Gastroenterology 2015;148:533–536

Truncating Mutation in the Nitric Oxide Synthase 1 Gene Is Associated With Infantile Achalasia Eyal Shteyer,1,* Simon Edvardson,2,* Sarah L. Wynia-Smith,3,* Ciro Leonardo Pierri,4,* Tzili Zangen,5,* Saar Hashavya,6 Michal Begin,2 Barak Yaacov,7 Yuval Cinamon,7 Benjamin Z. Koplewitz,8 Amos Vromen,9 Orly Elpeleg,7 and Brian C. Smith3 1 Pediatric Gastroenterology Unit, Department of Pediatrics; 2Neuropediatric Unit, Hadassah-Hebrew University Medical Center, Jerusalem, Israel; 3Department of Biochemistry, Medical College of Wisconsin, Milwaukee, Wisconsin; 4Department of Biosciences, Biotechnologies and Biopharmaceutics, University of Bari, Bari, Italy; 5Pediatric Gastroenterology Unit, E Wolfson Medical Center, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv, Israel; 6Emergency Medicine Department of Pediatrics; 7Monique and Jacques Roboh Department of Genetic Research, Hadassah-Hebrew University Medical Center, Jerusalem, Israel; 8Department of Medical Imaging; and 9Department of Pediatric Surgery, Hadassah-Hebrew University Medical Center, Jerusalem, Israel

See Covering the Cover synopsis on page 459. Nitric oxide is thought to have a role in the pathogenesis of achalasia. We performed a genetic analysis of 2 siblings with infant-onset achalasia. Exome analysis revealed that they were homozygous for a premature stop codon in the gene encoding nitric oxide synthase 1. Kinetic analyses and molecular modeling showed that the truncated protein product has defects in folding, nitric oxide production, and binding of cofactors. Heller myotomy had no effect in these patients, but sildenafil therapy increased their ability to drink. The finding recapitulates the previously reported phenotype of nitric oxide synthase 1–deficient mice, which have achalasia. Nitric oxide signaling appears to be involved in the pathogenesis of achalasia in humans.

Keywords: Human Genetics; Esophageal Disorder; Swallow; Muscle Relaxation.

A

chalasia is a rare primary esophageal motility disorder of unknown etiology. It can present as an isolated finding or as part of a syndrome, including Down syndrome, Allgrove (Achalasia-addisonianism-alacrimia) syndrome, familial visceral neuropathy, and achalasiamicrocephaly syndrome.1 Several achalasia mouse models are known, resulting from mutations in the Rassf1a, nitric oxide synthase 1, Kit, or Spry2 genes.1 However, mutation and common polymorphism analysis of these genes in patients with achalasia yielded negative results.1 The subjects of this report are 2 siblings: a 6-year-old girl (II-1) and a 2.5-year-old boy (II-3) (Figure 1A), the first and third children to first-cousin parents of Arab origin. The parents and their second child were healthy and the extended family history was noncontributory. The family first sought medical advice for patient II-1 when she was 5 months old because of recurrent vomiting since birth, dysphagia, and failure to thrive. Upper gastrointestinal series and high-resolution esophageal manometry were compatible with the diagnosis of type III (spastic) achalasia

