phosphate coprecipitation method (49). Mass populations of cell clones containing the indicator plasmid were selected in culture medium containing Genetycin (G418; GIBCO/BRL Life Technologies Inc., Burlington, Ontario, Canada) at 500 p.g/ml. In some experiments, multidrug-resistant clones were selected from G418r mass populations cotransfected with pSV2neo and indri or indr3 by subculture in medium containing vinblastine (Sigma Chemical Co., St. Louis, Mo.) at either 50 or 100 ng/ml. The drug survival characteristics of G418r mass populations cotransfected with pSV2nteo and mdrl or mnd)3 as well as control cells were determined by plating 105 cells in 60-mm dishes containing culture medium supplemented with increasing concentrations of colchicine (Sigma), Adriamycin (Adria Laboratories) vinblastine (Sigma), actinomycin D (Merck Sharp and Dohme, Montreal, Quebec, Canada). mitoxantrone (Lederle, Toronto, Ontario, Canada), and bleomycin (blenoxane sulfate; gift of C. Shustik, Royal Victoria Hospital, Montreal, Quebec, Canada). Cells were grown for 9 days. and the plates were fixed in 0.4% formaldehyde, stained with methylene blue, and photographed. For individual clones expressing midri or mdr3, 500 cells were plated in 60-mm dishes in medium containing increasing concentrations of the same drugs. After 7 days, the plates were fixed and stained, and the number of colonies containing 50 cells or more was scored. The relative plating efficiency of each clone was calculated by dividing the mean number of colonies observed at a given drug concentration by the mean number of colonies formed by the same clone in control medium lacking drug. This ratio was expressed as a percentage and plotted versus the drug concentration. Detection of MDRI and MDR3 proteins. Cells (108) grown to confluency were harvested by trypsin treatment and rinsed twice in TNE (Tris, 10 mM, pH 7.0; NaCl, 150 mM; EDTA, 1 mM) and once in TMg (Tris. 10 mM, pH 7.0; MgCl,. 1 mM) on ice. The cells were lysed with a Dounce homogenizer. the nuclei and unlysed cells were removed by centrifugation (400 x g, 10 min at 4°C), and the crude membrane fraction was concentrated by centrifugation of the supernatant (100,000 x g, 30 min at 4°C). In some experiments, this membrane fraction was suspended in TNE containing 45% sucrose, loaded onto a discontinuous sucrose gradient (60. 45, 35, and 30%) and centrifuged at 100,000 x g (3 h at 20°C). Membrane fractions floating at the 30 and 35% sucrose interfaces were pooled, washed once in TNE. and stored frozen in the same buffer containing 30% glycerol. For membrane protein isolation, all solutions were supplemented with the proteinase inhibitors trasylol (2 pLg/ ml), leupeptin (5 p.g/ml), and pepstatin (0.04 p,g/ml; Sigma). The mdrl and imdr3 gene products were identified in the membrane fractions by immunoblotting (45), using specific antibodies. Briefly, 30 to 50 pg of membrane proteins was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on a 7.5% acrylamide gel by the method of Laemmli (27). Proteins were transferred to a nitrocellulose membrane by electroblotting, and the membrane was incubated with either the mouse anti-P glycoprotein C219 monoclonal antibody (Centocor Corp., Philadelphia, Pa.) used at a 1/500 dilution or the rabbit anti-MDR3 B2037 polyclonal antibody used at a 1/250 dilution. Immune complexes were

1654

MOL. CELL. BIOL.

DEVAULT AND GROS D

XDR13 B

A

N

D

XDR14

A-~AAA

I::

lb

N

XDR13 XDR15

3 A

B

"4

'

