Comparative Biochemistry and Physiology, Part B 171 (2014) 34–41

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Two arginine kinases of Tetrahymena pyriformis: Characterization and localization Juri Michibata a, Noriko Okazaki a, Shou Motomura a, Kouji Uda a, Shigeki Fujiwara b, Tomohiko Suzuki a,⁎ a b

Laboratories of Biochemistry, Faculty of Science, Kochi University, Kochi 780-8520, Japan Cellular and Molecular Biotechnology, Faculty of Science, Kochi University, Kochi 780-8520, Japan

a r t i c l e

i n f o

Article history: Received 27 February 2014 Received in revised form 31 March 2014 Accepted 31 March 2014 Available online 12 April 2014 Keywords: Arginine kinase Subcellular localization Myristoylation Phosphoarginine shuttle Tetrahymena pyriformis

a b s t r a c t Two cDNAs, one coding a typical 40-kDa arginine kinase (AK1) and the other coding a two-domain 80-kDa enzyme (AK2), were isolated from ciliate Tetrahymena pyriformis, and their recombinant enzymes were successfully expressed in Escherichia coli. Both enzymes had an activity comparable to those of typical invertebrate AKs. Interestingly, the amino acid sequence of T. pyriformis AK1, but not AK2, had a distinct myristoylation signal sequence at the N-terminus, suggesting that 40-kDa AK1 targets the membrane. Moreover, Western blot analysis showed that the AK1 is mainly localized in the ciliary fraction. Based on these results, we discuss the phosphoarginine shuttle, which enables a continuous energy flow to dynein for ciliary movement in T. pyriformis, and the role of AK1 in this model. © 2014 Elsevier Inc. All rights reserved.

1. Introduction Phosphagen kinases (PKs), typically creatine kinase (CK; EC 2.7.3.2), play a key role in ATP buffering systems in animal cells that have high and variable rates of ATP turnover by catalyzing the reversible transfer of the γ-phosphoryl group of ATP to guanidine substrate yielding ADP and a phosphorylated guanidine or phosphagen (Morrison, 1973; Ellington, 2001). In vertebrates CK is the only PK, but in nonvertebrates various PKs such as glycocyamine kinase (GK; EC 2.7.3.1), taurocyamine kinase (TK; EC 3.7.3.4), hypotaurocyamine kinase (HTK; EC 2.7.3.6), lombricine kinase (LK; EC 2.7.3.5) and arginine kinase (AK; EC 2.7.3.3), in addition to CK. Phylogenetically, PKs are separated into two distinct groups: the AK group and the CK group. The enzymes typically consist of a subunit with a molecular mass of 40-kDa, but contiguous dimers or trimers have emerged several times during evolution as a result of gene duplication and subsequent fusion (Wothe et al., 1990; Suzuki et al., 1997, 1998). CK is distributed in many protostome and deuterostome invertebrates (Ellington and Suzuki, 2006), and the three extant CK isoforms, a cytoplasmic form (dimeric), a mitochondrial form (octameric) and a flagellar form (Wothe et al., 1990; Qin et al., 1998; Suzuki et al., 2004) are well characterized. The mitochondrial isoform contains a sequence

Abbreviations: PK, phosphagen kinase; AK, arginine kinase; CK, creatine kinase. ⁎ Corresponding author. E-mail address: [email protected] (T. Suzuki).

http://dx.doi.org/10.1016/j.cbpb.2014.03.008 1096-4959/© 2014 Elsevier Inc. All rights reserved.

of ~15 residues at N-terminus targeting to mitochondria, and the flagellar isoform has a myristoylation signal at the N-terminus (Quest et al., 1992). AK is the most widely distributed PK among nonvertebrates. Although its occurrence is intermittent, the gene has also been identified in unicellular organisms, protists and bacteria, suggesting an ancient origin of AK (Uda et al., 2006; Andrews et al., 2008; Bragg et al., 2012; Suzuki et al., 2013). To the best of our knowledge, AK activity has been observed in the protist genera Tetrahymena and Paramecium (Ciliophora) (Watts and Bannister, 1970; Noguchi et al., 2001), Trypanosoma (Sarcomastigophora) (Pereira et al., 2000), Monosiga (Choanozoa) (Conejo et al., 2008) and Emiliania (Haptophyta) (Hoshijima et al., unpublished data). Here it should be noted that Trypanosoma AK is apparently homologous with arthropod AKs, and its phylogenetic position falls unambiguously in the arthropod AK cluster. This is an example typical of horizontal transfer of the AK gene (Pereira et al., 2000), since arthropods are thought to have been primary early hosts of Trypanosoma. Recently, a novel TK has been found in the protists Phytophthora infestans (Uda et al., 2013) and Phytophthora sojae (Palmer et al., 2013). This was the first PK, other than AK, to be found in unicellular organisms, suggesting flexible substrate specificity in PK enzymes. We found two putative AK genes in the genome of Tetrahymena thermophila; one is a typical AK with a 40-kDa subunit (AK1) and the other is an unusual two-domain AK2 having an 80-kDa contiguous dimer, which appears to be the result of gene duplication and subsequent fusion (Uda et al., 2006). In 1970, Watts and Bannister had

J. Michibata et al. / Comparative Biochemistry and Physiology, Part B 171 (2014) 34–41

reported that Tetrahymena pyriformis contains a dimeric AK, which is now assumed to be the two-domain AK2. The role of CK in the “phosphocreatine shuttle” system in the flagellum of sea urchin sperm is well characterized (Tombes and Shapiro, 1985; Tombes et al., 1987; Tombes and Shapiro, 1989; Wothe et al., 1990; Quest et al., 1992). The gene for the flagellar CK has been isolated and shown to have an unusual three-domain structure (contiguous trimer). Its N-terminus is myristoylated, and the flagellar CK is likely to be associated with flagellar membrane. On the other hand, Noguchi et al. (2001) demonstrated that the “phosphoarginine shuttle” plays a key role in continuously supplying energy for ciliary beating in the ciliate Paramecium caudatum. Although the key enzyme AK in the phosphoarginine shuttle has not been isolated yet, they estimated recently the effective concentration of AK in cilia of living P. caudatum to be about 10 mM (Kutomi et al., 2012). A similar shuttle system has been proposed in the flagellum of horseshoe crab sperm (Strong and Ellington, 1993). The purpose of this study is to clarify the function of the two AKs in the “phosphoarginine shuttle” system in the cilia of Tetrahymena pyriformis. In this paper, we isolated the two cDNAs coding the AKs (AK1 and AK2) from T. pyriformis and determined the kinetic parameters of the recombinant enzymes. Western blot analysis showed that the AK1 is localized in the cilia. Since the AK1 has a distinct myristoylation signal in its N-terminus, AK1 is likely to be associated with ciliary membrane through the myristate (a C14-saturated fatty acid). Based on these findings, we discuss the “phosphoarginine shuttle” system in the cilia of T. pyriformis, focusing on the significance of the two AKs.

