A r t i c l e
TWO INNEXINS OF Spodoptera litura INFLUENCES HEMICHANNEL AND GAP JUNCTION FUNCTIONS IN CELLULAR IMMUNE RESPONSES Zunyu Pang∗ , Ming Li∗ , Dongshuai Yu∗ , Zhang Yan, Xinyi Liu, Xinglai Ji, Yang Yang, Jiansheng Hu, and Kaijun Luo School of Life Sciences and Key Laboratory for Animal Genetic Diversity and Evolution of High Education in Yunnan Province, Yunnan University, Kunming, P. R., China
Insect cellular immune responses include encapsulation, nodule formation, and phagocytosis. Hemichannels and gap junctions are involved in these cellular actions. Innexins (Inxs: analogous to the vertebrate connexins) form hemichannels and gap junctions, but the molecular mechanisms underlying their biology is still unclear. In this article, we reported a steady-state level of Inxs (SpliInxs) in hemocytes of Spodoptera litura, which formed nonfunctional hemichannels on the cell surface to maintain normal metabolism. We also reported that two innnexins (SpliInx2 and SpliInx3) were expressed significantly higher in hemocytes compared to other tissues, suggesting that they play important roles in hemocytes. Amino acid analysis found that two cysteine residues in two extracellular loops provided the capability for SpliInx2 and SpliInx3 hemichannels to dock into gap junctions. Western blotting demonstrated that both extracellular and intracellular loops of SpliInx3 and the extracellular loops of SpliInx2 might undergo posttranslational modification during the formation of a steady-state hemichannel. During hemichannel formation, SpliInx2 presented as one isoform, while SpliInx3 presented as three isoforms. These results provide fundamental knowledge for further study of how steady-state ∗ These authors contributed equally to this work. Grant sponsor: National Basic Research Program of China from Major State Basic Research Development Program; Grant number: 2013CB127600, Grant sponsor: Yunnan Department of Science and Technology; Grant number: 2013FA003; Grant sponsor: National Natural Science Foundation of China; Grant numbers: 31260448, 31060251, 31360454, 31160021, and 31270131. Correspondence to: Kaijun Luo, School of Life Sciences, Yunnan University, 2 CuihuBei Road, Kunming 650091, P. R. China, E-mail: [email protected]
ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 90, No. 1, 43–57 (2015) Published online in Wiley Online Library (wileyonlinelibrary.com). C 2015 Wiley Periodicals, Inc. DOI: 10.1002/arch.21243
44
r
Archives of Insect Biochemistry and Physiology, September 2015
levels of SpliInxs are dynamically adjusted to perform cellular immune C 2015 Wiley Periodicals, Inc. responses under immune challenge. Keywords: gap junction protein; innexin; posttranslational modification; Cysteine residue; cellular immune response
INTRODUCTION Insect cellular immune responses include encapsulation, nodulation, and phagocytosis. Gap junctions and hemichannels act in cellular immune reactions. Innexins (Inxs: analogous to the vertebrate connexins) are proteins responsible for forming hemichannels and gap junctions. Formation of hemichannels on the cell surface of lepidopteran hemocytes has been reported, and lipopolysaccharide (LPS) challenge decreases hemichannel function in Heliothis virescens hemocytes (Luo and Turnbull, 2011). Polydnavirus-mediated immunosuppression leads to down-regulation of SpliInx2 and SpliInx3 expressions during granulocyte apoptosis in Spodoptera litura hemocytes (Luo and Pang, 2006; Li et al., 2014). Available evidence indicates that Inxs act in cellular immune responses via hemichannels and gap junctions, although details remain unclear. Our previous study noted that overexpression of SpliInx2 and SpliInx3 activated PI3K-dependent changes in cell physiology (Liu et al., 2013). These changes included promoting apoptosis in Sf9 and Spli221 cell lines (both showing a lower level of phosphorylated Akt and activated caspase 3) and maintenance of a steady-state level of SpliInx2 and SpliInx3 in the High-Five cell line (which presents a high level of phosphorylated Akt and no activated caspase 3) (Liu et al., 2013).Understanding how Inxs maintain a nonfunctional steady state is a key question to address how Inxs regulate cellular immune responses. Insect Inxs belong to the gap junction protein family, which includes the connexins and pannexins of vertebrates and the vinnexins of some viruses (Turnbull et al., 2005; Webb et al., 2006). Gap junctions serve to coordinate cell-to-cell communication within tissues by allowing the transfer of ions, amino acids, and nucleotides, as well as second messengers such as Ca2+ , cAMP, cGMP, and IP3 between cells (Goodenough and Paul, 2003; Saez et al., 2003), thereby affecting cellular behaviors through the activation of paracrine signaling pathways (Wang et al., 2013) via signaling molecules, including ATP, ADP, AMP, and adenosine (Zhao et al., 2005; Huang et al., 2007; Chekeni et al., 2010; Peter et al., 2010). These gap junctions are essentially docking channels formed by two individual hemichannels from two neighboring cells (Yeager and Harris, 2007; Yen and Saier, 2007; Marziano et al., 2011). Based on their constituent domains, hexameric hemichannel proteins are individually named connexon, pannexon, innexon, and vinnexon within their respective organisms. However, invertebrate Inxs are poorly characterized, as most work on this family has been done in vertebrate species. Generally, each of the individual proteins that oligomerizes in the four types of hemichannels shares similar topologies, with four α-helical transmembrane segments (TM), two extracellular loops (EL), an intracellular loop (IL), and intracellular aminoterminus (NT) and carboxyl-terminus (CT). Numerous studies in vertebrates show that connexons are assembled in the Golgi via individual connexin proteins (Su and Lau, 2012). During synthesis, connexin is cotranslationally inserted into the endoplasmic reticulum (ER) membrane, and upon proper folding, is trafficked to the Golgi apparatus and trans Golgi network where it is posttranslationally modified and oligomerizes into hexameric connexons, which are then transported to the plasma membrane (Su and Lau, 2012). Archives of Insect Biochemistry and Physiology
Two Innexins of Spodoptera litura Influences Hemichannel
r
45
In the present study, we analyzed the steady state of SpliInx2 and SpliInx3 in High-Five stable cell lines. We analyzed cysteine, phosphorylation sites, and generated antigenic epitopes of SpliInx2 and SpliInx3 to map out the possibility of forming hemichannels and gap junctions. We also determined that both extracellular and intracellular loops of SpliInx3 as well as extracellular loops of SpliInx2 may undergo posttranslational modification during formation of the steady-state hemichannel. This work provides fundamental knowledge for further study of how steady-state levels of Inxs are dynamically modulated to perform cellular immune responses under immune challenge.
MATERIAL AND METHODS Insect Rearing and Cell Culture A colony of S. litura was reared according to an established method (Luo and Pang, 2006). High-Five (BTI-Tn-5B1-4) adherent cells were derived from Trichoplusia ni embryos (Granados et al., 1994) and cultured in TNM-FH insect culture medium containing 10% fetal bovine serum (FBS, HyClone, Logan, UT, USA). Cells were maintained and passaged in 25-cm2 tissue culture flasks (Corning, NY, Made in China). Wasp Rearing and Parasitization The parasitoid Microplitis bicoloratus colony was maintained on S. litura larvae reared in the laboratory. Adults were also provided with honey as a dietary supplement. Passage of parasitoids was performed according to established methods (Luo et al., 2007). Total RNA Isolation, cDNA Synthesis and qRT-PCR Fourth instar S. litura larvae were used to isolate hemocytes, fat body, midgut, and nervous tissues, while female adults were used to isolate ovarian tissue, and male adults were used to isolate testicular tissue. Total RNA was isolated from each of the collected tissues using RNAiso Plus (TaKaRa, Dalian, China), according to manufacturer’s instructions, including DNase treatment. The concentration and purity of each RNA sample was determined by measuring the optical density (OD) at 260 and 280 nm using a NanoDrop 2000. Samples with an A260/A280 ratio >2.0 were used to synthesize cDNA using OligodT 18 primers following manufacturer’s instructions (TaKaRa). All cDNA samples were stored at –80°C for preservation. qPCR was performed on an ABI 7500 using the following primers: SpliInx2-Q F (5 -CGTTCCGTTTCTTTATCTG-3 ) and SpliInx2-Q R (5 -ACACGCTCCTCTGGCTC-3 ) for a 144-bp product, SpliInx3-Q F (5 -ATCGCATCACATCAGCC-3 ) and SpliInx3Q R (5 -AGGTAATCCAGCAATAGG-3 ) for a 134 bp, with 18S as an endogenous control with 18S-Q F (5 -AGAACTCTGACCAGTGATGGGATG -3 ) and 18S-Q R (5 CTGATTCCCCGTTACCCGTGA -3 ) for a 215 bp product. The 2−࢞࢞CT analysis method was used as reported previously (Livak and Schmittgen, 2001). Prokaryotic Plasmids and Expression SpliInx2 was amplified via PCR, using cDNA as a template with the following primers: SpliInx2 F (5 -GAATTCATGTTTGACGTTTTCGGCT-3 ) and SpliInx2 R Archives of Insect Biochemistry and Physiology
46
r
Archives of Insect Biochemistry and Physiology, September 2015