D

*

AAA

N

',

Oz c pDR16

-

,IN

am

L.-IN

ME

I

IW

m

-AAAA

FIG. 1. Cloning strategy for mouse mdr3 cDNA. A schematic representation of cDNA clones overlapping the mdr3 gene along with the position of certain restriction enzymes is shown. Clone XDR13 was isolated from a cDNA library constructed with mRNA of a drug-sensitive mouse BALB/c cell line, 70/Z, using an oligonucleotide (probe a) overlapping a short segment of identical sequence in mdrl and mdr2. Clone XDR14 was obtained by screening the same library with probe b, a 380-bp 5'-end segment of XDR13. Clone XDR15 was isolated from a cDNA library constructed with mRNA from a multidrug-resistant cell line, P388-ADM2, using an mdr3-specific oligonucleotide (probe c) to prime the reverse transcriptase-directed first-strand cDNA synthesis reaction. This cDNA library was screened with a 260-bp 5' segment of clone XDR14. By using a common and unique Ndel restriction site (N), the cDNA inserts of XDR15 and XDR13 were fused to create a complete mdr3 clone, pDR16. For XDR clones, thin lines correspond to 5'- and 3'-untranslated regions; open boxes, major open reading frame; stippled boxes, DNA probes. AAA, Polyadenylated segments; N, NdeI; A, AccI; D, DraI; B, BalI. The predicted structural features of the mdr3 gene product are schematically presented within the pDR16 clone: filled boxes, transmembrane domains; hatched boxes, nucleotide-binding site consensus sequences.

revealed by using either anti-mouse or anti-rabbit antibodies coupled to alkaline phosphatase. Antibodies. The mouse anti-P-glycoprotein monoclonal antibody C219 (26) was used to detect MDR1 and MDR3. The epitope recognized by this antibody is VQEALD (E. Georges and V. Ling, personal communication), a sequence precisely conserved in mouse MDR1 and MDR3 (position 1210 in MDR3). An anti-MDR3 antibody was prepared by immunizing rabbits with either a bovine serum albumin or a keyhole limpet hemocyanin conjugate of the oligopeptide CKSKDEIDNLD (position 638 in MDR3). This sequence is unique to MDR3 and is not preserved in the homologous protein domain of either MDR1 or MDR2. Rabbits were immunized by standard procedures, and sera were tested for the production of specific anti-MDR3 antibodies by immunoblotting against protein extracts prepared from LR73 cells, LR73-1A cells expressing MDR1, P388 cells, and two multidrug-resistant derivatives, P388-ADM1 and P388ADM2, which only express the mdr3 mRNA (38), and protein extracts from E. coli cells producing an MDR2/TrpE fusion protein whose MDR2 portion corresponds to residues 633 to 777. A positive and specific anti-MDR3 serum (B2037) was identified. The specific antibody fraction was further purified by affinity chromatography and concentrated by ammonium sulfate precipitation prior to use. RESULTS Isolation of cDNA clones for mouse mdr3. A cDNA library constructed from the drug-sensitive mouse pre-B cell line 70/Z was initially screened with an oligonucleotide probe corresponding to one of the nucleotide-binding site domains identified in the MDR1 protein (Fig. 1, probe a). Three distinct cDNA species that could be separated according to their restriction maps were isolated. The two most abundant

species were found to correspond to cellular mRNA transcripts of the previously published mouse mdrl and mouse mdr2 genes (21, 22). The third type of clone was identified as corresponding to transcripts of a new mouse mdr gene, tentatively designated mdr3 (9). The nucleotide sequence of one of these clones, XDR13, was determined and found to be distinct but highly homologous to that of mouse mdrl and mdr2. Further screening of the same library with a 380base-pair (bp) fragment corresponding to the most 5' segment of the insert of XDR13 (Fig. 1, probe b) resulted in the isolation of clone XDR14. Sequence analysis of this clone indicated that it was still short of the predicted full-length size (Fig. 1). To obtain the missing 5'-coding region, a mdr3-specific oligonucleotide-primed cDNA library (probe c, Fig. 1) was constructed from multidrug-resistant P388 ADM-2 cells, previously shown to overexpress mdr3 (38), and screened with a 260-bp probe corresponding to the 5' end of clone XDR14 cDNA. Nucleotide sequence analysis of a positive clone (XDR15) indicated that its 5' end included an ATG triplet that could be aligned with the predicted initiator ATG of the mdrl and mdr2 mRNAs. With NdeI, clone XDR15 was fused to clone XDR13 to generate a full-length mdr3 cDNA, pDR16. Since a 5' portion of the complete mdr3 cDNA clone of pDR16 originated from RNA of multidrug-resistant cells (P388ADM-2) and since discrete mutations in the coding portion of the human mdrl gene have been found to be associated with drug selection (5), we verified that the segment of mdr3 cloned from P388ADM-2 did not contain such alterations. For this, two mdr3-specific oligonucleotides (see Materials and Methods) were used to amplify by polymerase chain reaction the corresponding segment of mdr3 cDNA synthesized from normal mouse intestine RNA, a tissue previously shown to express the mdr3 gene (9). The resulting 740-bp amplified DNA fragment was sequenced