2. Materials and methods 2.1. Total RNA isolation and cDNA synthesis T. pyriformis was grown axenically at 25 °C in 2% proteose peptone (Difco, MI, USA) supplemented with 10 μM FeCl3 and 25 μg/mL kanamycin (Watson and Hopkins, 1961; William, 1995). The Tetrahymena pyriformis cultures (100 mL) were harvested by centrifugation at 2000 ×g for 30 min. Total RNA was isolated using a High Pure RNA Tissue Kit (Roche, Mannheim, Germany), and mRNA was purified using poly (A)+ isolation kit (Nippon Gene, Tokyo, Japan). Single-stranded cDNA was synthesized with Ready-To-Go You-Prime First-Strand Beads (Amersham Pharmacia Biotech, NJ, USA) with a lock-docking oligo-dT primer with Sma I and Bam HI sites (5′-CCCGGGATCCT17VN) (Borson et al., 1992).

2.2. The cDNA amplification, sequence determination and cloning of AKs The central regions of the cDNAs for both of T. pyriformis AK1 and two-domain AK (AK2) were amplified using the redundant primers, T.PK.conF1 (5′-CAYTWYYTNTTYAARGARGGNGA) and T.PK.conR3 (5′-TCNSWRTGYTCNCCRTSDATNCC), designed from the genomic sequences of T. thermophila AKs. The amplified products (350 bp) were subcloned into pGEM-T Easy vector (Promega, WI, USA) and sequenced. The 3′-regions of the cDNA were then amplified using the oligo-dT primer and specific primers, T.p-AK1-F2 (5′- CTTACTCTCTAAGGATATGGCTACC) for AK1 and T.p2DAKD2-F1 (5′- TTGCGGCTGTGAACGTGACTGGCCTG) for AK2, designed from the sequences of the central regions. A poly (G)+ tail was added to the 3′ end of the T. pyriformis cDNA pool with terminal deoxynucleotidyl transferase (Promega, WI, USA). Using the cDNA pool, the 5′-regions of the cDNA were amplified using the oligo-dC primer with Bam HI site (5′-GGATC17) and specific primers, T.p-AK1R1 (5′-CCACCGTTTTGCATAGAGATGACTC) for AK1 and T.p-2DAKD2R2 (5′-CAGGCCAGTCACGTTCACAGCCGCAA) for AK2. The amplified products were purified, subcloned in the pGEM and sequenced.

35

The open reading frames (ORFs) of T. pyriformis AK1 and AK2 were amplified using specific primer sets, T.p AKI-cF2-Nde (5′-CCATA TGGGTTGCAGCAATTCC, Nde I site underlined) and T.p AKI-cR2-H6 (5′-GAAGCTTA(GTG)6ATGAGAAGCATGAGCGTG, 6xHis-tag and Hind III site underlined) for AK1, or T.p-2DAKcF1-2 (5′-CCATATGATCCCTGTCTGCCTTTTAATCG, Nde I site underlined) and T.p-2DAK-D2H6 (5′-GGGATCCTA(GTG) 6GTTAGATTCAGCTCTG AGGGACTTTTCG, 6xHis-tag and Bam HI site underlined) for AK2, subcloned into the pGEM and sequenced. 2.3. Replacement of TAA and TAG codons for glutamine with universal codons in T. pyriformis AK cDNA The prokaryotic protein expression host Escherichia coli uses the standard genetic code while T. pyriformis uses an alternative genetic code where TAA and TAG code for glutamine instead of a stop codon. Thus, we replaced a TAA codon in AK1 with CAA, and two TAA and three TAG codons in AK2 with CAA and CAG, respectively, by PCRbased mutagenesis as described previously (Suzuki et al., 2000). 2.4. Cloning into the pET30b and expression of T. pyriformis AKs in E. coli The T. pyriformis AK1 cDNA in pGEM plasmid was digested with Nde I and Hind III and cloned into Nde I/Hind III site of the pET30b. The T. pyriformis AK2 cDNA in pGEM were digested with Nde I and BamH I and cloned into the Nde I/BamH I site of the pET30b. The domain 1 (D1) of T. pyriformis AK2 were amplified using specific primer sets, T.p-2DAKcF1-2 (5′-CCATATGATCCCTGTCTGCCTTTTAATCG, Nde I site underlined) and T.p-2DAK-D1H6.R1-2, (5′-CCTA(GTG)6CTTTTCAACT TCGATTAATTCGTTG, 6xHis-tag underlined), subcloned into the pGEM and sequenced. The domain 1 (D1) of AK2 in pGEM was then digested with Nde I and Eco RI and cloned into Nde I/Eco RI site of the pET30b. The pET30b plasmids were sequenced and confirmed that there was no intended mutation in the coding region of T. pyriformis AKs. The fusion enzymes with a hexameric His tag at the C-terminal end were expressed in E. coli BL21 (DE3) cells (Novagen) by induction with 1.0 mM IPTG at 20 °C for 24 h. The cells were resuspended in lysis buffer (50 mM NaH2PO4, 300 mM NaCl, pH 8.0), sonicated and the resulting soluble recombinant enzyme was purified by affinity chromatography using a Ni-NTA Superflow column (QIAGEN, CA, USA). The purity of the expressed enzyme was verified by SDS-PAGE. The enzymes were placed on ice until assay of enzymatic activity within 12 h. 2.5. Enzyme assay and determination of kinetic constants Enzyme activity was measured by NADH-linked spectrophotometric assay at 25 °C for the forward reaction (phosphagen synthesis) (Ellington, 1989). The concentration of recombinant enzyme was estimated by the absorbance at 280 nm using the extinction coefficient of 31.40 mM−1 cm−1 for AK1 and 68.76 mM−1 cm−1 for AK2 obtained with the ProtParam (http://ca.expasy.org/tools/protparam.html) assuming that all Cys residues are reduced. Since the kinetics of AK can be explained as a random-order, rapidequilibrium kinetic mechanism (Morrison and James, 1965), the initial value of the velocity (v) is given by the following equation.