(5 -GCGGCCGCGTACACACTGTCCTTCCC-3 ) containing EcoR I and Not I sites (underlined). The gene was then directionally cloned into pMD19 (TaKaRa, Dalian, China) and sequenced. A fragment of SpliInx2 was cut and inserted into the prokaryotic expression plasmid pET32a (Novagen, Shanghai, China). This prokaryotic expression vector contains T7 promoters to express a 6His-Inx2-6His fusion protein. The same method was used to produce another construct that expressed a 6His-Inx3-6His fusion protein, using the following primers: SpliInx3 F (5 -GAATTCATGGCGGTATTTGGTTTG G-3 ) and SpliInx3 R (5 -GCGGCCGCATACGTTTCGGTTTC 3 ) containing EcoR I and Not I sites (underlined). A pET32a empty vector served as a negative control, subsequently named pET32a. BL21(DE3) was used as an expression strain. All of the recombinant plasmids were sequenced before expression in bacteria. Eukaryotic Expression and Selection of Stably Transfected SpliInx2-V5, SpliInx3-V5 Fusion Protein in High-Five Cell Lines Transfection was performed as previously described (Liu et al., 2013). In briefly, transfected cells were incubated at 27°C; after 96 h, the transfected cells were resuspended, diluted into TNM-FH 10% FBS medium containing 300-μg/ml Zeocin, and plated in 60-mm dishes at 50% confluence. After 5 days, cell clones stably expressing SpliInx2-V5, SpliInx3-V5, and empty vector (pIZT) attained confluence, and the cells were maintained in TNM-FH medium containing 10% FBS and 300 μg/ml Zeocin in 25 cm2 flasks. Predict Antigenic Epitopes of SpliInx2 and SpliInx3 With or Without Phosphorylation and Generate Polyclonal Antisera NetPhos 2.0 (Blom et al., 1999) and NetPhosK 1.0 (Blom et al., 2004) were used to predict phosphorylation sites and the types of kinases. Two antigens in extracellular loop 1 were chosen for SpliInx2, with and without phosphorylated sites. Another two antigens also with and without phosphorylated sites were chosen in SpliInx3 in the intracellular loop. Rabbit polyclonal antibodies were generated for these peptide antigens by Biocompany (GL Biochem, Shanghai, China). Antisera for the antigenic epitopes RLVGRVGKDVVQAGVA and SHVDGQDEVKYHKYYQ (which contain of S95 and T105 in EL1), were named anti-SpliInx2EL1(94) and anti-SpliInx2EL1(110), respectively. Two other antisera, those for SDGMRGTAASIADDK (containing S143 and S152 in IL) and KNNRLNRLVQYLVDTRHMHNTYS, were named anti-SpliInx3IL(156) and anti-SpliInx3IL(179), respectively. Western Blotting Western blotting was performed as previously described (Liu et al., 2013). Briefly, recombinant SpliInx2-V5 and SpliInx3-V5 fusion proteins were detected with mouse anti-V5 (Invitrogen, Carlsbad, CA, USA) (1:5000) and a goat antimouse horseradish peroxidaseconjugated secondary antibody (Beyotime, Nantong, China) (1:2000). 6His-Inx2-6His and 6His-Inx3-6His fusion proteins were detected with mouse anti-6His antibody (Beyotime, Nantong, China) (1:2000dilution). SpliInx2 extracellular loop 1 was detected with anti-SpliInx2EL(94) and anti-SpliInx2EL1(110) Rabbit (1:500), and SpliInx3 intracellular loop was detected with anti-SpliInx3IL(156) and anti-SpliInx3IL(179), and a goat antirabbit horseradish peroxidase-conjugated secondary antibody (Beyotime, Nantong, Archives of Insect Biochemistry and Physiology
Two Innexins of Spodoptera litura Influences Hemichannel
r
47
Figure 1. High steady-state SpliInx2 and SpliInx3 expression in host Spodoptera litura hemocytes. (A) SpliInx2 and (B) SpliInx3 in different tissues: hemocytes (He), fat body (Fa), midgut (Mi), nerve (Ne), ovary (Ov), and testis (Te). RQ: relative quantification.
China) (1:2000dilution). Bands were visualized via enhanced chemiluminescence (ECL, Beyotime, Nantong, China). Statistical Analysis Statistical analyses were performed using SPSS 16.0 for Windows (SPSS Inc., Chicago, IL, USA). Resulting data were presented as mean ± SEM. One-way ANOVA with SNK’s multiple comparisons were used to assess differences among different tissue types. All assays were repeated at least three times to ensure accuracy.
RESULTS Steady-State SpliInx2 and SpliInx3 Highly Expressed in Host Hemocytes Under immune challenge by the parasitoid M. bicoloratus, the transcription levels of SpliInx2 and SpliInx3 are significantly decreased (Li et al., 2014). We wanted to determine whether SpliInx2 and SpliInx3 are important proteins in hemocytes. We detected mRNA expression in different tissues: hemocytes, fat body, midgut, nerve, ovary, and testitis. However, their mRNA profiles were quite different. The expression levels of SpliInx2 and SpliInx3 in hemocytes and ovarian tissues were significantly higher than those in the other four tissues (P < 0.001) (Fig. 1), but the mRNA levels of SpliInx2 and SpliInx3 in testis, fat body, midgut, and nerve tissues were not significantly different. Overall, SpliInx2 and SpliInx3 were distributed broadly but were more highly expressed in hemocytes and ovarian tissues. The high expression in hemocytes suggested that SpliInx2 and SpliInx3 play an important role in cellular immune responses. SpliInx2 and SpliInx3 Cysteine Residues in the two Extracellular Loops Previous observations have documented that hemichannels and gap junctions are present in hemocytes, and SpliInx2 and SpliInx3 have been cloned from hemocytes (Liu et al., 2013). Cysteine residues are the hallmark of canonical gap junction proteins as a regulator via forming disulfide bonds. Connexins (Cxs) contain three cysteine residues, pannexin1 Archives of Insect Biochemistry and Physiology
48
r
Archives of Insect Biochemistry and Physiology, September 2015
(Px1) contains two, and Inxs contain two (Barbe et al., 2006). We found that a key feature of SpliInx2 and SpliInx3was two cysteine residues within two extracellular loops (EL1 and EL2). The space between the two conserved cysteines (C) was CX13 C for SpliInx2 andCX14 C for SpliInx3 in EL1, and CX17 C for both SpliInx2 and SpliInx3 in EL2. Moreover, the amino acids around the cysteine were conserved between the different Inx family members (Fig. 2). These results suggest that the cysteine residues of SpliInx2 and SpliInx3 provide the fundamental disulfide-linked ELs to allow docking of two hemichannels to generate a gap junction channel. SpliInx2 and SpliInx3 Phosphorylation Sites and Protein Kinases Inxs are known to form hemichannels, with the majority of phosphorylation events occurring on serine (S), although tyrosine phosphorylation has also been observed (Bauer et al., 2005). In this study, we noted nine phosphorylation sites in SpliInx2 and 12 phosphorylation sites in SpliInx3. S7 was located at the N-terminal (NT) of SpliInx2; while S67, S95, and S105 were in EL1; S207 and S215 were in internal loop (IL); S268 was in EL2; and S358 was in the C-terminal (CT). In SpliInx3, S86 was in NT; S143 was in EL1; S152 was in IL; S219 and S238 were in EL; S366 was in CT. In SpliInx2, S95 and Y105, no putative kinases were identified, but in SpliInx3, S143 and S152 had putative kinases, PKA/PKG and CKI/PKC, respectively (Table 1). These results suggested that serine phosphorylation sites and respective protein kinases provided the fundamental sites of posttranslational modification, and SpliInx2 and SpliInx3 might be modified and joined to the membrane to form hemichannels on the cell surface. EL1 of SpliInx2 and, EL1 and EL2 of SpliInx3 Were Potentially Modified at Posttranslational During Assembly of Innexon In order to examine posttranslational modification of SpliInx2, we used the High-Five cell line to stably express the target genes and to guarantee transport of the products from Golgi to membrane and subsequent insertion into the cell membrane. EL1 of SpliInx2 was detected by anti-SpliInx2EL1(94) (Fig. 3C) and anti-SpliInx2EL1(110) (Fig. 4B) from the bacterial lysate. 6His antibody served as a control for the recombinant protein expressed in the bacterial system (Fig. 3A).However, in eukaryotic expression, both antibodies failed to detect EL1, and the CT-V5 antibody only could identify SpliInx2 (Figs. 3B, 4A). Comparing the expression products between eukaryotic and prokaryotic systems, SpliInx2 presented only one isoform in both. Interestingly, the V5-antibody also showed that SpliInx2 was present, albeit quite weakly, during degradation. Collectively, these results suggested that SpliInx2 might undergo a posttranslational modification in EL1 domain. To identify the specificity of EL1 antibodies, we also compared the results of SpliInx2 with SpliInx3 using the same antibodies. We found that anti-SpliInx2EL1(94) could identify SpliInx3 weakly, but that anti-SpliInx2EL(110) could strongly bind to SpliInx3 in prokaryotic expression. The ability of anti-SpliInx2EL(110) to identify SpliInx2 and SpliInx3 in prokaryotic expression was expected, since this antibody recognizes the three amino acids YYQ, which are hallmarks of SpliInxs. We also aligned sequences of anti-SpliInx2EL1(110) with SpliInx3, and a similar sequence, X1 HX3 GX5 EX3 HX1 YYQ in AHPGLGNDFEEEKRIHAYYQ (from 92–111 in EL1 of SpliInx3) was found, confirming that anti-SpliInx2EL(110) was able to identify EL1 of both SpliInx2 and SpliInx3, and most likely other Inxs that also contain the natural hallmark “YYQ.” We further aligned sequences of anti-SpliInx2EL1(94) with SpliInx3, and found a Archives of Insect Biochemistry and Physiology