VOL. 10, 1990

MULTIDRUG RESISTANCE CONFERRED BY mdr GENES

and found to be identical to the corresponding segment of XDR15 (data not shown). Sequence analysis of mouse mdr3. The 4,356-bp full-length mdr3 cDNA insert of pDR16 has a 151-bp 5'-untranslated sequence followed by a putative initiator ATG codon and a 3,825-bp segment which forms an uninterrupted open reading frame (Fig. 2). The ATG codon at position + 1 was assigned as the probable initiator methionine since (i) it was the first ATG codon detected in the 5' end of the clone (Fig. 2), (ii) it initiates a predicted polypeptide of sequence highly homologous to the products of mdrl and mdr2, and (iii) it aligns precisely with the position of initiator methionines predicted for mdrl and mdr2. However, since no in-frame stop codon was detected in pDR16 upstream of this ATG codon, we cannot formally exclude the possibility that another upstream ATG, absent from XDR15, is the initiator ATG used in vivo. The coding region ends with a TGA termination codon immediately downstream of the serine residue at position 1276. The following 367 bp constitute the 3'-untranslated region which ends with a segment of 10 consecutive adenosine residues located 18 bases downstream from an imperfect TATAAA putative polyadenylation signal. This region does not appear to be the only site of mdr3 mRNA polyadenylation since other mdr3 cDNA clones showing further 3' extensions were isolated (data not shown). These differences in the length of the 3'-untranslated region correlate with the presence of two mouse mdr3 mRNA transcripts of approximately 5 and 6 kilobases that we have previously detected in normal mouse tissues by Northern (RNA) analysis with an mdr3-specific cDNA hybridization probe (9). The mdr3 cDNA open reading frame is capable of encoding a polypeptide of 1,276 amino acids in length with a predicted molecular weight of approximately 140,000 (Fig. 3). Analysis of the predicted amino acid sequence of MDR3 indicates that it shares the same predicted structural features and overall membrane arrangement as that of the two other members of the mouse mdr gene family. As observed previously for all other cloned mdr genes, the MDR3 polypeptide is formed by two symmetrical halves. Hydropathy analysis (data not shown) suggests that each half encodes six putative membrane-associated hydrophobic domains capable of forming three transmembrane loops, and sequence analysis also identifies a consensus site for ATP binding (Fig. 3). Amino acid sequence alignment of the two halves of MDR3 (residues 1 to 629 versus 630 to 1276) indicates that they share 38% identical residues with an additional 24% conserved substitutions, for a total homology of 62% (data not shown). This homology is highest in the segment overlapping the ATP binding domains (residues 346 to 629 and 991 to 1276, 77% homology), decreases in the transmembrane domain regions (residues 50 to 345 and 707 to 990, 54% homology), and disappears at the extreme 5' end of each half, which correspond to the amino terminus and the "linker" region joining the two halves of MDR3 (residues 1 to 50 and 630 to 706, 18% homology). Seven putative N-linked glycosylation sites (N-X-T, N-X-S) are predicted in MDR3 (positions 14, 83, 87, 90, 292, 700, and 805). Three of these sites would be located in the first extracellular domain of the protein, whereas the others would be within intracellular or transmembrane domains, according to the proposed membrane topology of MDR proteins (4, 21). This suggests that only the three sites mapping to the first extracellular domain may be glycosylated in vivo. A similar cluster of putative N-linked glycosylation sites is also conserved in the same segment of MDR1 and MDR2.