v¼

Arg

V max Arg ATP Arg K ATP K Ka a •K ia þ a þ þ1 ½Arginine½ATP ½ATP ½Arginine

ATP

ATP

Arg

;

K a •K ia ¼ K a •K ia ¼ K T ¼ ½E½Arg½ATP=½E−Arg−ATP;

ð1Þ

ð2Þ

36

J. Michibata et al. / Comparative Biochemistry and Physiology, Part B 171 (2014) 34–41

and V max ¼ kcat ½E0  ¼ kcat ð½E þ ½E−Arg þ ½E−ATP þ ½E−Arg−ATPÞ;

ð3Þ

where Ka is the ternary dissociation constant in the presence of the second substrate, Kia is the binary dissociation constant in the absence of the second substrate, and KT is the dissociation constant of the [E-ArgATP] complex (see Eq. (2)). To determine the kinetic parameters, data were fitted directly to Eq. (1) according to the method of Cleland (1979) using software written by Dr. R. Viola (Enzyme kinetics Programs, ver. 2.0) or SigmaPlot 12 (Systat Software, Inc.). 2.6. Preparation of deciliated cell and ciliary fraction from T. pyriformis Cilia fractionation was prepared from T. pyriformis culture following the methods of William (1995). Briefly, 50 mL of HNMKS solution (50 mM HEPES, 36 mM NaCl, 0.01 mM MgSO4, 1 mM KCl, and 250 mM sucrose) containing 0.035 g of dibucaine hydrochloride and 30 mM PMSF was added to one aliquot of packed cells of T. pyriformis harvested from 250 mL of culture and shaken at 130 rpm for 10 min at 25 °C. The solution was centrifuged at 2500 ×g for 10 min at 20 °C to obtain the deciliated cell fraction. The ciliary fraction was recovered by further centrifugation at 22,300 g for 40 min at 4 °C. The fractions were observed under a Nomarski differential-interference microscope (ECLIPSE 80i, Nikon) and confirmed to mostly contain the target fraction. 2.7. Western blot analysis Mouse polyclonal antibodies for T. pyriformis AK1 or AK2 were raised using a recombinant enzyme AK1 (100 mg) or domain 1 of the twodomain AK2 (100 mg), respectively, as the antigen, using BALB/c mice by Technical Keystone Craft, Japan (http://www.tkcraft.co.jp/). Western immunoblot analysis was then performed using the primary antibodies to AK1 and AK2. Samples for SDS-PAGE (intact cell, deciliated cell and ciliary fraction) were dissolved in HEEMSC solution, vortexed or sonicated if needed, and the extracted protein concentration of the sample was estimated by a Bradford method using a Protein Assay CBB Solution (Nacalai Tesque, Tokyo, Japan). A 33-mg aliquot of protein was applied to SDSPAGE with a visible protein marker (Precision Plus Protein™ Dual Color Standards, Bio-Rad). After SDS-PAGE, proteins were transferred onto a Hybond™ ECL™ Nitrocellulose membrane (Amersham Pharmacia Biotech) soaked in 100 mM Tris, 192 mM glycine and 20% methanol solution, using a AE6675 blotter (ATTO, Japan). Blotted membranes were then blocked in 5% skim milk in a PBST solution (1 L solution contains 0.8 g of NaCl, 0.02 g of KCl, 0.115 g of Na2HPO4·12H2O, 0.02 g of KH2PO4 and 10 g of Tween 20) at room temperature for 2 h followed by incubation with the primary antibodies for AK1 (10 mg) or AK2 (5 mg) in PBST. Membranes were then washed three times with PBST and a secondary antibody (goat anti-mouse lgG-HRP, Santa Cruz Biotechnology) was added and incubated for 2 h at room temperature. The membrane was washed with PBST and visualized using an HRP Conjugate Substrate Kit (BioRad). 2.8. N-Myristoyltransferase (NMT) assay using N-terminal peptides of T. pyriformis AK1 NMT activity was measured with the continuous assay method of Boisson and Meinnel (2003). Assay was performed using the recombinant enzymes (14 µM of T. pyriformis NMT (manuscript in preparation) or 10 µM of Arabidopsis thaliana NMT (Boisson and Meinnel, 2003)) and 5–2000 µM of the peptide substrates (GCSNSRSG: N-terminal eight residues of T. pyriformis AK1, CSNSRS: residue 2–8 of T. pyriformis AK1, and GCSVSKKK: AtSOS3 peptide which is known to be myristoylated