Two Innexins of Spodoptera litura Influences Hemichannel
r
49
Figure 2. Multiple alignments among the two Spodoptera litura innexin proteins and seven Drosophila melanogaster innexin proteins. The multiple alignment was performed using ClustalW. The sequence numbers are labeled on the right. "*" represents identical residues; ":" represents conserved substitutions; "." represents semiconserved substitutions. Transmembrane domains (TMs) are shown in yellow. The TMs of the two S. litura innexin proteins were identified using the TMHMM in InterProScan. The TMs of the other proteins came from a previous study. Green is used to identify the cysteine residues that are present within the extracellular loops (ELs). Compared to the other proteins, DmInx4 has additional cysteine residues. Red letters indicate the innexin protein’s putative phosphorylation sites as determined by the NetPhos 2.0 server. The kinase specificity was analyzed with the NetPhosK 1.0 server. The class I and II PDZ motifs are shown in brown and purple, respectively. Archives of Insect Biochemistry and Physiology
50
r
Archives of Insect Biochemistry and Physiology, September 2015
Table 1. Predicted phosphorylation sites of two Spodoptera litura innexin proteins. The phosphorylation sites were predicted in NetPhos 2.0 server. The kinase specificity was analyzed in NetPhosK 1.0 server Protein
Amino Acid Position
Type
Content (Score)
Type of Kinase (Score) PKC (0.63) PKA (0.56) CKI (0.53) CKII (0.65) INSR (0.50) P38MAPK (0.54), GSK3 (0.51), cdk5 (0.50) PKA (0.85), PKG (0.51) CKI (0.50), PKC (0.54) PKC (0.55) cdc2 (0.53) PKC (0.52) GSK3 (0.51), cdk5 (0.54) -
SpliInx2 SpliInx 2 SpliInx 2 SpliInx 2 SpliInx 2 SpliInx 2 SpliInx 2 SpliInx 2 SpliInx 2 SpliInx 3
7 (NT) 95 (EL1) 157 (EL2) 207 (IL) 215 (IL) 358 (CN) 67 (EL1) 105 (EL1) 268 (EL2) 86 (NT)
serine serine serine serine serine serine tyrosine tyrosine tyrosine serine
DVFGSVKGL (0.673) AGVASHVDG (0.769) ECKDSRKKL (0.983) DGEFSTYGS (0.840) SDVVSFTEM (0.981) EGKDSV— (0.514) VMDTYCWIY (0.872) DEVKYHKYY (0.937) NEKIYVFLW (0.865) TLPNSPARG (0.950)
SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3
143 (EL1) 152 (IL) 219 (EL2) 299 (CT) 366 (CT) 238 (EL2) 303 (CT) 313 (CT) 324 (CT) 374 (CT) 380 (CT)
serine serine serine serine serine threonine threonine threonine threonine tyrosine tyrosine
VRMISDGMR (0.752) GTAASIADD (0.987) VVKFSNMNQ (0.843) ILLPSTRET (0.974) PSAPSTLEM (0.919) FPRLTKCTF (0.935) STRETILKR (0.714) FRFGTPAGV (0.962) LVRKTQVGD (0.770) MAPIYPNID (0.853) NIDKYAKET (0.703)
similar sequence, X3 GX6 GX1 DVVX6 in TFLGGAFLTYGTDVVKF (from 202–222 in EL2 of SpliInx3, near the serine phosphorylation site 219 (EL2) in Table 1), suggesting that anti-SpliInx2EL1(94) was able to identify SpliInx3 extracellular loop2. However, neither antibody could identify SpliInx3 in eukaryotic expression (Figs. 3B, 4A). Despite antiSpliInx2EL1(94), not anti-SpliInx2EL1(110) (S95 and Y105) having no phosphorylation sites, neither could identify EL1 in eukaryotic expression. These results suggested that SpliInx3 might undergo a posttranslational modification in EL1 and EL2 domains. IL of SpliInx3, and EL2 of SpliInx2 Were Potentially Modified at Posttranslational Level During Assembly of Steady-State Innexon Based on the phosphorylation sites, antigenic epitopes with and without phosphorylation sites in intracellular loop were used to generate polyclonal antisera. The intracellular loop of SpliInx3 could be identified by anti-SpliInx3IL(179) (Fig. 6B) but not antiSpliInx3IL(156) in prokaryotic expression. In eukaryotic expression, these antibodies failed to identify IL, with the exception of the CT-V5 antibody (Figs. 5A, 6A). SpliInx3 presents two bands in prokaryotic expression, in which the band lower than 59 kDa is from alternate translation initiation from an AUG codon approximately 90 nt into SpliInx3 (Liu et al., 2013). In the present study, we demonstrated that this was NT-missing SpliInx3 (though we cannot confirm missing amino acids from 1–27 or 1–31, due to other AUGs nearby). Collectively, the accumulated data suggested that SpliInx3 presented 3 isoforms SpliInx3, modified SpliInx3, and NT-missing SpliInx3 and might undergo a posttranslational modification in IL domain. Archives of Insect Biochemistry and Physiology
Two Innexins of Spodoptera litura Influences Hemichannel
r
51
Figure 3. Antigenic epitope without phosphorylation site in extracellular loop1 (EL1) (94) of SpliInx2. (A) Construction of prokaryotic expression plasmids, with expression 6His fusion proteins. (B) Western blot of EL1 (EL1 94-antibody) and carboxyl termini (CT) (V5-antibody) of SpliInxs in eukaryotic expression from the insect High Five cells. Tubulin served as loading control. (C) Western blots of EL1 and CT (6His-antibody) including N termini (NT) of Spliinxs in prokaryotic expression from Escherichia coli BL21(ED3). GADPH served as loading control.
To identify specific IL antibodies, we also compared the results of SpliInx3 with SpliInx2 using the same antibodies. Unexpectedly, anti-SpliInx3IL(156) was able to identify SpliInx2 specifically in prokaryotic expression (Fig. 5C), but not in eukaryotic expression (Fig. 5B). We aligned sequences of anti-SpliInx3IL(156) with SpliInx2, and found similarity in the sequences, X1 DGX7 IX3 K compared with FDGLCVLPLNIVNEK (from 252–266 in EL2 of SpliInx2, also nearby tyrosine phosphorylation sites 268 (EL2) in Table 1), Archives of Insect Biochemistry and Physiology
52
r
Archives of Insect Biochemistry and Physiology, September 2015
Figure 4. Antigenic epitope with two phosphorylation sites and conserved YYQ motif in extracellular loop1 (EL1) (110) of SpliInx2. (A) Western blot of EL1 (EL1 110-antibody) and carboxyl termini (CT) (V5-antibody) of SpliInxs in eukaryotic expression from insect High-Five cells. Tubulin served as loading control. (B) Western blots of EL1 and CT (6His-antibody) including N termini (NT) of SpliInxs in prokaryotic expression from Escherichia coli BL21(ED3). GADPH served as loading control.
suggesting that anti-IL(156) might identify SpliInx2 extracellular loop2 in prokaryotic expression. Anti-SpliInx3IL(156) contained two phosphorylation sites, but it was still unable to identify SpliInx2 eukaryotic expression. These results suggest that SpliInx2 undergoes a posttranslational modification in EL1 domain.
DISCUSSION Insect cellular immune responses require hemocytes to perform encapsulation, nodule formation, and phagocytosis. Hemichannels and gap junctions are likely to be involved in these cellular actions. In this study, we reported a steady-state level of SpliInxs in hemocytes, which formed a nonfunctional hemichannel on the cell surface to maintain normal metabolism. Our results demonstrated that SpliInx2 and SpliInx3 were highly expressed in the host hemocytes. We reported that nascent SpliInxs formed steady-state Archives of Insect Biochemistry and Physiology
Two Innexins of Spodoptera litura Influences Hemichannel
r
53
Figure 5. Antigenic epitope with two phosphorylation sites in the intracellular loop1 (IL) (156) of SpliInx3. (A) Western blot of IL (156) and carboxyl termini (CT) (V5-antibody) of SpliInxs in eukaryotic expression from insect High Five cells. Tubulin served as loading control. (B) Western blots of EL1 and CT (6His-antibody) including N termini (NT) of SpliInxs in prokaryotic expression from Escherichia coli BL21(ED3). GADPH served as loading control.
hemichannels on the cell membrane. During assembly of the steady-state hemichannels, both EL and IL of SpliInx3 as well as EL of SpliInx2 underwent posttranslational modification. This is the first paper to define a nonfunctional steady state of Inxs, which will contribute to further understanding of the functional hemichannels and gap junctions in cellular immune responses. First, we found that SpliInx2 and SpliInx3 were highly expressed in hemocytes and ovaries compared with fat body, midgut, and nerve tissues of larvae, and also in the testes of adult insects (Fig. 1). The steady-state expression of Inxs in the hemocytes from Heliothis virescens present intermittently open hemichannels (Luo and Turnbull, 2011). This report was followed up by the isolation of SpliInx2 and SpliInx3 from hemocytes of S.litura (Liu et al., 2013). These two reports provide the initial evidence that steadystate hemichannels are present on the hemocyte surface. According to our data, under immune challenge, polydnavirus-mediated immunosuppression leads to down regulation of SpliInx2 and SpliInx3 expression during granulocyte apoptosis in S. litura hemocytes Archives of Insect Biochemistry and Physiology
54
r
Archives of Insect Biochemistry and Physiology, September 2015
Figure 6. Antigenic epitope with and without phosphorylation site in intracellular loop1 (IL)(179) of SpliInx3. (A) Western blot of IL (179) and Carboxyl termini (CT) (V5-antibody) of SpliInxs in eukaryotic expression from insect High Five cells. Tubulin served as loading control. (B) Western blots of EL1 and CT (6Hisantibody) including N termini (NT) of SpliInxs in prokaryotic expression from Escherichia coli BL21(ED3). GADPH served as loading control.