(Figure 1D and E). Heller myotomy was performed at 3 years, however, there was no improvement in her ability to swallow, and she remained fed through a gastrostomy tube. Patient II-3 was diagnosed at the age of 2 months with type III (spastic) achalasia. Both children were diagnosed with autism (see Supplementary Material). Because of the parental consanguinity, we suspected a founder mutation transmitted in an autosomal-recessive manner. Exome analysis in patient II-1 DNA (detailed in the Supplementary Material) disclosed a homozygous premature termination codon in the nitric oxide synthase 1 (NOS1) gene at residue Tyr1202 instead of the normally occurring termination codon at residue 1435 (Figure 1B and C). The encoded neuronal nitric oxide synthase (nNOS) protein catalyzes the oxidation of L-arginine and nicotinamide adenine dinucleotide phosphate, reduced form (NADPH) to L-citrulline, NADPþ, and NO. Tyr1202 resides in the C-terminal electron-supplying reductase module (NOSred) that binds the flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) cofactors as well as the NADPH substrate (Figure 2A). We hypothesized that the Tyr1202Ter (Y1202X) mutation abolishes proper NOS cofactor assembly and therefore NO synthesis (for details see Supplementary Material). Assessment of NOS1 messenger RNA in fibroblasts disclosed very low levels of the normal transcript in both affected and unaffected individuals (see Supplementary Material). Because NOS1-expressing tissue was not available for additional studies, we measured the rates of NO synthesis and NADPH oxidation for purified wild-type (WT) and Y1197X (equivalent to Y1202X in human nNOS;

*Authors share co-first authorship. Abbreviations used in this paper: FMN, flavin mononucleotide; FAD, flavin adenine dinucleotide; NADPH, nicotinamide adenine dinucleotide phosphate, reduced form; nNOS, neuronal nitric oxide synthase; NO, nitric oxide; NOS1, nitric oxide synthase 1; NOSred, nitric oxide synthase cterminal electron-supplying reductase module; WT, wild-type. © 2015 by the AGA Institute 0016-5085/$36.00 http://dx.doi.org/10.1053/j.gastro.2014.11.044

BRIEF REPORT

BRIEF REPORT

534

Shteyer et al

Gastroenterology Vol. 148, No. 3

BRIEF REPORT

Figure 1. (A) Family pedigree, patients are designated by filled symbols and the mutation genotype is indicated (B). NOS1 genomic sequence around the mutation site in the DNA samples of the family members, and of a normal control (C). An upper gastrointestinal series (D) and a highresolution manometry (E) of patient II-1. There is severe narrowing (arrow) of the distal esophagus (Eso). High-resolution manometry (E) after 5-mL water swallow shows premature spastic contraction (distal latency 3.8 s) and impaired lower esophageal sphincter relaxation (integrated relaxation pressure [IRP] of 36 mmHg), exhibited in 6 of 10 swallows, compatible with type III achalasia.

Figure 2B) nNOS from Rattus norvegicus. Both nNOS WT (160 kDa) and Y1197X (135 kDa) migrated at their expected molecular weights (Figure 2C). As predicted, NO formation was not detectable for rat nNOS Y1197X. WT rat nNOS exhibited a robust steady-state rate of NO formation (0.20 ± 0.07/s) (Figure 2D). Similarly, the rate of NADPH oxidation for rat nNOS Y1197X was G, p.Y1202* (Y1202X) results in a premature termination codon at residue Tyr1202 instead of the normally occurring termination codon at residue 1435 in the NOS1 gene (Figure 1B and C). The mutation was not present in dbSNP138 and was absent from 6503 exome analyses available at the Exome Variant Server, NHLBI Exome Sequencing Project, Seattle, WA (http://evs.gs. washington.edu/EVS/). The mutation state was determined in all family members by Sanger sequencing. The NOS1 gene consists of 28 exons encoding the neuronal nitric oxide synthase (nNOS) protein. Nitric oxide synthase catalyzes the synthesis of NO from L-arginine. This is a heme-based oxygenation reaction that involves electron transfer from NADPH through the FAD and FMN cofactors and finally to the heme cofactor. Because the FAD and NADPH binding sites of NOS proteins are located at their C-terminus, the truncated protein, even if produced and stable, was predicted to be deficient of NOS catalytic activity. Mammals possess 3 NOS proteins, encoded by 3 different genes: nNOS, and endothelial NOS (eNOS), which are constitutively expressed in many tissues, and inducible NOS (iNOS), which is induced in macrophages during the innate immune response and in other tissues during inflammation. NO generated by nNOS and eNOS is regarded as a neurotransmitter and a paracrine signaling molecule involved in vasodilation, brain functions, and gut motility. The limited organ involvement in our patients, confined to the lower esophageal sphincter and brain, likely represent tissues where eNOS expression cannot compensate for the loss of nNOS. This was probably also the case for the NOS1 knockout mouse,4 where achalasia was the predominant abnormality4 and underlies the intact lower esophageal sphincter relaxation in the eNOS knockout animal.5