(Boisson and Meinnel, 2003)). All the peptides were synthesized with the grade N 80% HPLC by Operon Biotechnology Japan. Measurements were triplicated, and the Michaelis–Menten curve was analyzed using SigmaPlot 12. 3. Results and discussion 3.1. cDNA and derived amino acid sequence of two Tetrahymena pyriformis AKs The two AK cDNAs, AK1 and AK2, from T. pyriformis were sequenced and deposited in the DDBJ database (accession numbers: AB758886 and AB758887, respectively). AK1 was 1377 bp in length and had an open reading frame (ORF) of 1113 bp and 5′ and 3′ untranslated regions of 79 and 185 bp, respectively. AK2 was 2363 bp in length and had an ORF of 2151 bp and 5′ and 3′ untranslated regions of 95 and 117 bp, respectively. The ORF of T. pyriformis AK1 codes for a protein with 370 amino acid residues (calculated molecular mass of 41152.6 Da) with an estimated pI of 6.40, while the AK2 codes for a protein with 716 amino acid residues (calculated mass of 80845.3 Da), which is twice that for AK1, with an estimated pI of 6.55. The gene for T. pyriformis AK1 has one TAA codon at position 185, which codes for Gln, while that for AK2 uses TAG, TAG, TAG, TAA and TAA codons for Gln at positions 155, 185, 461, 535 and 610, respectively. These codons were replaced by CAA or CAG prior to expressing the recombinant enzymes in E. coli. The cDNA-derived amino acid sequence of T. pyriformis AK1 showed 54% to 57% sequence identity with those of the two domains (D1 and D2) of T. pyriformis AK2. In contrast, D1 and D2 showed a rather higher sequence identity (87%), suggesting that a relatively recent gene duplication event yielded the two domains. Two-domain AKs, such as those from Pseudocardium and Anthopleura, have a bridge intron separating the two domains, suggesting that the two-domain enzyme resulted from gene duplication and subsequent fusion events (Suzuki et al., 1997; 1998), but AK2 in T. pyriformis lacks the bridge intron (Okazoe et al., unpublished data). Therefore, we designated the boundary of the two domains of T. pyriformis AK2 based on amino acid sequence homology. 3.2. T. pyriformis AKs have a substrate recognition system similar to those of typical invertebrate AKs In the Limulus AK TSAC (transition state analog complex) structure, seven residues (S63, G64, V65, Y68, E225, C271 and E314) and five Arg residues (R124, R126, R229, R280 and R309) interact with substrates arginine and ATP, respectively (Zhou et al., 1998). These residues are highly conserved among invertebrate AKs, except for the residues at positions 64 and 65, which are often replaced by structurally similar amino acids (Uda et al., 2006). Comparison of Limulus and T. pyriformis AK sequences indicates that the five residues (S63, Y68, E225, C271, and E314) that interact with the arginine substrate are conserved but residues 64 and 65 are substituted by Ser and Ile, respectively, in all T. pyriformis AK sequences (see Table 1). On the other hand, the five Arg residues that interact with ATP are conserved in all T. pyriformis AKs. D62 and R193 residues are suggested to play a key role in stabilizing the substrate-bound structures of AK by forming an ion pair (Suzuki et al., 2000) and are conserved in most AK sequences, including the unusual Stichopus AK, which evolved secondarily from CK (Suzuki et al., 1999). These residues are conserved in both of the two domains of T. pyriformis AK2, but are substituted in the AK1 by N and K, respectively (Table 1). The same pair of substitutions has been observed in oyster, Crassostrea AK (Fujimoto et al., 2005). In Paramecium tetraurelia AKs, R193 is replaced by N. Tyr at position 89 is also a key residue in typical invertebrate AKs and is strictly conserved. This residue is not directly involved in substrate

193 Arg . . . . . Asn Asn Asn Asn Lys . . 62 Asp . . . . . . . . . Asn . . 89 Tyr . . . . . . . . . . . .

3.3. T. pyriformis AK1 has a myristoylation signal at the N-terminus PROSCAN (PROSITE SCAN; http://npsa-pbil.ibcp.fr/cgi-bin/npsa_ automat.pl?page=/NPSA/npsa_proscan.html) of the amino acid sequences of T. pyriformis AKs showed the presence of a myristoylation signal sequence (GCSNSR) at the N-terminus of T. pyriformis AK1, while no such signal was found for T. pyriformis AK2. This is the first report of a myristoylation signal sequence in AKs, but there is one precedent in the flagellar CK isoform in sea urchin (Quest et al., 1992). The myristoylation signal group mediates the binding of the protein to the cell membrane and is characterized by the following sequence (Towler et al., 1988; Grand, 1989; Aicart-Ramos et al., 2011): (N-terminal G-[not E, D, R, K, H, P, F, Y and W]-X-X-[any one of S, T, A, G, C and N][not P]). In the case of sea urchin flagellar CK which has a myristoylated N-terminus, the enzyme is localized in the flagellar membrane of sperm (Quest et al., 1992). Likewise, T. pyriformis AK1 might target the cell membrane or ciliary membrane. Here, it should be noted that the PROSCAN method is prone to false positives (Podell and Gribskov, 2004). For myristoylation, the protein Nmyristoyltransferase (NMT) and the myristoyl CoA are required (AicartRamos et al., 2011). In this respect, we have isolated and cloned the NMT cDNA from T. pyriformis (manuscript in preparation). So we performed the NMT assay (Boisson and Meinnel, 2003), using the recombinant T. pyriformis NMT and the N-terminal peptide GCSNSRSG of T. pyriformis AK1 or the peptide CSNSRSG which lacks N-terminal G of the former peptide. As shown in Fig. 1, the use of the former peptide gave a typical Michaelis–Menten curve with an apparent Km value of 50 μM for the peptide, while that for the latter gave no activity. We also confirmed that the NMT assay using Arabidopsis thaliana NMT and the peptide AtSOS3 gave a typical Michaelis–Menten curve, similar to the literature (Boisson and Meinnel, 2003). Thus our results suggest that the N-terminal Gly of T. pyriformis AK1 is likely to be myristoylated.

280 Arg . . . . . . . . . . . . 229 Arg . . . . . . . . . . . . 126 Arg . . . . . . . . . . . . 124 Arg . . . . . . . . . . . . Dot ‘.’ indicates the same conserved residue in Limulus AK.

Position in Limulus sequence Limulus polyphemus AK Nautilus pompilius AK Sulfurovum lithotrophicum AK Desulfotalea psychrophila AK Trypanosoma cruzi AK Monosiga ovata AK Paramecium tetraurelia AK1 Paramecium tetraurelia AK2 Paramecium tetraurelia AK3 Paramecium tetraurelia AK4 Tetrahymena pyriformis AK1 Tetrahymena pyriformis AK2-D1 Tetrahymena pyriformis AK2-D2 Sources Arthropod Mollusc Bacterium Bacterium Protist (Sarcomastigophora) Protist (Choanozoa) Protist (Ciliophora) Protist (Ciliophora) Protist (Ciliophora) Protist (Ciliophora) Protist (Ciliophora) Protist (Ciliophora) Protist (Ciliophora)

Table 1 Key amino acid residues for substrate binding in AK.