(Li et al., 2014), and recombinant baculovirus infection results in hemichannel-closed Sf9 cells (Guo et al., 2015). These results suggested that steady-state hemichannel could be disrupted during cellular immune responses and raise the question of what mechanisms controls steady-state hemichannel formation? Recent studies have found a series of complex translational and posttranslational mechanisms that regulate gap junction synthesis, maturation, membrane, transport, and degradation, which in turn modulate intercellular communication via gap junction (Dbouk et al., 2009). For connexins, these phosphorylation events are essential for proper control of the formation and modulation of gap junction channel function, since connex in phosphorylation by different kinases (e.g., Src, PKA/PKC/PKG, and MAPKs) is both required and affects connexin/connexon trafficking, assembly and disassembly, degradation, and gating of gap junction channel. In S. litura, PKA/PKG are involved in phosphorylation of Serine 143 of SpliInx3, and CKI/PKC are involved in phosphorylation of Serine 152 (Table 1). These results suggested that serine phosphorylation sites through their respective protein kinases provide the fundamental sites of posttranslational modification, and SpliInx2 and SpliInx3 may be posttranslationally modified and inserted into the cell membrane to form hemichannels on the cell surface. Furthermore, we detected the phosphorylation of serine 143/152 in the IL of SpliInx3 via anti-SpliInx3IL(156) and anti-SpliInx3IL(179) and found that two types of antigen Archives of Insect Biochemistry and Physiology
Two Innexins of Spodoptera litura Influences Hemichannel
r
55
exhibited no specific bindings in the eukaryotic system compared with prokaryotic system. These results supported that posttranslational modification might occur similar to those known in connexin, e.g., phosphorylation. We still a need specific assay to identify phosphorylation exactly happened in Inx3 during forming a steady state on the cell surface. After various cell signaling events, hemichannels dock to form gap junction channels. In mammals, mutation of the extracellular cysteine of Cx43 eliminates gap junction formation without altering hemichannel formation (Bao et al., 2004), while with Px, which forms only hemichannels without gap junctions, substitution of extracellular cysteines does not change localization in the cell membrane nor causes loss of voltage gating (Bunse et al., 2011). We uncovered a biochemical basis for this possibility by demonstrating that SpliInx2 and SpliInx3 contain two cysteine residues in the ELs that can be used to form gap junctions. These results suggest that the cysteine residues of SpliInx2 and 3 provide the fundamental disulfide-linked ELs for the ability of Inxs to dock two hemichannels to generate a gap junction channel. Compared with DmInx2 and DmInx3, both SpliInx2 and SpliInx3 have the same cysteine spacing, implying they might also possess the ability to form gap junctions (Fig. 2). The concept of the steady-state Inxs help explain why overexpression of SpliInx2 and SpliInx3 lead to multiple changes in cell physiology. Recently it was reported that SpliInx2 and SpliInx3present a functional hemichannel that promotes apoptosis in insect cell types already showing a low level of cell death; curiously, this is not happen in stable state in High-Five cells, which has an activated pI3K/Akt signaling pathway (Liu et al., 2013). The concept of steady-state Inxs helps us to answer this question: the steady state of SpliInx2 and SpliInx3 shows nonfunction, like in High-Five cells; and unsteady-state of SpliInx2 and SpliInx3 shows function, like in Sf9 and Spli221 cells. This result serves as a strong indicator that hemichannels are not activators that induce apoptosis, but only function as promoters of apoptosis. A similar result was previously found for Cx43 (Vinken et al., 2012). Caspase3 cleavage of connexin has been observed with Cx45.6 C-terminal in lens (Yin et al., 2008). Taken together, we concluded that although the hemichannels remained at a steady state on the cell membrane, they require a trigger to alter its state, leading to functional activation. Finally, we confirmed that SpliInx2 only presented a single isoform, and SpliInx3 presented 3 isoforms during steady-state process in vitro. In conclusion, our findings demonstrated that SpliInx2 and SpliInx3 were highly expressed in host hemocytes and formed a steady-state hemichannel to maintain normal metabolism. The cysteine residues provided the fundamental disulfide-linked ELs for Inxs potential for docking two hemichannels to generate a gap junction channel. The serine phosphorylation sites and respective protein kinases provided the fundamental sites of posttranslational modification, and joined to the membrane to form hemichannels in the cell surface. Both extracellular and intracellular loops of SpliInx3 as well as extracellular loops of SpliInx2 might undergo posttranslational modification during steady-state hemichannel assembly. This finding might have implications for better understanding of the mechanism underlying cellular immune responses via disrupting the steady state of hemichannels on the cell surface. However, analysis of the disruption of the steady-state hemichannels under immune challenge should involve three levels in hemocytes: transcriptional regulation of Inxs mRNA expression, protein translation, and protein posttranslational modification to reduce steady-state hemichannels or to trigger opening/closing of hemichannels on the cell surface. However, the role of the functional hemichannels on the cell membrane remains to be elucidated. Archives of Insect Biochemistry and Physiology
56
r
Archives of Insect Biochemistry and Physiology, September 2015
LITERATURE CITED Bao X, Chen Y, Reuss L, Altenberg GA. 2004. Functional expression in Xenopus oocytes of gapjunctional hemichannels formed by a cysteine-less connexin 43. J Biol Chem 279(11):9689– 9692. Barbe MT, Monyer H, Bruzzone R. 2006. Cell-cell communication beyond connexins: the pannexin channels. Physiology (Bethesda) 21:103–114. Bauer R, L¨oer B, Ostrowski K, Martini J, Weimbs A, Lechner H, Hoch M. 2005. Intercellular communication: the Drosophila Innexin multiprotein Family of Gap Junction Proteins. Chem Biol 12(5):515–526. Blom N, Gammeltoft S, Brunak S. 1999. Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J Mol Biol 294(5):1351–1362. Blom N, Sicheritz-Ponten T, Gupta R, Gammeltoft S, Brunak S. 2004. Prediction of post-translational glycosylation and phosphorylation of proteins from the amino acid sequence. Proteomics 4(6):1633–1649. Bunse S, Schmidt M, Hoffmann S, Engelhardt K, Zoidl G, Dermietzel R. 2011. Single cysteines in the extracellular and transmembrane regions modulate pannexin 1 channel function. J Membr Biol 244(1):21–33. Chekeni FB, Elliott MR, Sandilos JK, Walk SF, Kinchen JM, Lazarowski ER, Armstrong AJ, Penuela S, Laird DW, Salvesen GS, Isakson BE, Bayliss DA Ravichandran KS. 2010. Pannexin 1 channels mediate ’find-me’ signal release and membrane permeability during apoptosis. Nature 467(7317):863–867. Dbouk HA, Mroue RM, El-Sabban ME, Talhouk RS. 2009. Connexins: a myriad of functions extending beyond assembly of gap junction channels. Cell Commun Signal 7(4):1–17. Goodenough DA, Paul DL. 2003. Beyond the gap: functions of unpaired connexon channels. Nat Rev Mol Cell Biol 4(4):285–294. Granados RR, Li Gx, Derksen ACG, McKenna KA. 1994. A new insect cell line from Trichoplusia ni (BT1-Tn-5B1-4) susceptible to Trichoplusia ni single enveloped nuclear polyhedrosis virus. J Invertebr Pathol 64:260–266. Guo LE, Zhang JF, Liu XY, Zhang LM, Zhang HL, Chen JH, Xie XG, Zhou Y, Luo K, Yoon J. 2015. Phosphate ion targeted colorimetric and fluorescent probe and its use to monitor endogeneous phosphate ion in a hemichannel-closed cell. Anal Chem 87(2):1196–1201. Huang YJ, Maruyama Y, Dvoryanchikov G, Pereira E, Chaudhari N, Roper SD. 2007. The role of pannexin 1 hemichannels in ATP release and cell-cell communication in mouse taste buds. Proc Natl Acad Sci USA 104(15):6436–6441. Li M, Pang Z, Xiao W, Liu X, Zhang Y, Yu D, Yang M, Yang Y, Hu J, Luo KJ. 2014. A transcriptome analysis suggests apoptosis-related signaling pathways in hemocytes of spodoptera litura after parasitization by microplitis bicoloratus. PLoS One 9(10):e110967. Liu T, Li M, Zhang Y, Pang Z, Xiao W, Yang Y, Luo KJ. 2013. A role for Innexin2 and Innexin3 proteins from Spodoptera litura in apoptosis. PLoS One 8(7):e70456. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25(4):402–408. Luo KJ, Pang Y. 2006. Spodoptera litura multicapsid nucleopolyhedrovirus inhibits Microplitis bicoloratus polydnavirus-induced host granulocytes apoptosis. J Insect Physiol 52(8):795–806. Luo KJ, Trumble JT, Pang Y. 2007. Development of Microplitis bicoloratus on Spodoptera litura and implications for biological control. BioControl 52(3):309–321. Luo KJ, Turnbull MW. 2011. Characterization of nonjunctional hemichannels in caterpillar cells. J Insect Sci 11:6. Marziano NK, Hasegawa DK, Phelan P, Turnbull MW. 2011. Functional Interactions between polydnavirus and host cellular Innexins. J Virol 85(19):10222–10229. Archives of Insect Biochemistry and Physiology
Two Innexins of Spodoptera litura Influences Hemichannel
r
57
Peter C, Wesselborg S, Lauber K. 2010. Apoptosis: opening PANdora’s boX. Curr Biol 20(21): R940–R942. Saez JC, Berthoud VM, Branes MC, Martinez AD, Beyer EC. 2003. Plasma membrane channels formed by connexins: their regulation and functions. Physiol Rev 83(4):1359–1400. Su V, Lau AF. 2012. Ubiquitination, intracellular trafficking, and degradation of connexins. Arch Biochem Biophys 524(1):16–22. Turnbull MW, Volkoff AN, Webb BA, Phelan P. 2005. Functional gap junction genes are encoded by insect viruses. Curr Biol 15(13):R491–R492. Vinken M, Decrock E, Vanhaecke T, Leybaert L, Rogiers V. 2012. Connexin43 signaling contributes to spontaneous apoptosis in cultures of primary hepatocytes. Toxicol Sci 125(1):175–186. Wang N, De Bock M, Decrock E, Bol M, Gadicherla A, Vinken M, Rogiers V, Bukauskas FF, Bultynck G, Leybaert L. 2013. Paracrine signaling through plasma membrane hemichannels. BBA-Biomembranes 1828(1):35–50. Webb BA, Strand MR, Dickey SE, Beck MH, Hilgarth RS, Barney WE, Kadash K, Kroemer JA, Lindstrom KG, Rattanadechakul W, Shelby KS, Thoetkiattikul H, Turnbull MW, Witherell RA. 2006. Polydnavirus genomes reflect their dual roles as mutualists and pathogens. Virology 347(1):160–174. Yeager M, Harris AL. 2007. Gap junction channel structure in the early 21st century: facts and fantasies. Curr Opin Cell Biol 19(5):521–528. Yen MR, Saier MH. 2007. Gap junctional proteins of animals: the innexin/pannexin superfamily. Prog Biophys Mol Bio 94(1–2):5–14. Yin X, Liu J, Jiang JX. 2008. Lens fiber connexin turnover and caspase-3-mediated cleavage are regulated alternately by phosphorylation. Cell Commun Adhes 15(1):1–11. Zhao HB, Yu N, Fleming CR. 2005. Gap junctional hemichannel-mediated ATP release and hearing controls in the inner ear. Proc Natl Acad Sci USA 102(51):18724–18729.