1655

The three MDR proteins are formed by an identical number of residues, 1,276, and share a high degree of amino acid sequence homology: MDR3 shows a 92% overall sequence homology with MDR1 (83% identity, 9% conserved substitutions) and 85% homology with MDR2 (73% identity, 12% conserved substitutions), while MDR1 and MDR2 are also 85% homologous (71% identity, 14% conserved substitutions). The three proteins show sequence variations at 417 positions, 39 of these substitutions being unique to MDR3, 77 unique to MDR1, and 214 unique to MDR2. Together, these results indicate that MDR1 and MDR3 are more closely related to each other than they are to MDR2, perhaps reflecting a shorter evolutionary distance between MDR1 and MDR3. Among the three proteins, the most conserved segments overlap the two predicted intracellular domains that include the ATP-binding folds in which the percentage of sequence identity varies between 91 and 99%, depending on the pair of MDR proteins analyzed. The nonconserved regions among the three proteins are mainly clustered within small segments of very low sequence homology: the first predicted extracellular loop of each homologous MDR half (residues 78 to 102, 5 to 14% identity; and residues 730 to 748, 16 to 46% identity) as well as the linker domain joining the two homologous halves (residues 637 to 673, 17 to 33% identity). Likewise, nonhomologous regions of MDR2 versus MDR1/3 are clustered within short segments: the amino terminus (residues 1 to 35), the extracellular domain defined by transmembrane domains 11 and 12 (residues 957 to 969), and a short segment downstream of transmembrane domain 12 (residues 998 to 1013). The roles of these highly divergent segments in MDR protein function are unknown. Biological activity of mouse mdr3. To investigate the biological activity of mdr3, the insert of pDR16 was cloned in the mammalian expression vector pMT2, which utilizes the adenovirus major late promoter and simian virus 40 enhancer elements to direct high levels of expression of cloned cDNAs. As a positive control, the mouse mdrl cDNA was introduced in the same vector. The resulting plasmids, pMT2.1 (mdrl), pMT2.3 (mdr3), and pMT2.3r (mdr3 in the antisense orientation), were introduced by transfection into Chinese hamster drug-sensitive LR73 cells, followed by selection of drug-resistant colonies in cultured medium containing Adriamycin (50 ng/ml) or colchicine (100 ng/ml). Although pMT2.1 could elicit formation of multidrug-resistant colonies in five independent experiments, no such colonies could be detected with either pMT2.3 or pMT2.3r (data not shown). Subsequently, pMT2.1 and pMT2.3 were introduced into LR73 cells by cotransfection with the indicator plasmid pSV2neo followed by selection of transfected cells in Geneticyn (G418). Several hundred G418-resistant (G418r) colonies were obtained for each cotransfection and were harvested as mass populations. To detect a possible multidrug resistance phenotype in these cotransfected cells, 105 G418r cells of each mass population were plated in medium containing increasing concentrations of several cytotoxic drugs. Results presented in Fig. 4 show that mdr3, like mdrl, cause an increased capacity of cotransfected cells to survive in medium containing vinblastine, Adriamycin, actinomycin D, mitoxantrone, and colchicine when compared with mass populations of cells cotransfected with the control pMT2.3r plasmid. In addition, quantitative differences in the multidrug resistance phenotype conferred by these two genes are noticeable. Particularly, mdr3 appears to confer only very low levels of resistance to Adriamycin and colchicine as compared with mdrl, probably explaining our inability to obtain resistant colonies with mdr3 in transfec-

DEVAULT AND GROS

1656

MOL. CELL. BIOL.

C> C> C> C> C> CO C> C> C> CO C> CO CO C> CO CO (D C) CO C> C) C> C> CO CO C> CO CO C> w u) to r- ao oN (D r-i c-4 cy) v Ln %o r- co a% (D r-i N cy) T-1 H r-i H H H H H H H 04 CN N N

W-4 CO

0 0

E-4 P 0 P P P

CD CO qw N

40 40 CO C> C> (D CO C> CO CO C> CO CO c. CO C> CO CO CO CO C> CO C> C> CO CO C> C> CI (D CO C> C> C> CO 40 Ln w r- 00 4M C> r-I N (y) IV If) %0 r- CD 0% C> r-i CN