References Zhou et al. (1998) Suzuki et al. (2000) Suzuki et al. (2013) Andrews et al. (2008) Pereira et al. (2000) Conejo et al. (2008) Gi|145528740 Gi|145528710 Gi|145496314 Gi|145506947 This work This work This work

63 Ser . . . . . . . . . . . .

64 Gly . Ser Ser . . Ser Ser Gln Ser Ser Ser Ser

65 Val . Ile Ile Ile . Val Val Val Val Ile Ile Ile

68 Tyr . . . . . . . Ser Ser . . .

225 Glu . . . . . . . . . . . .

271 Cys . . . . . . . . . . . .

314 Glu . . . . . . . . . . . .

ADP binding residues Arginine binding residues

37

binding but it is located close to the site that binds with the substrate arginine (Zhou et al., 1998). Site-directed mutagenesis of this residue indicates that it significantly and specifically affects guanidino substrate (Edmiston et al., 2001; Tanaka and Suzuki, 2004; Uda and Suzuki, 2004). Y89 was conserved in all AK sequences of T. pyriformis (Table 1).

309 Arg . . . . . . . . . . . .

Guanidino substrate-specific residue

Specific ion pair-forming residues in Limulus AK

J. Michibata et al. / Comparative Biochemistry and Physiology, Part B 171 (2014) 34–41

Fig. 1. Michaelis–Menten curve of N-myristoyltransferase (NMT) reaction. As the enzyme, 14 μM of the recombinant Tetrahymena pyriformis NMT was used. Two peptides, one with the sequence of GCSNSRSG corresponding to the N-terminal eight residues of T. pyriformis AK1 and the other of CSNSRSG (removed N-terminus Gly of the former peptide) were used for the assay (Boisson and Meinnel, 2003). The concentration of myristoyl CoA was 250 μM.

219 145 1932 1920 1487 434 47 423 101 ± ± ± ± ± ± ± ± ± 1.86 1.27 0.11 0.02 1.61 1.23 3.56 0.6 2.26 ± ± ± ± ± ± ± ± ± 0.73 0.73 0.07 0.02 1.52 0.99 1.27 0.30 0.97 ± ± ± ± ± ± ± ± ± 0.65 0.60 0.64 0.11 0.3 0.47 2.67 0.23 0.82 ± ± ± ± ± ± ± ± ± 0.26 0.35 0.4 0.07 0.28 0.38 0.95 0.12 0.35 104 63.4 88 3.14 671 200 159 29.2 79.7 6xHis 6xHis 6xHis MBP 6xHis 6xHis No tag MBP MBP This work This work Suzuki et al. (2013) Andrews et al. (2008) Tada and Suzuki (2010) Iwanami et al. (2009) Wu et al. (2007) Wickramasinghe et al. (2007) Fujimoto et al. (2005) Tetrahymena pyriformis AK1 Tetrahymena pyriformis AK2 two-domain Sulfurovum lithotrophicum AK Desulfotalea psychrophila AK Anthopleura AK two-domain Neocaridina AK2 Locusta AK Toxocara AK Crassostrea AK

Tombes and Shapiro were the first to demonstrate that the energy required for flagellar motility of sea urchin sperm is transported from mitochondria to flagellum by a “phosphocreatine shuttle” that facilitates the diffusion of phosphocreatine between two CK isozymes, one localized in cytoplasm (normal CK) and the other in flagellum (unusual three-domain CK) (Tombes and Shapiro, 1985; Tombes et al., 1987; Tombes and Shapiro, 1989; Wothe et al., 1990). Later, it was shown that the flagellar CK is associated with the membrane through the

Ciliate Ciliate Bacteria Bacteria Cnidaria Arthropod Arthropod Nematoda Mollusc

3.6. Continuous ATP supply system (phosphoarginine shuttle) in the cilia of T. pyriformis and the role of the AK1

Reference

Proteins were extracted from the intact cell, deciliated cell and ciliary fraction of T. pyriformis, and a normalized amount of proteins was subjected to SDS-PAGE and blotted onto nitrocellulose membrane. Then it was reacted with anti-AK1 or anti-AK2 polyclonal antibodies, and was visualized (Fig. 2). Western blot analysis showed that anti-AK1 antibody cross-reacted apparently with AK2 (see Fig. 2, lane d). This may be due to high sequence identity (57%) between AK1 and domain 1 of AK2. However it should be emphasized that AK1 and AK2 is unambiguously distinguished by their molecular masses (AK1: ~40 kDa: and AK2: ~80 kDa) on SDS-PAGE. The result of Western blotting indicates that the intact cell expresses both AK1 and AK2 (see Fig. 2, lanes d and g), the deciliated cell contains AK2 (lanes e and h) and cilia contains AK1 (lanes f and i). Thus, it is suggested that the AK1 is mainly localized in the cilia, and the AK2 is mainly localized in the cytoplasmic fraction.

Table 2 Comparison of kinetic parameters of Tetrahymena AKs with those of bacterial and invertebrate AKs.

3.5. Western blot analysis of T. pyriformis AK1 and AK2

Enzyme tag

kcat (1/s)

± ± ± ± ± ± ± ± ±

3.1 2.3 5.37 0.12 32.4 5.2 6.2 0.19 3.4

KArg a (mM)

0.07 0.08 0.10 0.01 0.05 0.04 0.08 0.003 0.01

KArg ia (mM)

0.15 0.14 0.10 0.04 0.08 0.08 0.22 0.03 0.37

KATP a (mM)

0.06 0.07 0.01 0 0.16 0.06 0.23 0.04 0.25

KATP ia (mM)