Archives of Insect Biochemistry and Physiology
TWO INNEXINS OF Spodoptera litura INFLUENCES HEMICHANNEL AND GAP JUNCTION FUNCTIONS IN CELLULAR IMMUNE RESPONSES Zunyu Pang∗ , Ming Li∗ , Dongshuai Yu∗ , Zhang Yan, Xinyi Liu, Xinglai Ji, Yang Yang, Jiansheng Hu, and Kaijun Luo School of Life Sciences and Key Laboratory for Animal Genetic Diversity and Evolution of High Education in Yunnan Province, Yunnan University, Kunming, P. R., China
Insect cellular immune responses include encapsulation, nodule formation, and phagocytosis. Hemichannels and gap junctions are involved in these cellular actions. Innexins (Inxs: analogous to the vertebrate connexins) form hemichannels and gap junctions, but the molecular mechanisms underlying their biology is still unclear. In this article, we reported a steady-state level of Inxs (SpliInxs) in hemocytes of Spodoptera litura, which formed nonfunctional hemichannels on the cell surface to maintain normal metabolism. We also reported that two innnexins (SpliInx2 and SpliInx3) were expressed significantly higher in hemocytes compared to other tissues, suggesting that they play important roles in hemocytes. Amino acid analysis found that two cysteine residues in two extracellular loops provided the capability for SpliInx2 and SpliInx3 hemichannels to dock into gap junctions. Western blotting demonstrated that both extracellular and intracellular loops of SpliInx3 and the extracellular loops of SpliInx2 might undergo posttranslational modification during the formation of a steady-state hemichannel. During hemichannel formation, SpliInx2 presented as one isoform, while SpliInx3 presented as three isoforms. These results provide fundamental knowledge for further study of how steady-state ∗ These authors contributed equally to this work. Grant sponsor: National Basic Research Program of China from Major State Basic Research Development Program; Grant number: 2013CB127600, Grant sponsor: Yunnan Department of Science and Technology; Grant number: 2013FA003; Grant sponsor: National Natural Science Foundation of China; Grant numbers: 31260448, 31060251, 31360454, 31160021, and 31270131. Correspondence to: Kaijun Luo, School of Life Sciences, Yunnan University, 2 CuihuBei Road, Kunming 650091, P. R. China, E-mail: [email protected]
ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 90, No. 1, 43–57 (2015) Published online in Wiley Online Library (wileyonlinelibrary.com). C 2015 Wiley Periodicals, Inc. DOI: 10.1002/arch.21243
44
r
Archives of Insect Biochemistry and Physiology, September 2015
levels of SpliInxs are dynamically adjusted to perform cellular immune C 2015 Wiley Periodicals, Inc. responses under immune challenge. Keywords: gap junction protein; innexin; posttranslational modification; Cysteine residue; cellular immune response
INTRODUCTION Insect cellular immune responses include encapsulation, nodulation, and phagocytosis. Gap junctions and hemichannels act in cellular immune reactions. Innexins (Inxs: analogous to the vertebrate connexins) are proteins responsible for forming hemichannels and gap junctions. Formation of hemichannels on the cell surface of lepidopteran hemocytes has been reported, and lipopolysaccharide (LPS) challenge decreases hemichannel function in Heliothis virescens hemocytes (Luo and Turnbull, 2011). Polydnavirus-mediated immunosuppression leads to down-regulation of SpliInx2 and SpliInx3 expressions during granulocyte apoptosis in Spodoptera litura hemocytes (Luo and Pang, 2006; Li et al., 2014). Available evidence indicates that Inxs act in cellular immune responses via hemichannels and gap junctions, although details remain unclear. Our previous study noted that overexpression of SpliInx2 and SpliInx3 activated PI3K-dependent changes in cell physiology (Liu et al., 2013). These changes included promoting apoptosis in Sf9 and Spli221 cell lines (both showing a lower level of phosphorylated Akt and activated caspase 3) and maintenance of a steady-state level of SpliInx2 and SpliInx3 in the High-Five cell line (which presents a high level of phosphorylated Akt and no activated caspase 3) (Liu et al., 2013).Understanding how Inxs maintain a nonfunctional steady state is a key question to address how Inxs regulate cellular immune responses. Insect Inxs belong to the gap junction protein family, which includes the connexins and pannexins of vertebrates and the vinnexins of some viruses (Turnbull et al., 2005; Webb et al., 2006). Gap junctions serve to coordinate cell-to-cell communication within tissues by allowing the transfer of ions, amino acids, and nucleotides, as well as second messengers such as Ca2+ , cAMP, cGMP, and IP3 between cells (Goodenough and Paul, 2003; Saez et al., 2003), thereby affecting cellular behaviors through the activation of paracrine signaling pathways (Wang et al., 2013) via signaling molecules, including ATP, ADP, AMP, and adenosine (Zhao et al., 2005; Huang et al., 2007; Chekeni et al., 2010; Peter et al., 2010). These gap junctions are essentially docking channels formed by two individual hemichannels from two neighboring cells (Yeager and Harris, 2007; Yen and Saier, 2007; Marziano et al., 2011). Based on their constituent domains, hexameric hemichannel proteins are individually named connexon, pannexon, innexon, and vinnexon within their respective organisms. However, invertebrate Inxs are poorly characterized, as most work on this family has been done in vertebrate species. Generally, each of the individual proteins that oligomerizes in the four types of hemichannels shares similar topologies, with four α-helical transmembrane segments (TM), two extracellular loops (EL), an intracellular loop (IL), and intracellular aminoterminus (NT) and carboxyl-terminus (CT). Numerous studies in vertebrates show that connexons are assembled in the Golgi via individual connexin proteins (Su and Lau, 2012). During synthesis, connexin is cotranslationally inserted into the endoplasmic reticulum (ER) membrane, and upon proper folding, is trafficked to the Golgi apparatus and trans Golgi network where it is posttranslationally modified and oligomerizes into hexameric connexons, which are then transported to the plasma membrane (Su and Lau, 2012). Archives of Insect Biochemistry and Physiology
Two Innexins of Spodoptera litura Influences Hemichannel
r
45
In the present study, we analyzed the steady state of SpliInx2 and SpliInx3 in High-Five stable cell lines. We analyzed cysteine, phosphorylation sites, and generated antigenic epitopes of SpliInx2 and SpliInx3 to map out the possibility of forming hemichannels and gap junctions. We also determined that both extracellular and intracellular loops of SpliInx3 as well as extracellular loops of SpliInx2 may undergo posttranslational modification during formation of the steady-state hemichannel. This work provides fundamental knowledge for further study of how steady-state levels of Inxs are dynamically modulated to perform cellular immune responses under immune challenge.
MATERIAL AND METHODS Insect Rearing and Cell Culture A colony of S. litura was reared according to an established method (Luo and Pang, 2006). High-Five (BTI-Tn-5B1-4) adherent cells were derived from Trichoplusia ni embryos (Granados et al., 1994) and cultured in TNM-FH insect culture medium containing 10% fetal bovine serum (FBS, HyClone, Logan, UT, USA). Cells were maintained and passaged in 25-cm2 tissue culture flasks (Corning, NY, Made in China). Wasp Rearing and Parasitization The parasitoid Microplitis bicoloratus colony was maintained on S. litura larvae reared in the laboratory. Adults were also provided with honey as a dietary supplement. Passage of parasitoids was performed according to established methods (Luo et al., 2007). Total RNA Isolation, cDNA Synthesis and qRT-PCR Fourth instar S. litura larvae were used to isolate hemocytes, fat body, midgut, and nervous tissues, while female adults were used to isolate ovarian tissue, and male adults were used to isolate testicular tissue. Total RNA was isolated from each of the collected tissues using RNAiso Plus (TaKaRa, Dalian, China), according to manufacturer’s instructions, including DNase treatment. The concentration and purity of each RNA sample was determined by measuring the optical density (OD) at 260 and 280 nm using a NanoDrop 2000. Samples with an A260/A280 ratio >2.0 were used to synthesize cDNA using OligodT 18 primers following manufacturer’s instructions (TaKaRa). All cDNA samples were stored at –80°C for preservation. qPCR was performed on an ABI 7500 using the following primers: SpliInx2-Q F (5 -CGTTCCGTTTCTTTATCTG-3 ) and SpliInx2-Q R (5 -ACACGCTCCTCTGGCTC-3 ) for a 144-bp product, SpliInx3-Q F (5 -ATCGCATCACATCAGCC-3 ) and SpliInx3Q R (5 -AGGTAATCCAGCAATAGG-3 ) for a 134 bp, with 18S as an endogenous control with 18S-Q F (5 -AGAACTCTGACCAGTGATGGGATG -3 ) and 18S-Q R (5 CTGATTCCCCGTTACCCGTGA -3 ) for a 215 bp product. The 2−࢞࢞CT analysis method was used as reported previously (Livak and Schmittgen, 2001). Prokaryotic Plasmids and Expression SpliInx2 was amplified via PCR, using cDNA as a template with the following primers: SpliInx2 F (5 -GAATTCATGTTTGACGTTTTCGGCT-3 ) and SpliInx2 R Archives of Insect Biochemistry and Physiology
46
r