Neuronal Nitric Oxide Synthase Expression and Purification For in vitro kinetic studies, the nNOS sequence from R norvegicus was used due to the ease of expression and purification of this construct from Escherichia coli. WT rat nNOS was purified as described previously.6,7 For the truncated protein, the rat nNOS sequence truncated at Y1197 (equivalent to Y1202 in human nNOS) was cloned into the pCWori vector with a C-terminal hexahistidine tag to aid in purification. The pCWori rat nNOS Y1197X-His6 plasmid was cotransformed with the pGROE plasmid into

536.e2

Shteyer et al

BL21(DE3) cells. A 50-mL culture supplemented with 50 mg/mL ampicillin and 10 mg/mL tetracycline was inoculated with a single colony containing both plasmids and shaken at 37 C overnight. The overnight culture (15 mL) was added to two 1-L flasks of Terrific Broth supplemented with 50 mg/mL ampicillin and 10 mg/mL tetracycline and shaken at 37 C. Upon reaching an OD600 of 0.6, protein expression was induced with isopropyl-1-thio-D-galactopyranoside to a final concentration of 0.5 mM. To aid in proper protein folding and cofactor biosynthesis, adenosine triphosphate (1 mM), d-aminolevulinic acid (450 mM), and riboflavin (3 mM) was also added to each flask. The flasks were shaken for 16 hours at 25 C and the cells were harvested by centrifugation at 5000g for 10 minutes at 4 C and stored at 80 C. The cell paste was resuspended in lysis buffer (50 mM HEPES [pH 7.5], 1 mM L-arginine, 250 mM NaCl, 5% v/v glycerol, 1 mM b-mercaptoethanol) with protease inhibitors (0.3 mM aprotinin, 1 mM E-64, 1 mM leupeptin, 1 mM bestatin, 1 mM pepstatin, and 100 mM phenylmethylsulfonyl fluoride). Cells were lysed by passage through an Emulsiflex homogenizer and cell debris was removed by centrifugation at 35,000 rpm for 30 minutes at 4 C. The clarified lysate was rocked with 2 mL PerfectPro Ni-NTA Superflow resin (5Prime, Gaithersburg, MD) for 1 hour at 4 C before application to a gravity flow column. The column was washed with 50 mL lysis buffer with 5 mM imidazole added, and the protein was eluted with 50 mL lysis buffer with 150 mM imidazole added. The eluted protein was then concentrated to 1 mL using a 10,000 MWCO spin concentrator. The protein was loaded onto a ENrich SEC 650 column (Bio-Rad, Hercules, CA), equilibrated with 50 mM HEPES [pH 7.5], 50 mM NaCl, 10% v/v glycerol, 8 mM tetrahydrobiopterin, 1 mM dithiothreitol, and eluted with a flow rate of 0.5 mL/ min. Fractions containing rat nNOS Y1197X (as analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis) were pooled and concentrated. Protein aliquots were frozen in liquid N2 and stored at 80 C. Protein concentrations were determined using the method of Bradford with bovine serum albumin as the standard.

Neuronal Nitric Oxide Synthase Activity Assays Steady-state kinetic assays were performed in clear 96well microplates in 300 mL total volumes. NO formation was detected as an increase in absorbance at 401 nm using the oxyhemoglobin (HbO2) assay as described previously.8 Reaction mixtures contained 50 mM HEPES (pH 7.5), 500 mM NaCl, 1 mM L-arginine, 1 mM dithiothreitol, 10 mM tetrahydrobiopterin, 100 mM NADPH, 1 mM CaCl2, 8 mM HbO2, 1.2 mM calmodulin, and 50 nM nNOS. NADPH oxidation was monitored as a decrease in absorbance at 340 nm using the assay conditions mentioned, except that HbO2 was omitted from the reactions.