N N N 04 04 cn cn cn cn m cn cn cn cn cn qw v v

U

co

000460

00-00 foldiolo 40 4J id 4J 4J 0 4J 0 P E-4 0 0 P 4 0 0 to 4i tm E-1 P P E-4 P 0 0 E-4 0 P E4 4 P P 0 0 (d 90 4J 04 4J 01 0 E-1 0 E-1 P p p H p p p 0 04 p p 0 0 (014:0UPOO4 0 V (D 0 4 0 09CP04 04 4i to go CD 4 0 0 P E-1 9C P 6 P P E-4 4 4 4J 4J 0 P E-4 P P P E-1 0 00 P OPP (D p 0 P 0 0 P P 4J 0 4 0 gpgu 4i 4i op (D p (D U U 0 0 E-4 0 0 0 09 04 c co to p p CD P P (D 4J gq 80 0 0 4J 4J (D p (D p (D p p (D 0 (D 0 04 04 C.) 4J 4J CO 90 0 tn p p E4 0 0 0 04 0 0 p .0 .0 E-1 E 00 p 0 4 E-4 0 V 0 0 0 0 tm ON Eq p 0 P p 0 0 p 0 p ou otmolm co p P Eq p0 p p 0 0 p p p co 0 4.) Cd p 0 0 p 00 00 p p E-4 p 04 tm p E-4 P 0 0400 Po P44P co 0 -w E-4 p p p 0 0 0 04 0 P .0 .0 0 010 E-4 P p 0 0 0 p 00000u p p p (d 4J Cd 4J 04 p co 0 9c 0 p p p0u 04 01000p 40p p0 p a C) bN C) CJ E-4 6 8 0 E-4 0 P L) 99 s4 U 4J P E-4 P P P 4J 04 p 4J 0 60000 p 0 0 p 0 to (D (D 0 E-4 0 P 0 p up 0 u p co co tyl tm co p E4 0 P id id id PPOMP OE81OOPP p 0 8.0.0 0 p P4 pp Po 6 pu E-4 6 406 8 . 246u604 099 4J 43 -&-) 4.) (d 0 p4puOu p uggup4upep OPPOO p P.0 0 0 po. im 0 gp4opuo p 4 0 0 0 0 p 0 P 0 40 0 to 0 0 04 P 0 P pp 4J 0 0 E-4 P E-4 E-4 0 0 0 0 0 E-4 0 0 s4 0 P P P P P P -0 4J tn P E-4 00 P 0 P E-4 tP 4.) E-4 E-4 E-4 0 oop 0 E-4 (d (d E-4 L) E-1 L) Q C.) E-1 (D r-) C.) E-1 E-4 E Cd 4.) Q 0 C.) 4.) (d id E-4 4.) E-1 E-4 (D (D E-4 C.) CD U E-4 E-4 E-4 4 P 0 (D U U E-1 4-) CO (U 90 E-4 (D E-4 U P L) Q (D E-4 04 E-1 (4 E-4 (D E-I U (L) 4-) 4-) id 4.) 0 to U (D EE-4 (D P E-4 0 E-4 E-4 E-4 8 E-1 6E-4 U 4-) 4J 10 0 E-4 tm 9 E-1 E-4 0 0 E-4 4 (D Q E-4 0 E-4 E-4 E-4 E4 CO 4.) 4.) 4.) (d U E-4 E-4 E-4 C.) E--l E-4 (D U P C) (D P 6 E-4 (D IL) 4 U +) id 4.) (d cd E-1 E-4 U E-4 Q 6 C.) 0 (D E-4 E-4 LI) 0 04 s4 (D (D E-4 E-4 C.) (p U t)N r.) 4.) co U E-4 (D E-4 U (D Q 0 (D E-4 0 4 s4 E-, E-1 P 0 (D C.) C.) 8 id tmtd t P (DI 04 04 P U U O 91 C.) U Q E-4 04 6 0 (D E-4 U O E-4 (D r.) E-4 O 0 it 4.) E-4 U (D E-1 (d 4.) 6 (4 (D 6 E-4 gg 4 0 E-' og 4 0 E-4 (D (D E-4 0 0 0 90 Id (d 4-3 (L) 4.) 6 E-1 E-4 4 (D E-4 E-4 (D (D E-4 Q (D E-4 E-4 E-4 E-4 E-1 E-4 E-4 E-' 0 E-4 I$ Ef6 4.) id Id 8 i 0 E-4 E-4 LI) E4 E-4 0 E-4 0 4 94 C.) 4 4 (D (_) P E-4 0 E-4 (D 0 E-4 C.) U Cj C.) tM IMV 0 U 04 P U 99 8 P 6 Q (D 0 0 Q 4 U (D E-4 E-4 P4 U C.) E-4 gg (D (D Q 4 606E-16064.) 004i cd (D (D OP Q44Qfl-4E-4gC E-4 (D U E-40 0 E-4 (D 0 (a 04 E-4 (D U (D (D (D gg E-4 E-4 (D Q0 (D E-4 (D 0 E-4 C.) E-4 E-1 LI) bM tm 0 4.) (d E-1 (D E-4 (D E-4 4 Q (D E-4 (D E-4 E-4 E-4 (D E-1 (D (D I 4 (D 9 E-4 r_) E(D 04 og cd (d to 4i 99 E-4 (D (D (D O r,) E-4 4.) E-4 to 0 E-4 E-4 0 0 E-4 8) P (D to 0 E-4 (D U E-4 Eg-4 64 E-iE-4 0 LI) (D94 E 0 E-4 0U E-' E +) Id to E-4 E-1 s4 4 E-1 gC P U P E-4 gC g4 (D 0 0 E-i E 4 U LI) (D 94 U 01 a to (D U E-4 E-4 r_) E-4 (D E-4 4 0 (D P4 Q C.) U E-4 E-4 0 E-4 (D (D 1 (D 4.) 