Archives of Insect Biochemistry and Physiology, September 2015
(5 -GCGGCCGCGTACACACTGTCCTTCCC-3 ) containing EcoR I and Not I sites (underlined). The gene was then directionally cloned into pMD19 (TaKaRa, Dalian, China) and sequenced. A fragment of SpliInx2 was cut and inserted into the prokaryotic expression plasmid pET32a (Novagen, Shanghai, China). This prokaryotic expression vector contains T7 promoters to express a 6His-Inx2-6His fusion protein. The same method was used to produce another construct that expressed a 6His-Inx3-6His fusion protein, using the following primers: SpliInx3 F (5 -GAATTCATGGCGGTATTTGGTTTG G-3 ) and SpliInx3 R (5 -GCGGCCGCATACGTTTCGGTTTC 3 ) containing EcoR I and Not I sites (underlined). A pET32a empty vector served as a negative control, subsequently named pET32a. BL21(DE3) was used as an expression strain. All of the recombinant plasmids were sequenced before expression in bacteria. Eukaryotic Expression and Selection of Stably Transfected SpliInx2-V5, SpliInx3-V5 Fusion Protein in High-Five Cell Lines Transfection was performed as previously described (Liu et al., 2013). In briefly, transfected cells were incubated at 27°C; after 96 h, the transfected cells were resuspended, diluted into TNM-FH 10% FBS medium containing 300-μg/ml Zeocin, and plated in 60-mm dishes at 50% confluence. After 5 days, cell clones stably expressing SpliInx2-V5, SpliInx3-V5, and empty vector (pIZT) attained confluence, and the cells were maintained in TNM-FH medium containing 10% FBS and 300 μg/ml Zeocin in 25 cm2 flasks. Predict Antigenic Epitopes of SpliInx2 and SpliInx3 With or Without Phosphorylation and Generate Polyclonal Antisera NetPhos 2.0 (Blom et al., 1999) and NetPhosK 1.0 (Blom et al., 2004) were used to predict phosphorylation sites and the types of kinases. Two antigens in extracellular loop 1 were chosen for SpliInx2, with and without phosphorylated sites. Another two antigens also with and without phosphorylated sites were chosen in SpliInx3 in the intracellular loop. Rabbit polyclonal antibodies were generated for these peptide antigens by Biocompany (GL Biochem, Shanghai, China). Antisera for the antigenic epitopes RLVGRVGKDVVQAGVA and SHVDGQDEVKYHKYYQ (which contain of S95 and T105 in EL1), were named anti-SpliInx2EL1(94) and anti-SpliInx2EL1(110), respectively. Two other antisera, those for SDGMRGTAASIADDK (containing S143 and S152 in IL) and KNNRLNRLVQYLVDTRHMHNTYS, were named anti-SpliInx3IL(156) and anti-SpliInx3IL(179), respectively. Western Blotting Western blotting was performed as previously described (Liu et al., 2013). Briefly, recombinant SpliInx2-V5 and SpliInx3-V5 fusion proteins were detected with mouse anti-V5 (Invitrogen, Carlsbad, CA, USA) (1:5000) and a goat antimouse horseradish peroxidaseconjugated secondary antibody (Beyotime, Nantong, China) (1:2000). 6His-Inx2-6His and 6His-Inx3-6His fusion proteins were detected with mouse anti-6His antibody (Beyotime, Nantong, China) (1:2000dilution). SpliInx2 extracellular loop 1 was detected with anti-SpliInx2EL(94) and anti-SpliInx2EL1(110) Rabbit (1:500), and SpliInx3 intracellular loop was detected with anti-SpliInx3IL(156) and anti-SpliInx3IL(179), and a goat antirabbit horseradish peroxidase-conjugated secondary antibody (Beyotime, Nantong, Archives of Insect Biochemistry and Physiology
Two Innexins of Spodoptera litura Influences Hemichannel
r
47
Figure 1. High steady-state SpliInx2 and SpliInx3 expression in host Spodoptera litura hemocytes. (A) SpliInx2 and (B) SpliInx3 in different tissues: hemocytes (He), fat body (Fa), midgut (Mi), nerve (Ne), ovary (Ov), and testis (Te). RQ: relative quantification.
China) (1:2000dilution). Bands were visualized via enhanced chemiluminescence (ECL, Beyotime, Nantong, China). Statistical Analysis Statistical analyses were performed using SPSS 16.0 for Windows (SPSS Inc., Chicago, IL, USA). Resulting data were presented as mean ± SEM. One-way ANOVA with SNK’s multiple comparisons were used to assess differences among different tissue types. All assays were repeated at least three times to ensure accuracy.
RESULTS Steady-State SpliInx2 and SpliInx3 Highly Expressed in Host Hemocytes Under immune challenge by the parasitoid M. bicoloratus, the transcription levels of SpliInx2 and SpliInx3 are significantly decreased (Li et al., 2014). We wanted to determine whether SpliInx2 and SpliInx3 are important proteins in hemocytes. We detected mRNA expression in different tissues: hemocytes, fat body, midgut, nerve, ovary, and testitis. However, their mRNA profiles were quite different. The expression levels of SpliInx2 and SpliInx3 in hemocytes and ovarian tissues were significantly higher than those in the other four tissues (P < 0.001) (Fig. 1), but the mRNA levels of SpliInx2 and SpliInx3 in testis, fat body, midgut, and nerve tissues were not significantly different. Overall, SpliInx2 and SpliInx3 were distributed broadly but were more highly expressed in hemocytes and ovarian tissues. The high expression in hemocytes suggested that SpliInx2 and SpliInx3 play an important role in cellular immune responses. SpliInx2 and SpliInx3 Cysteine Residues in the two Extracellular Loops Previous observations have documented that hemichannels and gap junctions are present in hemocytes, and SpliInx2 and SpliInx3 have been cloned from hemocytes (Liu et al., 2013). Cysteine residues are the hallmark of canonical gap junction proteins as a regulator via forming disulfide bonds. Connexins (Cxs) contain three cysteine residues, pannexin1 Archives of Insect Biochemistry and Physiology
48
r
Archives of Insect Biochemistry and Physiology, September 2015
(Px1) contains two, and Inxs contain two (Barbe et al., 2006). We found that a key feature of SpliInx2 and SpliInx3was two cysteine residues within two extracellular loops (EL1 and EL2). The space between the two conserved cysteines (C) was CX13 C for SpliInx2 andCX14 C for SpliInx3 in EL1, and CX17 C for both SpliInx2 and SpliInx3 in EL2. Moreover, the amino acids around the cysteine were conserved between the different Inx family members (Fig. 2). These results suggest that the cysteine residues of SpliInx2 and SpliInx3 provide the fundamental disulfide-linked ELs to allow docking of two hemichannels to generate a gap junction channel. SpliInx2 and SpliInx3 Phosphorylation Sites and Protein Kinases Inxs are known to form hemichannels, with the majority of phosphorylation events occurring on serine (S), although tyrosine phosphorylation has also been observed (Bauer et al., 2005). In this study, we noted nine phosphorylation sites in SpliInx2 and 12 phosphorylation sites in SpliInx3. S7 was located at the N-terminal (NT) of SpliInx2; while S67, S95, and S105 were in EL1; S207 and S215 were in internal loop (IL); S268 was in EL2; and S358 was in the C-terminal (CT). In SpliInx3, S86 was in NT; S143 was in EL1; S152 was in IL; S219 and S238 were in EL; S366 was in CT. In SpliInx2, S95 and Y105, no putative kinases were identified, but in SpliInx3, S143 and S152 had putative kinases, PKA/PKG and CKI/PKC, respectively (Table 1). These results suggested that serine phosphorylation sites and respective protein kinases provided the fundamental sites of posttranslational modification, and SpliInx2 and SpliInx3 might be modified and joined to the membrane to form hemichannels on the cell surface. EL1 of SpliInx2 and, EL1 and EL2 of SpliInx3 Were Potentially Modified at Posttranslational During Assembly of Innexon In order to examine posttranslational modification of SpliInx2, we used the High-Five cell line to stably express the target genes and to guarantee transport of the products from Golgi to membrane and subsequent insertion into the cell membrane. EL1 of SpliInx2 was detected by anti-SpliInx2EL1(94) (Fig. 3C) and anti-SpliInx2EL1(110) (Fig. 4B) from the bacterial lysate. 6His antibody served as a control for the recombinant protein expressed in the bacterial system (Fig. 3A).However, in eukaryotic expression, both antibodies failed to detect EL1, and the CT-V5 antibody only could identify SpliInx2 (Figs. 3B, 4A). Comparing the expression products between eukaryotic and prokaryotic systems, SpliInx2 presented only one isoform in both. Interestingly, the V5-antibody also showed that SpliInx2 was present, albeit quite weakly, during degradation. Collectively, these results suggested that SpliInx2 might undergo a posttranslational modification in EL1 domain. To identify the specificity of EL1 antibodies, we also compared the results of SpliInx2 with SpliInx3 using the same antibodies. We found that anti-SpliInx2EL1(94) could identify SpliInx3 weakly, but that anti-SpliInx2EL(110) could strongly bind to SpliInx3 in prokaryotic expression. The ability of anti-SpliInx2EL(110) to identify SpliInx2 and SpliInx3 in prokaryotic expression was expected, since this antibody recognizes the three amino acids YYQ, which are hallmarks of SpliInxs. We also aligned sequences of anti-SpliInx2EL1(110) with SpliInx3, and a similar sequence, X1 HX3 GX5 EX3 HX1 YYQ in AHPGLGNDFEEEKRIHAYYQ (from 92–111 in EL1 of SpliInx3) was found, confirming that anti-SpliInx2EL(110) was able to identify EL1 of both SpliInx2 and SpliInx3, and most likely other Inxs that also contain the natural hallmark “YYQ.” We further aligned sequences of anti-SpliInx2EL1(94) with SpliInx3, and found a Archives of Insect Biochemistry and Physiology