Molecular Modeling Investigations Homo sapiens NOS1 protein sequence was obtained from the NCBI database. NOS1 orthologs from animalia were sampled by screening the RefSeq protein database by using

Gastroenterology Vol. 148, No. 3

blastp (http://blast.ncbi.nlm.nih.gov). A multiple sequence alignment with 13 selected NOS1 orthologs was obtained by using ClustalW9 (Figure 2B). The multiple sequence alignment of the 13 sequences cited here (Figure 2B) shows that the tyrosine in position 1202 is invariant among the NOS1 orthologs sampled from animalia. Blocks of the same color show groups of identical or similar amino acids. The black arrowheads indicate the highly conserved tyrosine mutated in our patients. Given the location of the Y1202STOP mutation in the NOSred domain, we used modeller10 to calculate structural models of the human WT NOSred domain (residues 755–1434) and the human NOSred Y1202X mutant protein (residues 755–1202) by using as a protein 3-dimensional (3D) template the structure of the R norvegicus NOSred.11 Cofactors FAD, FMN, and NADPH were docked into the 3D model of the human WT NOS1 and into the 3D model of the NOS1 Y1202X mutant protein12 by using cofactor coordinates available in the R norvegicus NOS1 crystal structure (PDB_ID: 1tll.pdb).11 Final models were examined in PyMOL (http://www. pymol.org/) and where side-chain packing led to clashes in the protein structure, alternative side-chain rotamers were evaluated. The human NOS1 has the National Center for Biotechnology Information accession number NP_000611.1. Accession numbers for the other sequence fragments are from animalia: Rattus norvegicus, NP_434686.1; Gorilla gorilla, XP_004054011.1; Papio anubis, XP_003907271.1; Saimiri boliviensis, XP_003932255.1; Macaca mulatta, XP_001083352.2; Bos mutus, XP_005888367.1; Camelus ferus, XP_006188961.1; Bubalus bubalis, XP_006043099.1; Equus caballus, XP_001915005.3; Cavia porcellus, XP_005007269.1; Canis familiaris, NP_001182074.1; Elephantulus edwardii, XP_006890466.1. The encoded nNOS protein functions as a homodimer and each monomer consists of an N-terminal catalytic oxidase domain (NOSox) and a C-terminal electron-supplying reductase domain (NOSred) linked by a 32 residue Ca2þ/ calmodulin binding region (Figure 2A). NOSred binds NADPH, FAD, and FMN and transfers electrons from NADPH via the flavins to the heme cofactor in NOSox, which in turn catalyzes the sequential monoxygenation of L-arginine to Nhydroxyarginine, followed by oxidation of this intermediate to form citrulline and NO.11 Tyr1202 resides in the NOSred module and we hypothesize that the Tyr1202STOP (Y1202X) mutation abolishes FAD and NADPH binding. NOSred belongs to a large protein family that includes NADPH-dependent cytochrome P450 reductase and sulfite reductase flavoprotein and share a conserved organization of the FMN, FAD, and NADPH binding domains. R norvegicus NOSred was previously crystallized in complex with NADPH, FMN, and FAD cofactors11 (PDB_ID: 1TLL). Accordingly, our 3D model of the human WT NOSred module contains bound NADPH, FAD, and FMN (Figure 2E). The 3D model of the truncated protein lacks 232 residues at the C-terminus, which are known to be involved in NADPH and FAD binding (Figure 2E). Specifically, H-bond and interactions between Y1202 and NADPH and FAD are highlighted (Figure 2E).