0 cd (D 0 4 E-4 (D sg 0 E-4 0 E-4 Q (D 4 U s4 0 4 (D 4 E-1 Q E-4 E-4 4 Q E-4 cd tM cd CO CO I 0 E-' E-4 E-4 Q Q E4 E-4 U L) E 4 (D U 0 E-4 0 4J (a Co 4 E-44 -4 04 r_) (D cd LI) s4 (D E-4 E-4 (D (D r,) E-4 U E-4 4 E-' Q E-4 E-4 (D 0 E-4 . (D LI) U U 4V 4J Ep8 Co 94 -4 (D (D E-4 4 (D (D U (D C_ C.) C.) gC LI) (D P E-4 (D (D gC 4 E 4 C.) C.) to 4J 4.) 4-) E-4 4 E-4 (D C_) 0 (D L) O 0 P (D O E-4 04 E-4 E-4 6 U 6 U 6 (D 99 E-4 (D E-4 IL) E-4 tn 4i 4.) 0 4.) C.) og E-' 0 E-' (D 4 C.) (D E-4 0 4 0 Q E-1 E-4 P P P E-1 0 4.) 4-) 0 4.) 0 6 E-4 (D P P4 (D o4 P -4 E-' 4 E-1 (D gg Q P4 (D P 0 E-4 U 0 8 E-4 4-) C) 4.) E-i E-4 E-4 4 E-i U P C.) (D U E-4 (D (D 0, E-1 4 E-1 P U C.) (D 0 O0 Q P 0 0 E-4 4-3 P (D . (D (D U E-4 4 Q P4 U 4 4 (D E-4 0 E-4 E-4 (D og r.) 4-) 4.) 4.) 4.) (D E-4 Q (D U 6 (D (D 6 (D P E-4 P 4 E-4 P Q P (D 0 C.) C_) C_) r.) IV t Co 4.) C.) (D (D E-4 C.D E-4 U 4 U IL) E-1 (D P P E-1 U Q Q (D (d 4.) 10 4.) tm E-4 p O (D P (D P O (D (D 6 (D (D 4 E-4 tM id 4.) (d 0 E-i E-4 E-4 E-4 E-1 0 gg gg 4 (D P 94 4 4 (D 0 0 E-4 C.) 6 8 I 9c (04 4.) 4.) 4.) bi 99 bN (D E-4 E-4 P Q 4 Q E-4 (D 4 E-4 E-4 s4 0 (D (D C.) P O E-4 E-1 Q C.) P (DC.) LI) O (D 6 4-) (d 4-) co (D gg LI) 4 0 0 E-4 p L) 0 E-4 0 E-4 (D U E-4 (D tgDC 4 E-4 t3m tm C) bi 6 (D LI) E-4 4 E-1 E-4 L) E-4 E-4 0 U P4 P 4 Ej 6 E-4 (D (D P4 0 (D E-4 E-1 E-4 E-4 10 id id E-4 (D (D Q 0 (D 4 P U LI) 4 r,) (D (D (D 0 (D gg s4 (D Q (D U P 0 P 8 0 tn Co Ej L (D U P 0 (D E-4 (D ID (D E-4 L) U E-4 s4 E-4 (D (D 0 4 0 UN 4-) E-4 4.) (D E-1 P P P 0 C.) E-4 (D 0 (D c) 0 E-i E-4 (D E-4 8 U E-' E-4 U (D 4 E-1 0 0 tn 4i co P 6 E-i P P U (D (4 (D E-4 (d 4J co p P 0 I rE-), P p 0 U 0 P P P . 0 0 04 CL) 0 09 p P L) U 0 L) p p p L) E4 0 P 00U 4 p 0 L) P U P 6 0 p Cd 0 co 4J 0 0 04 P U 4 P 4 0 (D P 0 P 0 CD P 4 P L) P p P 04 0 U P 0 to 4i V 4 p U0 40 4 0 40 P 0P E-4 U 0 0 0 0 P 0 0 id Cd Ej 01 4E-IOPO PPOP44P P P 4 09 0 E-4 4J C) 4J 4J 8 pp 0 CD ip 6 CJ IM 4J L) p 8 0 U0 p p UUPP POUP44P it Id 4J 4J 6 p p 66 p 0 4 (D U 0 CD 904 00U P E-' LI) P P P 4J 0 id 0 E-4 P E-4 6 0 E-, ID E-4 6 0 E-4 P 6 E-4 4J It 0 p 0 p 0 P gC 4 E4 L) 8 24 pp p 0 0 p0 0 4.) 4.) 0 U 4 P 0 0 E-' 0 P P P 0 4 E-' 0 E-4 0 0 P 6 (E-, P IJ P (d co t) E-4 0 6 0 p p 0 0 p 0 4 4 08. p p 6 p 0 OPUP 0 IM 4J CO CO 4J PO 00 0 PO 04 Eg-i PP 6 Po E-4 00 PO p 0 00 0 p p 4J 4J E-1 p 0 p 4 4 0 0044 4U4 0 4 p p p 4 0 4 0 0 4J 4 4 P P 0 P 4 0 . 0 0 4 0 0 E-4 P E-4 0 E-4 0 0 0 CD U 0 0 go to Id p 0 41 6 U04PO4 C)OPOOP049c 0 P tM Id 4J 0 E-4 (DC op Po 0 Cj LI) CD P 00 P0 P 4P.E40&4. OPO.UO PIPPP 800 0 tm cd cd 4J P 99 6 OP 6p 6 it 4J O4 p 0 P P P P P P E-4 9c 0 4J