Two Innexins of Spodoptera litura Influences Hemichannel
r
49
Figure 2. Multiple alignments among the two Spodoptera litura innexin proteins and seven Drosophila melanogaster innexin proteins. The multiple alignment was performed using ClustalW. The sequence numbers are labeled on the right. "*" represents identical residues; ":" represents conserved substitutions; "." represents semiconserved substitutions. Transmembrane domains (TMs) are shown in yellow. The TMs of the two S. litura innexin proteins were identified using the TMHMM in InterProScan. The TMs of the other proteins came from a previous study. Green is used to identify the cysteine residues that are present within the extracellular loops (ELs). Compared to the other proteins, DmInx4 has additional cysteine residues. Red letters indicate the innexin protein’s putative phosphorylation sites as determined by the NetPhos 2.0 server. The kinase specificity was analyzed with the NetPhosK 1.0 server. The class I and II PDZ motifs are shown in brown and purple, respectively. Archives of Insect Biochemistry and Physiology
50
r
Archives of Insect Biochemistry and Physiology, September 2015
Table 1. Predicted phosphorylation sites of two Spodoptera litura innexin proteins. The phosphorylation sites were predicted in NetPhos 2.0 server. The kinase specificity was analyzed in NetPhosK 1.0 server Protein
Amino Acid Position
Type
Content (Score)
Type of Kinase (Score) PKC (0.63) PKA (0.56) CKI (0.53) CKII (0.65) INSR (0.50) P38MAPK (0.54), GSK3 (0.51), cdk5 (0.50) PKA (0.85), PKG (0.51) CKI (0.50), PKC (0.54) PKC (0.55) cdc2 (0.53) PKC (0.52) GSK3 (0.51), cdk5 (0.54) -
SpliInx2 SpliInx 2 SpliInx 2 SpliInx 2 SpliInx 2 SpliInx 2 SpliInx 2 SpliInx 2 SpliInx 2 SpliInx 3
7 (NT) 95 (EL1) 157 (EL2) 207 (IL) 215 (IL) 358 (CN) 67 (EL1) 105 (EL1) 268 (EL2) 86 (NT)
serine serine serine serine serine serine tyrosine tyrosine tyrosine serine
DVFGSVKGL (0.673) AGVASHVDG (0.769) ECKDSRKKL (0.983) DGEFSTYGS (0.840) SDVVSFTEM (0.981) EGKDSV— (0.514) VMDTYCWIY (0.872) DEVKYHKYY (0.937) NEKIYVFLW (0.865) TLPNSPARG (0.950)
SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3 SpliInx 3
143 (EL1) 152 (IL) 219 (EL2) 299 (CT) 366 (CT) 238 (EL2) 303 (CT) 313 (CT) 324 (CT) 374 (CT) 380 (CT)
serine serine serine serine serine threonine threonine threonine threonine tyrosine tyrosine
VRMISDGMR (0.752) GTAASIADD (0.987) VVKFSNMNQ (0.843) ILLPSTRET (0.974) PSAPSTLEM (0.919) FPRLTKCTF (0.935) STRETILKR (0.714) FRFGTPAGV (0.962) LVRKTQVGD (0.770) MAPIYPNID (0.853) NIDKYAKET (0.703)
similar sequence, X3 GX6 GX1 DVVX6 in TFLGGAFLTYGTDVVKF (from 202–222 in EL2 of SpliInx3, near the serine phosphorylation site 219 (EL2) in Table 1), suggesting that anti-SpliInx2EL1(94) was able to identify SpliInx3 extracellular loop2. However, neither antibody could identify SpliInx3 in eukaryotic expression (Figs. 3B, 4A). Despite antiSpliInx2EL1(94), not anti-SpliInx2EL1(110) (S95 and Y105) having no phosphorylation sites, neither could identify EL1 in eukaryotic expression. These results suggested that SpliInx3 might undergo a posttranslational modification in EL1 and EL2 domains. IL of SpliInx3, and EL2 of SpliInx2 Were Potentially Modified at Posttranslational Level During Assembly of Steady-State Innexon Based on the phosphorylation sites, antigenic epitopes with and without phosphorylation sites in intracellular loop were used to generate polyclonal antisera. The intracellular loop of SpliInx3 could be identified by anti-SpliInx3IL(179) (Fig. 6B) but not antiSpliInx3IL(156) in prokaryotic expression. In eukaryotic expression, these antibodies failed to identify IL, with the exception of the CT-V5 antibody (Figs. 5A, 6A). SpliInx3 presents two bands in prokaryotic expression, in which the band lower than 59 kDa is from alternate translation initiation from an AUG codon approximately 90 nt into SpliInx3 (Liu et al., 2013). In the present study, we demonstrated that this was NT-missing SpliInx3 (though we cannot confirm missing amino acids from 1–27 or 1–31, due to other AUGs nearby). Collectively, the accumulated data suggested that SpliInx3 presented 3 isoforms SpliInx3, modified SpliInx3, and NT-missing SpliInx3 and might undergo a posttranslational modification in IL domain. Archives of Insect Biochemistry and Physiology
Two Innexins of Spodoptera litura Influences Hemichannel
r
51
Figure 3. Antigenic epitope without phosphorylation site in extracellular loop1 (EL1) (94) of SpliInx2. (A) Construction of prokaryotic expression plasmids, with expression 6His fusion proteins. (B) Western blot of EL1 (EL1 94-antibody) and carboxyl termini (CT) (V5-antibody) of SpliInxs in eukaryotic expression from the insect High Five cells. Tubulin served as loading control. (C) Western blots of EL1 and CT (6His-antibody) including N termini (NT) of Spliinxs in prokaryotic expression from Escherichia coli BL21(ED3). GADPH served as loading control.
To identify specific IL antibodies, we also compared the results of SpliInx3 with SpliInx2 using the same antibodies. Unexpectedly, anti-SpliInx3IL(156) was able to identify SpliInx2 specifically in prokaryotic expression (Fig. 5C), but not in eukaryotic expression (Fig. 5B). We aligned sequences of anti-SpliInx3IL(156) with SpliInx2, and found similarity in the sequences, X1 DGX7 IX3 K compared with FDGLCVLPLNIVNEK (from 252–266 in EL2 of SpliInx2, also nearby tyrosine phosphorylation sites 268 (EL2) in Table 1), Archives of Insect Biochemistry and Physiology
52
r
Archives of Insect Biochemistry and Physiology, September 2015
Figure 4. Antigenic epitope with two phosphorylation sites and conserved YYQ motif in extracellular loop1 (EL1) (110) of SpliInx2. (A) Western blot of EL1 (EL1 110-antibody) and carboxyl termini (CT) (V5-antibody) of SpliInxs in eukaryotic expression from insect High-Five cells. Tubulin served as loading control. (B) Western blots of EL1 and CT (6His-antibody) including N termini (NT) of SpliInxs in prokaryotic expression from Escherichia coli BL21(ED3). GADPH served as loading control.
suggesting that anti-IL(156) might identify SpliInx2 extracellular loop2 in prokaryotic expression. Anti-SpliInx3IL(156) contained two phosphorylation sites, but it was still unable to identify SpliInx2 eukaryotic expression. These results suggest that SpliInx2 undergoes a posttranslational modification in EL1 domain.
DISCUSSION Insect cellular immune responses require hemocytes to perform encapsulation, nodule formation, and phagocytosis. Hemichannels and gap junctions are likely to be involved in these cellular actions. In this study, we reported a steady-state level of SpliInxs in hemocytes, which formed a nonfunctional hemichannel on the cell surface to maintain normal metabolism. Our results demonstrated that SpliInx2 and SpliInx3 were highly expressed in the host hemocytes. We reported that nascent SpliInxs formed steady-state Archives of Insect Biochemistry and Physiology
Two Innexins of Spodoptera litura Influences Hemichannel
r
53
Figure 5. Antigenic epitope with two phosphorylation sites in the intracellular loop1 (IL) (156) of SpliInx3. (A) Western blot of IL (156) and carboxyl termini (CT) (V5-antibody) of SpliInxs in eukaryotic expression from insect High Five cells. Tubulin served as loading control. (B) Western blots of EL1 and CT (6His-antibody) including N termini (NT) of SpliInxs in prokaryotic expression from Escherichia coli BL21(ED3). GADPH served as loading control.
hemichannels on the cell membrane. During assembly of the steady-state hemichannels, both EL and IL of SpliInx3 as well as EL of SpliInx2 underwent posttranslational modification. This is the first paper to define a nonfunctional steady state of Inxs, which will contribute to further understanding of the functional hemichannels and gap junctions in cellular immune responses. First, we found that SpliInx2 and SpliInx3 were highly expressed in hemocytes and ovaries compared with fat body, midgut, and nerve tissues of larvae, and also in the testes of adult insects (Fig. 1). The steady-state expression of Inxs in the hemocytes from Heliothis virescens present intermittently open hemichannels (Luo and Turnbull, 2011). This report was followed up by the isolation of SpliInx2 and SpliInx3 from hemocytes of S.litura (Liu et al., 2013). These two reports provide the initial evidence that steadystate hemichannels are present on the hemocyte surface. According to our data, under immune challenge, polydnavirus-mediated immunosuppression leads to down regulation of SpliInx2 and SpliInx3 expression during granulocyte apoptosis in S. litura hemocytes Archives of Insect Biochemistry and Physiology
54
r
Archives of Insect Biochemistry and Physiology, September 2015
Figure 6. Antigenic epitope with and without phosphorylation site in intracellular loop1 (IL)(179) of SpliInx3. (A) Western blot of IL (179) and Carboxyl termini (CT) (V5-antibody) of SpliInxs in eukaryotic expression from insect High Five cells. Tubulin served as loading control. (B) Western blots of EL1 and CT (6Hisantibody) including N termini (NT) of SpliInxs in prokaryotic expression from Escherichia coli BL21(ED3). GADPH served as loading control.