March 2015

Nitric Oxide Synthase 1 Expression in Fibroblasts Relative changes in Nos1 messenger RNA expression were calculated using real-time quantitative polymerase chain reaction assay. Total RNA was isolated from patient II3, his father (I-2), and control fibroblast cells. Ten nanograms RNA from each sample was used as a template for complementary DNA preparation using random primers (Promega #A3802, Madison, WI). Reverse transcription polymerase chain reaction was performed using SYBR green assay. Nos1 messenger RNA expression was measured at 3 different messenger RNA positions—the boundaries of exons 5–6, 18–19, and 26–27 (Supplementary Table 1). Delta Ct (2DDct) values were calculated using the glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) gene as a reference. NOS1 expression was barely detectable in all primary fibroblasts tested.

Role of NOS1 in Pathogenesis of Achalasia 536.e3

4.

5.

6.

7.

8. 9.

References 1. Bredenoord AJ, Fox M, Kahrilas PJ, et al. Chicago classification criteria of esophageal motility disorders defined in high resolution esophageal pressure topography. Neurogastroenterol Motil 2012;24(Suppl 1):57–65. 2. Edvardson S, Cinnamon Y, Jalas C, et al. Hereditary sensory autonomic neuropathy caused by a mutation in dystonin. Ann Neurol 2012;71:569–572. 3. Schwarz JM, Rodelsperger C, Schuelke M, et al. MutationTaster evaluates disease-causing potential

10.

11.

12.

of sequence alterations. Nat Methods 2010;7: 575–576. Sivarao DV, Mashimo HL, Thatte HS, et al. Lower esophageal sphincter is achalasic in nNOS(-/-) and hypotensive in W/W(v) mutant mice. Gastroenterology 2001;121:34–42. Kim CD, Goyal RK, Mashimo H. Neuronal NOS provides nitrergic inhibitory neurotransmitter in mouse lower esophageal sphincter. Am J Physiol 1999;277:G280–G284. Gerber NC, Ortiz de Montellano PR. Neuronal nitric oxide synthase. Expression in Escherichia coli, irreversible inhibition by phenyldiazene, and active site topology. J Biol Chem 1995;270:17791–17796. Roman LJ, Sheta EA, Martasek P, et al. High-level expression of functional rat neuronal nitric oxide synthase in Escherichia coli. Proc Natl Acad Sci U S A 1995; 92:8428–8432. Hevel JM, Marletta MA. Nitric-oxide synthase assays. Methods Enzymol 1994;233:250–258. Persson B. Bioinformatics in protein analysis. EXS 2000; 88:215–231. Sanchez R, Sali A. Comparative protein structure modeling. Introduction and practical examples with modeller. Methods Mol Biol 2000;143:97–129. Garcin ED, Bruns CM, Lloyd SJ, et al. Structural basis for isozyme-specific regulation of electron transfer in nitricoxide synthase. J Biol Chem 2004;279:37918–37927. Pierri CL, Parisi G, Porcelli V. Computational approaches for protein function prediction: a combined strategy from multiple sequence alignment to molecular docking-based virtual screening. Biochim Biophys Acta 2010;1804:1695–1712.

536.e4

Shteyer et al

Gastroenterology Vol. 148, No. 3

Supplementary Table 1.Exons Primers for NOS1 Expression in Fibroblasts Primer

Forward

Reverse

Nos1 exons 5–6 (110 bp) Nos1 exons 18–19 (86 bp) Nos1 exons 26–27 (112 bp) GAPDH exons 2–3 (98 bp)

CCCTCTCGCCAAAGAGTTTAT GATCCTGAAGATGAGGGAAGG GCAACAGCGGCAATTTGATA ATGGGGAAGGTGAAGGTCGG

TTCACCTCTTCCAGCCTTTC TCCCACACAGAAGACATCAC CAGGGTCTCTTCCCTGTAGATA TGACGGTGCCATGGAATTTG

GAPDH, glyceraldehyde-3-phosphate dehydrogenase (phosphorylating).