00 la rA r. '= CO -0

P P P E-1 U 0 0 4 P P 0u0p 6864 0

CU

tn..

Z.0

v) CZ .:

06

IL)

o CZ

E

t

66P

06

..:

E.a

8.00 t

= C

E

z

a

r. 2

E

8

.!

.0

(1)

?: E

6

-

72

.r-

(1) 41

6600.84PP6PP L

D E-, 0

48P

064 (p E046 gLC)

bo

z

+.,

Lo CZ

Q) la .t.

o ci

-Eb Z= = 4-

0

Zz.

CZ

tn CZ 0

CZ

=

(U

'.5 r-.2",am 0

.0,2 Z -

tn

8PP060 60668

OE-48UP082up

,

c,0

.

0

co m

4 6 s 4 ( D E 4 _U ) 6 91

v.

F

0

r

6

I"t

.00

66

-4

. rz

0

U

t3l

-

0 0

la

04

40

r.

0.

8 (-D4 (E-)4

8

uj

0

P8

6

u

0

go' Up pp P4 04P04OP8

u6

ItC

-0

CZ

8.

OE4016

6.

= CZ

.

4i 4i 4i

8

Ej t0 0

0

'E-Di P

Id Id id tt (d

Z O.?:

-:=

.. co

Q.

57D

MULTIDRUG RESISTANCE CONFERRED BY mdr GENES

VOL. 10, 1990

a a

cn CA (1

D _F C

900 33

33 9

33

33

a9

333

aa

r-L r-

En U) cn

C

w-

_n tn c

H

1

.

33

i

It

CLrL

z z z

Ht

g2

HH

H

33 5

33

555 33

aP ~aP ~ a a

~ ~ M1

a

C

-

333

a

-

aaC

cn uz

til

_s s t2 tn tv O a O

7