(Li et al., 2014), and recombinant baculovirus infection results in hemichannel-closed Sf9 cells (Guo et al., 2015). These results suggested that steady-state hemichannel could be disrupted during cellular immune responses and raise the question of what mechanisms controls steady-state hemichannel formation? Recent studies have found a series of complex translational and posttranslational mechanisms that regulate gap junction synthesis, maturation, membrane, transport, and degradation, which in turn modulate intercellular communication via gap junction (Dbouk et al., 2009). For connexins, these phosphorylation events are essential for proper control of the formation and modulation of gap junction channel function, since connex in phosphorylation by different kinases (e.g., Src, PKA/PKC/PKG, and MAPKs) is both required and affects connexin/connexon trafficking, assembly and disassembly, degradation, and gating of gap junction channel. In S. litura, PKA/PKG are involved in phosphorylation of Serine 143 of SpliInx3, and CKI/PKC are involved in phosphorylation of Serine 152 (Table 1). These results suggested that serine phosphorylation sites through their respective protein kinases provide the fundamental sites of posttranslational modification, and SpliInx2 and SpliInx3 may be posttranslationally modified and inserted into the cell membrane to form hemichannels on the cell surface. Furthermore, we detected the phosphorylation of serine 143/152 in the IL of SpliInx3 via anti-SpliInx3IL(156) and anti-SpliInx3IL(179) and found that two types of antigen Archives of Insect Biochemistry and Physiology
Two Innexins of Spodoptera litura Influences Hemichannel
r
55
exhibited no specific bindings in the eukaryotic system compared with prokaryotic system. These results supported that posttranslational modification might occur similar to those known in connexin, e.g., phosphorylation. We still a need specific assay to identify phosphorylation exactly happened in Inx3 during forming a steady state on the cell surface. After various cell signaling events, hemichannels dock to form gap junction channels. In mammals, mutation of the extracellular cysteine of Cx43 eliminates gap junction formation without altering hemichannel formation (Bao et al., 2004), while with Px, which forms only hemichannels without gap junctions, substitution of extracellular cysteines does not change localization in the cell membrane nor causes loss of voltage gating (Bunse et al., 2011). We uncovered a biochemical basis for this possibility by demonstrating that SpliInx2 and SpliInx3 contain two cysteine residues in the ELs that can be used to form gap junctions. These results suggest that the cysteine residues of SpliInx2 and 3 provide the fundamental disulfide-linked ELs for the ability of Inxs to dock two hemichannels to generate a gap junction channel. Compared with DmInx2 and DmInx3, both SpliInx2 and SpliInx3 have the same cysteine spacing, implying they might also possess the ability to form gap junctions (Fig. 2). The concept of the steady-state Inxs help explain why overexpression of SpliInx2 and SpliInx3 lead to multiple changes in cell physiology. Recently it was reported that SpliInx2 and SpliInx3present a functional hemichannel that promotes apoptosis in insect cell types already showing a low level of cell death; curiously, this is not happen in stable state in High-Five cells, which has an activated pI3K/Akt signaling pathway (Liu et al., 2013). The concept of steady-state Inxs helps us to answer this question: the steady state of SpliInx2 and SpliInx3 shows nonfunction, like in High-Five cells; and unsteady-state of SpliInx2 and SpliInx3 shows function, like in Sf9 and Spli221 cells. This result serves as a strong indicator that hemichannels are not activators that induce apoptosis, but only function as promoters of apoptosis. A similar result was previously found for Cx43 (Vinken et al., 2012). Caspase3 cleavage of connexin has been observed with Cx45.6 C-terminal in lens (Yin et al., 2008). Taken together, we concluded that although the hemichannels remained at a steady state on the cell membrane, they require a trigger to alter its state, leading to functional activation. Finally, we confirmed that SpliInx2 only presented a single isoform, and SpliInx3 presented 3 isoforms during steady-state process in vitro. In conclusion, our findings demonstrated that SpliInx2 and SpliInx3 were highly expressed in host hemocytes and formed a steady-state hemichannel to maintain normal metabolism. The cysteine residues provided the fundamental disulfide-linked ELs for Inxs potential for docking two hemichannels to generate a gap junction channel. The serine phosphorylation sites and respective protein kinases provided the fundamental sites of posttranslational modification, and joined to the membrane to form hemichannels in the cell surface. Both extracellular and intracellular loops of SpliInx3 as well as extracellular loops of SpliInx2 might undergo posttranslational modification during steady-state hemichannel assembly. This finding might have implications for better understanding of the mechanism underlying cellular immune responses via disrupting the steady state of hemichannels on the cell surface. However, analysis of the disruption of the steady-state hemichannels under immune challenge should involve three levels in hemocytes: transcriptional regulation of Inxs mRNA expression, protein translation, and protein posttranslational modification to reduce steady-state hemichannels or to trigger opening/closing of hemichannels on the cell surface. However, the role of the functional hemichannels on the cell membrane remains to be elucidated. Archives of Insect Biochemistry and Physiology
56
r
Archives of Insect Biochemistry and Physiology, September 2015
LITERATURE CITED Bao X, Chen Y, Reuss L, Altenberg GA. 2004. Functional expression in Xenopus oocytes of gapjunctional hemichannels formed by a cysteine-less connexin 43. J Biol Chem 279(11):9689– 9692. Barbe MT, Monyer H, Bruzzone R. 2006. Cell-cell communication beyond connexins: the pannexin channels. Physiology (Bethesda) 21:103–114. Bauer R, L¨oer B, Ostrowski K, Martini J, Weimbs A, Lechner H, Hoch M. 2005. Intercellular communication: the Drosophila Innexin multiprotein Family of Gap Junction Proteins. Chem Biol 12(5):515–526. Blom N, Gammeltoft S, Brunak S. 1999. Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J Mol Biol 294(5):1351–1362. Blom N, Sicheritz-Ponten T, Gupta R, Gammeltoft S, Brunak S. 2004. Prediction of post-translational glycosylation and phosphorylation of proteins from the amino acid sequence. Proteomics 4(6):1633–1649. Bunse S, Schmidt M, Hoffmann S, Engelhardt K, Zoidl G, Dermietzel R. 2011. Single cysteines in the extracellular and transmembrane regions modulate pannexin 1 channel function. J Membr Biol 244(1):21–33. Chekeni FB, Elliott MR, Sandilos JK, Walk SF, Kinchen JM, Lazarowski ER, Armstrong AJ, Penuela S, Laird DW, Salvesen GS, Isakson BE, Bayliss DA Ravichandran KS. 2010. Pannexin 1 channels mediate ’find-me’ signal release and membrane permeability during apoptosis. Nature 467(7317):863–867. Dbouk HA, Mroue RM, El-Sabban ME, Talhouk RS. 2009. Connexins: a myriad of functions extending beyond assembly of gap junction channels. Cell Commun Signal 7(4):1–17. Goodenough DA, Paul DL. 2003. Beyond the gap: functions of unpaired connexon channels. Nat Rev Mol Cell Biol 4(4):285–294. Granados RR, Li Gx, Derksen ACG, McKenna KA. 1994. A new insect cell line from Trichoplusia ni (BT1-Tn-5B1-4) susceptible to Trichoplusia ni single enveloped nuclear polyhedrosis virus. J Invertebr Pathol 64:260–266. Guo LE, Zhang JF, Liu XY, Zhang LM, Zhang HL, Chen JH, Xie XG, Zhou Y, Luo K, Yoon J. 2015. Phosphate ion targeted colorimetric and fluorescent probe and its use to monitor endogeneous phosphate ion in a hemichannel-closed cell. Anal Chem 87(2):1196–1201. Huang YJ, Maruyama Y, Dvoryanchikov G, Pereira E, Chaudhari N, Roper SD. 2007. The role of pannexin 1 hemichannels in ATP release and cell-cell communication in mouse taste buds. Proc Natl Acad Sci USA 104(15):6436–6441. Li M, Pang Z, Xiao W, Liu X, Zhang Y, Yu D, Yang M, Yang Y, Hu J, Luo KJ. 2014. A transcriptome analysis suggests apoptosis-related signaling pathways in hemocytes of spodoptera litura after parasitization by microplitis bicoloratus. PLoS One 9(10):e110967. Liu T, Li M, Zhang Y, Pang Z, Xiao W, Yang Y, Luo KJ. 2013. A role for Innexin2 and Innexin3 proteins from Spodoptera litura in apoptosis. PLoS One 8(7):e70456. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25(4):402–408. Luo KJ, Pang Y. 2006. Spodoptera litura multicapsid nucleopolyhedrovirus inhibits Microplitis bicoloratus polydnavirus-induced host granulocytes apoptosis. J Insect Physiol 52(8):795–806. Luo KJ, Trumble JT, Pang Y. 2007. Development of Microplitis bicoloratus on Spodoptera litura and implications for biological control. BioControl 52(3):309–321. Luo KJ, Turnbull MW. 2011. Characterization of nonjunctional hemichannels in caterpillar cells. J Insect Sci 11:6. Marziano NK, Hasegawa DK, Phelan P, Turnbull MW. 2011. Functional Interactions between polydnavirus and host cellular Innexins. J Virol 85(19):10222–10229. Archives of Insect Biochemistry and Physiology
Two Innexins of Spodoptera litura Influences Hemichannel
r
57
Peter C, Wesselborg S, Lauber K. 2010. Apoptosis: opening PANdora’s boX. Curr Biol 20(21): R940–R942. Saez JC, Berthoud VM, Branes MC, Martinez AD, Beyer EC. 2003. Plasma membrane channels formed by connexins: their regulation and functions. Physiol Rev 83(4):1359–1400. Su V, Lau AF. 2012. Ubiquitination, intracellular trafficking, and degradation of connexins. Arch Biochem Biophys 524(1):16–22. Turnbull MW, Volkoff AN, Webb BA, Phelan P. 2005. Functional gap junction genes are encoded by insect viruses. Curr Biol 15(13):R491–R492. Vinken M, Decrock E, Vanhaecke T, Leybaert L, Rogiers V. 2012. Connexin43 signaling contributes to spontaneous apoptosis in cultures of primary hepatocytes. Toxicol Sci 125(1):175–186. Wang N, De Bock M, Decrock E, Bol M, Gadicherla A, Vinken M, Rogiers V, Bukauskas FF, Bultynck G, Leybaert L. 2013. Paracrine signaling through plasma membrane hemichannels. BBA-Biomembranes 1828(1):35–50. Webb BA, Strand MR, Dickey SE, Beck MH, Hilgarth RS, Barney WE, Kadash K, Kroemer JA, Lindstrom KG, Rattanadechakul W, Shelby KS, Thoetkiattikul H, Turnbull MW, Witherell RA. 2006. Polydnavirus genomes reflect their dual roles as mutualists and pathogens. Virology 347(1):160–174. Yeager M, Harris AL. 2007. Gap junction channel structure in the early 21st century: facts and fantasies. Curr Opin Cell Biol 19(5):521–528. Yen MR, Saier MH. 2007. Gap junctional proteins of animals: the innexin/pannexin superfamily. Prog Biophys Mol Bio 94(1–2):5–14. Yin X, Liu J, Jiang JX. 2008. Lens fiber connexin turnover and caspase-3-mediated cleavage are regulated alternately by phosphorylation. Cell Commun Adhes 15(1):1–11. Zhao HB, Yu N, Fleming CR. 2005. Gap junctional hemichannel-mediated ATP release and hearing controls in the inner ear. Proc Natl Acad Sci USA 102(51):18724–18729.
Archives of Insect Biochemistry and Physiology