0.8 0.48 0.03 0.01 0.55 0.23 0.32 0.07 0.59

Kia/Ka

Arg kcat/KATP a Kia

AKs from T. pyriformis were successfully expressed as soluble proteins with 6xHis-tag and purified by affinity chromatography. We examined the activity for several guanidino substrates, arginine, creatine, glycocyamine and taurocyamine, and the enzymes showed significant activity only for arginine. Kinetic constants of purified AKs from T. pyriformis for the forward reaction (phosphagen formation) are shown in Table 1 along with parameters for bacterial and invertebrate AKs. The parameters KArg and KATP represent dissociation constant in a a ATP the presence of the other substrate, and KArg ia and Kia represent dissociation constant in the absence of the other substrate. Comparison of T. pyriformis AK1 and AK2 kinetic constants, KArg a (0.26–0.35 mM) and KATP (0.73 mM), shows that these are comparable a to those of bacterial and invertebrates AKs (KArg (0.12 to 0.95 mM) and a KATP (0.30 to 1.52 mM)) (Table 2). The kcat (63–104 s−1) and catalytic a Arg efficiency calculated by kcat/KATP (145–219 s− 1 mM− 2) of a Kia T. pyriformis AKs were also within the ranges of values for other AKs Arg (kcat (29 to 671) and kcat/KATP a Kia (47–1487)). In reactions involving AKs, the two substrates are typically bound synergistically to the enzyme. In most cases, binding of the first substrate facilitates binding of the second substrate. Therefore, Kia, the dissociation constant in the absence of the second substrate, usually becomes higher than Ka (Kia/Ka is 1.07–3.2; Table 2). T. pyriformis enzymes exhibit a medium level of positive synergism in substrate binding (Kia/Ka = 1.7–2.6). ATP The KArg value appears to become a good index to distinguish a /Ka bacterial AKs from other AKs: bacterial AKs showing higher value (4.7–5.6) and invertebrates and T. pyriformis AKs showing lower value (less than 0.75) (Table 2). As summarized, these results indicate that the T. pyriformis AKs have a substrate binding property that is comparable to those of typical invertebrate AKs, rather than bacterial AKs.

2.56 1.71 1.59 1.56 1.07 1.24 3.2 1.96 2.34

ATP KArg a /Ka

3.4. Characterization of two recombinant AK enzymes from Tetrahymena pyriformis

0.36 0.48 5.62 4.67 0.18 0.38 0.75 0.40 0.36

J. Michibata et al. / Comparative Biochemistry and Physiology, Part B 171 (2014) 34–41

Sources

38

J. Michibata et al. / Comparative Biochemistry and Physiology, Part B 171 (2014) 34–41

39

Fig. 2. Western immunoblot analysis of proteins from Tetrahymena pyriformis. Proteins were extracted from intact cells, deciliated cells and ciliary fraction, electrophoresed, transferred to nitrocellulose membrane, reacted with anti-AK1 or anti-AK2 polyclonal antibodies, and visualized. M (marker proteins); a, d and g (intact cells); b, e and h (deciliated cells); c, h and h (ciliary fraction).

myristoylation group attached at the N-terminus of the flagellar CK (Quest et al., 1992). Noguchi et al. (2001) demonstrated that phosphoarginine supplies energy for ciliary beating in Paramecium caudatum and that it functions not only as a reservoir of energy but also as a transporter of energy in conditions that continuously require energy. Although AK enzymes are suggested to participate in the “phosphoarginine shuttle” system, the enzyme involved in the reaction has not yet been identified in P. caudatum. In this paper, we isolated two AK cDNAs, one coding normal 40-kDa AK (AK1) and the other coding an unusual two-domain AK (AK2), from T. pyriformis. Both enzymes display strong activity comparable to that of typical invertebrate AK, and Western blot analysis showed that AK1 was mainly localized in the cilia, while the AK2 appeared to be distributed in the cytoplasm. Considering that T. pyriformis AK1 has a distinct myristoylation signal at the N-terminus, it is very likely that T. pyriformis AK1 is attached to the ciliary membrane through the myristoylation group.

Based on these results, we developed the model of the “phosphoarginine shuttle” in T. pyriformis. First of all, we must say that the model is highly speculative at present. In the cilia, continuous energy flow to dynein is required for ciliary movement. As shown in Fig. 3, ATP is generated by mitochondria in the cytoplasm, and the transfer of the high-energy phosphate group to arginine is catalyzed by AK2 located in the cytoplasm, yielding phosphoarginine (Pi-Arg). Then PiArg diffuses toward the tip of the cilia along the concentration gradient. AK1 may be attached at many sites to the ciliary membrane through the myristoylation group. It is also possible that AK1 is localized to cilia by another mechanism. The enzyme is able to regenerate ATP from ADP using Pi-Arg, and the resulting ATP is continuously supplied to dynein. The consumption of Pi-Arg locally at the cilia facilitates the diffusion of Pi-Arg to the tip and, as a consequence, continuous ciliary movement can be achieved. Is the “phosphoarginine shuttle” mechanism proposed in T. pyriformis (Fig. 3) applicable to the case of P. caudatum (Noguchi et al., 2001)? Although there are no molecular data available for AKs of P. caudatum, a

Fig. 3. Model for phosphoarginine shuttle in the cilia of Tetrahymena pyriformis. AK1 is bound to the ciliary membrane through the myristoylation group, and regenerates ATP, which is supplied to the dynein using phosphoarginine (Pi-Arg). The consumption of Pi-Arg locally at the cilia produces a sharp concentration gradient of Pi-Arg, which facilitates the diffusion of Pi-Arg to the tip of the cilia.

40

J. Michibata et al. / Comparative Biochemistry and Physiology, Part B 171 (2014) 34–41

search of genomic data for P. tetraurelia revealed the presence of four putative AKs (Table 1). Unfortunately, we have not found the myristoylation signal in any of the four AKs. This suggests that another mechanism must be considered for the case of Paramecium. However, by a carful motif search of P. tetraurelia AKs, we have found the prenylation signal (C-terminal CAAX box) in two of the four P. tetraurelia AK sequences, instead of myristoylation signal. The prenylation signal adds either a farnesyl (a C15-unsaturated fatty acid) or a geranyl-geranyl (a C20-unsaturated fatty acid) group to a cysteine residue that is three residues away from the C-terminus (Lowy and Willumsen, 1989; Glomset et al., 1990; Powers, 1991). This finding suggests that the “phosphoarginine shuttle” system, proposed in this work (Fig. 3), may also work in Paramecium, but in Paramecium a prenylated AK may substitute for the myristoylated AK1 of T. pyriformis. In this paper, we have shown that T. pyriformis AK1 is localized in the cilia. Why is AK1 specifically localized at the ciliary membrane, not at the cytoplasmic membrane? We do not know this reason, but this might be related to the marked difference in the lipid composition between the two membranes of T. pyriformis (Nozawa and Thompson, 1971). Subcellular localization (trafficking) of proteins or enzymes is dependent either on the targeted N-terminal signal sequences, such as endoplasmic reticulum and mitochondria (Petersen et al., 2011), or on fatty acylation (lipidation), such as myristoylation, palmitoylation and prenylation, which are modified at the specific amino acids N-terminal Gly, Ser and Cys, respectively (Aicart-Ramos et al., 2011). Localization of enzymes and its mechanism are key issues to fully understanding the function of the enzyme. In this respect, the “phosphoarginine shuttle” model in the cilia of T. pyriformis will provide a good model for understanding the relationship between localization and function of enzymes. Acknowledgements We thank Dr. Ken-ichi Nakamura of Hiroshima Prefectural Women's University, Japan, for supplying Tetrahymena pyriformis. This work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology, Japan to TS (20570072 and 24570087). References Aicart-Ramos, C., Valero, R.A., Rodriguez-Crespo, I., 2011. Protein palmitoylation and subcellular trafficking. Biochim. Biophys. Acta 1808, 2981–2994. Andrews, L.D., Graham, J., Snider, M.J., Fraga, D., 2008. Characterization of a novel bacterial arginine kinase from Desulfotalea psychrophila. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 150, 312–319. Boisson, B., Meinnel, T., 2003. A continuous assay of myristoyl-CoA: protein Nmyristoyltransferase for proteomic analysis. Anal. Biochem. 322, 116–123. Borson, N.D., Salo, W.L., Drewes, L.R., 1992. A lock-docking oligo(dT) primer for 5′ and 3′ RACE PCR. PCR Methods Appl. 2, 144–148. Bragg, J., Rajkovic, A., Anderson, C., Curtis, R., Van Houten, J., Begres, B., Naples, C., Snider, M., Fraga, D., Singer, M., 2012. Identification and characterization of a putative arginine kinase homolog from Myxococcus xanthus required for fruiting body formation and cell differentiation. J. Bacteriol. 194, 2668–2676. Cleland, W.W., 1979. Statistical analysis of enzyme kinetic data. Methods Enzymol. 63, 103–138. Conejo, M., Bertin, M., Pomponi, S.A., Ellington, W.R., 2008. The early evolution of the phosphagen kinases—insights from choanoflagellate and poriferan arginine kinases. J. Mol. Evol. 66, 11–20. Edmiston, P.L., Schavolt, K.L., Kersteen, E.A., Moore, N.R., Borders, C.L., 2001. Creatine kinase: a role for arginine-95 in creatine binding and active site organization. Biochim. Biophys. Acta 1546, 291–298. Ellington, W.R., 1989. Phosphocreatine represents a thermodynamic and functional improvement over other muscle phosphagens. J. Exp. Biol. 143, 177–194. Ellington, W.R., 2001. Evolution and physiological roles of phosphagen systems. Annu. Rev. Physiol. 63, 289–325. Ellington, W.R., Suzuki, T., 2006. Evolution and divergence of creatine kinase genes. In: Vial, C. (Ed.), Molecular Anatomy and Physiology of Proteins: Creatine Kinase. Nova Science, New York, pp. 1–27. Fujimoto, N., Tanaka, K., Suzuki, T., 2005. Amino acid residues 62 and 193 play the key role in regulating the synergism of substrate binding in oyster arginine kinase. FEBS Lett. 579, 1688–1692.

Glomset, J.A., Gelb, M.H., Farnsworth, C.C., 1990. Prenyl proteins in eukaryotic cells: a new type of membrane anchor. Trends Biochem. Sci. 15, 139–142. Grand, R.J.A., 1989. Acylation of viral and eukaryotic proteins. Biochem. J. 258, 625–638. Iwanami, K., Iseno, S., Uda, K., Suzuki, T., 2009. A novel arginine kinase from the shrimp Neocaridina denticulata: the fourth arginine kinase gene lineage. Gene 437, 80–87. Kutomi, O., Takemura, M., Kamachi, H., Noguchi, M., 2012. Estimation of effective concentrations of ATP-regenerating enzymes in cilia of Paramecium caudatum. J. Eukaryot. Microbiol. 59, 49–53. Lowy, D.R., Willumsen, B.M., 1989. Protein modification: new clue to Ras lipid glue. Nature 341, 384–385. Morrison, J.F., 1973. Arginine kinase and other invertebrate guanidino kinases. In: Boyer, P.C. (Ed.), The Enzymes. Academic Press, New York, pp. 457–486. Morrison, J.F., James, E., 1965. The mechanism of the reaction catalyzed by adenosine triphosphate–creatine phosphotransferase. Biochem. J. 97, 37–52. Noguchi, M., Sawada, T., Akazawa, T., 2001. ATP-regenerating system in the cilia of Paramecium caudatum. J. Exp. Biol. 204, 1063–1071. Nozawa, Y., Thompson Jr., G.A., 1971. Studies of membrane formation in Tetrahymena pyriformis. II. Isolation and lipid analysis of cell fractions. J. Cell Biol. 49, 712–721. Palmer, A., Begres, B.N., Van Houten, J.M., Snider, M.J., Fraga, D., 2013. Characterization of a putative oomycete taurocyamine kinase: implications for the evolution of the phosphagen kinase family. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 166, 173–181. Pereira, C., Alonso, G., Paveto, M., Iribarren, A., Cabanas, M., Torres, H., Flawia, M., 2000. Trypanosoma cruzi arginine kinase characterization and cloning. A novel energetic pathway in protozoan parasites. J. Biol. Chem. 275, 1495–1501. Petersen, T.N., Brunak, S., von Heijne, G., Nielsen, H., 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods 8, 785–786. Podell, S., Gribskov, M., 2004. Predicting N-terminal myristoylation sites in plant proteins. BMC Genomics 5, 37. Powers, S., 1991. Protein prenylation: a modification that sticks. Curr. Biol. 1, 114–116. Qin, W., Khuchua, Z., Cheng, J., Boero, J., Payne, R.M., Strauss, A.W., 1998. Molecular characterization of the creatine kinases and some historical perspectives. Mol. Cell. Biochem. 184, 153–167. Quest, A.F., Chadwick, J.K., Wothe, D.D., McIlhinney, R.A., Shapiro, B.M., 1992. Myristoylation of flagellar creatine kinase in the sperm phosphocreatine shuttle is linked to its membrane association properties. J. Biol. Chem. 267, 15080–15085. Strong, S.J., Ellington, W.R., 1993. Horseshoe crab sperm contain a unique isoform of arginine kinases that is present in midpiece and flagellum. J. Exp. Zool. 267, 563–571. Suzuki, T., Kawasaki, Y., Furukohri, T., 1997. Evolution of phosphagen kinase. Isolation, characterization and cDNA-derived amino acid sequence of two-domain arginine kinase from the sea anemone Anthopleura japonicus. Biochem. J. 328, 301–306. Suzuki, T., Kawasaki, Y., Unemi, Y., Nishimura, Y., Soga, T., Kamidochi, K., Yazawa, Y., Furukohri, T., 1998. Gene duplication and fusion have occurred frequently in the evolution of phosphagen kinases—a two-domain arginine kinase from the clam Pseudocardium sachalinensis. Biochim. Biophys. Acta 1388, 253–259. Suzuki, T., Kamidochi, M., Inoue, N., Kawamichi, H., Yazawa, Y., Furukohri, T., Ellington, W. R., 1999. Arginine kinase evolved twice: evidence that echinoderm arginine kinase originated from creatine kinase. Biochem. J. 340, 371–375. Suzuki, T., Fukuta, H., Nagato, H., Umekawa, M., 2000. Arginine kinase from Nautilus pompilius, a living fossil. Site-directed mutagenesis studies on the role of amino acid residues in the guanidino specificity region. J. Biol. Chem. 275, 23884–23890. Suzuki, T., Mizuta, C., Uda, K., Ishida, K., Mizuta, K., Sona, S., Compaan, D.M., Ellington, W.R. , 2004. Evolution and divergence of the genes for cytoplasmic, mitochondrial and flagellar creatine kinases. J. Mol. Evol. 59, 218–226. Suzuki, T., Soga, S., Inoue, M., Uda, K., 2013. Characterization and origin of bacterial arginine kinases. Int. J. Biol. Macromol. 57, 273–277. Tada, H., Suzuki, T., 2010. Cooperativity in the two-domain arginine kinase from the sea anemone Anthopleura japonicus. II. Evidence from site-directed mutagenesis studies. Int. J. Biol. Macromol. 47, 250–254. Tanaka, K., Suzuki, T., 2004. Role of amino acid residue 95 in substrate specificity of phosphagen kinases. FEBS Lett. 573, 78–82. Tombes, R.M., Shapiro, B.M., 1985. Metabolite channeling: a phosphorylcreatine shuttle to mediate high energy phosphate transport between sperm mitochondrion and tail. Cell 41, 325–334. Tombes, R.M., Shapiro, B.M., 1989. Energy transport and cell polarity: relationship of phosphagen kinase activity to sperm function. J. Exp. Zool. 251, 82–90. Tombes, R.M., Brokaw, C.J., Shapiro, B.M., 1987. Creatine kinase-dependent energy transport in sea urchin spermatozoa. Flagellar wave attenuation and theoretical analysis of high energy phosphate diffusion. Biophys. J. 52, 75–86. Towler, D.A., Gordon, J.I., Adams, S.P., Glaser, L., 1988. The biology and enzymology of eukaryotic protein acylation. Annu. Rev. Biochem. 57, 69–99. Uda, K., Suzuki, T., 2004. Role of amino acid residues on the GS region of Stichopus arginine kinase and Danio creatine kinase. Protein J. 23, 53–64. Uda, K., Fujimoto, N., Akiyama, Y., Mizuta, K., Tanaka, K., Ellington, W.R., Suzuki, T., 2006. Evolution of the arginine kinase gene family. Comp. Biochem. Physiol. Part D Genomics Proteomics 1, 209–218. Uda, K., Hoshijima, M., Suzuki, T., 2013. A novel taurocyamine kinase found in the protist Phytophthora infestans. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 165, 42–48. Watson, M.R., Hopkins, J.M., 1961. Isolated cilia from Tetrahymena pyriformis. Exp. Cell Res. 28, 280–295. Watts, D.C., Bannister, L.H., 1970. Location of arginine kinase in the cilia of Tetrahymena pyriformis. Nature 226, 450–451.

J. Michibata et al. / Comparative Biochemistry and Physiology, Part B 171 (2014) 34–41 Wickramasinghe, S., Uda, K., Nagataki, M., Yatawara, L., Rajapakse, R.P.V.J., Watanabe, Y., Suzuki, T., Agatsuma, T., 2007. Toxocara canis: Molecular cloning, characterization, expression and comparison of the kinetics of cDNA-derived arginine kinase. Exp. Parasitol. 117, 124–132. William, L.D., 1995. Isolation of cilia from Tetrahymena thermophila. Methods Cell Biol. 47, 13–15 (Chapter 3). Wothe, D.D., Charbonneau, H., Shapiro, B.M., 1990. The phosphocreatine shuttle of sea urchin sperm: flagellar creatine kinase resulted from a gene triplication. Proc. Natl. Acad. Sci. U. S. A. 87, 5203–5207.

41

Wu, Q.Y., Li, F., Zhu, W.J., Wang, X.Y., 2007. Cloning, expression, purification, and characterization of arginine kinase from Locusta migratoria manilensis. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 148, 355–362. Zhou, G., Somasundaram, T., Blanc, E., Parthasarathy, G., Ellington, W., Chapman, M., 1998. Transition state structure of arginine kinase: implications for catalysis of bimolecular reactions. Proc. Natl. Acad. Sci. U. S. A. 95, 8449–8454.