Am J Physiol Gastrointest Liver Physiol 309: G87–G99, 2015. First published May 28, 2015; doi:10.1152/ajpgi.00421.2014.

TRPV1 sensitization mediates postinflammatory visceral pain following acute colitis Tamia K. Lapointe,1 Lilian Basso,2,3,4 Mircea C. Iftinca,1 Robyn Flynn,1 Kevin Chapman,1 Gilles Dietrich,2,3,4 Nathalie Vergnolle,1,2,3,4 and Christophe Altier1 1

Department of Physiology and Pharmacology, Inflammation Research Network, University of Calgary, Calgary, Alberta, Canada; 2Institut National de la Santé et de la Recherche Medicale (INSERM), Toulouse, France; 3Le Centre National de la Recherche Scientifique (CNRS), Toulouse, France; and 4Université de Toulouse III Paul Sabatier, Centre de Physiopathologie de Toulouse Purpan (CPTP), Toulouse, France Submitted 21 November 2014; accepted in final form 20 May 2015

Lapointe TK, Basso L, Iftinca MC, Flynn R, Chapman K, Dietrich G, Vergnolle N, Altier C. TRPV1 sensitization mediates postinflammatory visceral pain following acute colitis. Am J Physiol Gastrointest Liver Physiol 309: G87–G99, 2015. First published May 28, 2015; doi:10.1152/ajpgi.00421.2014.—Quiescent phases of inflammatory bowel disease (IBD) are often accompanied by chronic abdominal pain. Although the transient receptor potential vanilloid 1 (TRPV1) ion channel has been postulated as an important mediator of visceral hypersensitivity, its functional role in postinflammatory pain remains elusive. This study aimed at establishing the role of TRPV1 in the peripheral sensitization underlying chronic visceral pain in the context of colitis. Wild-type and TRPV1-deficient mice were separated into three groups (control, acute colitis, and recovery), and experimental colitis was induced by oral administration of dextran sulfate sodium (DSS). Recovery mice showed increased chemically and mechanically evoked visceral hypersensitivity 5 wk post-DSS discontinuation, at which point inflammation had completely resolved. Significant changes in nonevoked pain-related behaviors could also be observed in these animals, indicative of persistent discomfort. These behavioral changes correlated with elevated colonic levels of substance P (SP) and TRPV1 in recovery mice, thus leading to the hypothesis that SP could sensitize TRPV1 function. In vitro experiments revealed that prolonged exposure to SP could indeed sensitize capsaicin-evoked currents in both cultured neurons and TRPV1transfected human embryonic kidney (HEK) cells, a mechanism that involved TRPV1 ubiquitination and subsequent accumulation at the plasma membrane. Importantly, although TRPV1-deficient animals experienced similar disease severity and pain as wild-type mice in the acute phase of colitis, TRPV1 deletion prevented the development of postinflammatory visceral hypersensitivity and pain-associated behaviors. Collectively, our results suggest that chronic exposure of coloninnervating primary afferents to SP could sensitize TRPV1 and thus participate in the establishment of persistent abdominal pain following acute inflammation. visceral pain; inflammatory bowel disease; transient receptor potential vanilloid 1; substance P; peripheral sensitization INFLAMMATORY BOWEL DISEASE (IBD), encompassing Crohn’s disease and ulcerative colitis, is a condition characterized by chronic inflammation of the gastrointestinal tract and severe abdominal pain. Although clinical remission can be achieved, a large subset of patients (33–57%) continues to suffer from debilitating pain after the resolution of inflammation and throughout quiescent phases of the disease (37, 47). Despite

Address for reprint requests and other correspondence: C. Altier, Dept. of Physiology and Pharmacology, Inflammation Research Network, Univ. of Calgary, 3330 Hospital Dr., N.W., Calgary, Alberta, T2N 4N1, Canada (e-mail: [email protected]). http://www.ajpgi.org

significant advances in our understanding of the etiology of IBD and the processes underlying sensory transduction and nociception, little is known about the pathophysiological mechanisms involved in IBD-related chronic pain. The polymodal ion channel transient receptor potential vanilloid 1 (TRPV1) is expressed by extrinsic primary afferents and responds to a variety of noxious stimuli, including capsaicin, mustard oil, and noxious heat (reviewed in Refs. 8 and 42). Activation of TRPV1 at the nerve terminal of sensory neurons leads to the release of neuropeptides such as substance P (SP) and calcitonin gene-related peptide (CGRP) in the colonic mucosa, which contributes to inflammatory responses by modulating leukocyte migration and plasma extravasation (4, 9, 37, 47). This process is accompanied by visceral hypersensitivity, a phenomenon that relies mainly on peripheral sensitization of colonic primary afferents. A variety of proinflammatory mediators, including bradykinin, histamine, and proteases, have been shown to participate in peripheral sensitization by modulating TRPV1 channel function and membrane expression (3, 22, 24, 42, 53, 57). Although peripheral sensitization is normally reversible upon the resolution of inflammation, pain pathways sensitized during the course of acute inflammation can fail to return to their physiological state, thus contributing to the establishment of chronic pain. A growing body of evidence suggests a role for TRPV1 in IBD-related visceral hypersensitivity. Notably, upregulation of TRPV1 expression has been observed in both rodent models of colitis and colonic biopsies from patients with IBD (15, 16, 35, 55). Increased TRPV1 expression has also been shown to correlate with the severity of abdominal pain in patients with IBD in clinical remission, thus identifying TRPV1 as an important predictor of visceral hypersensitivity (2). Although these observations suggest a role for TRPV1 in the development of visceral pain during the acute phase of colitis, functional studies have yet to evaluate its contribution to the establishment of postinflammatory sensitization and chronic pain. A better understanding of these processes has tremendous potential to improve pain management in patients with IBD. Therefore, our study aimed to characterize the mechanisms underlying pain signaling during both the acute and recovery phases of experimental colitis. Using a combination of pain behavior assessment tools in wild-type (WT) and TRPV1deficient (TRPV1⫺/⫺) mice, we demonstrated that a single bout of colonic inflammation could induce visceral pain that persisted long after the resolution of inflammation. Importantly, our results indicate that TRPV1 plays a pivotal role in

0193-1857/15 Copyright © 2015 the American Physiological Society

G87

G88

TRPV1 MEDIATES POSTINFLAMMATORY VISCERAL PAIN

the establishment of chronic pain during the recovery period, in stark contrast to the acute phase of the disease. Mechanistically, we demonstrated that prolonged exposure to SP could potentiate capsaicin-evoked currents in both primary and recombinant culture systems, a mechanism that involves TRPV1 ubiquitination and its subsequent accumulation at the cell surface. Taken together, our findings suggest a feedback regulation of TRPV1 by SP, which likely participates in the establishment of long-lasting postinflammatory visceral pain. MATERIALS AND METHODS

Mice. Six-week-old WT C57BL/6 mice were obtained from Charles River Laboratories (Montreal, Quebec, Canada). TRPV1⫺/⫺ mice (strain B6.129X1-Trpv1tm1Jul/J) were originally obtained from Jackson Laboratories (Bar Harbor, ME) and bred in the University of Calgary Animal Resource Center (P. Whelan and S. Mandadi). All mice were genotyped with the following primers: WT: cctgctcaacatgctcattg (984 bp); heterozygotes: tcctcatgcacttcaggaaa (450 and 984 bp); TRPV1⫺/⫺: tggatgtggaatgtgtgcgag (450 bp) (Jackson Laboratories). Transgenic Ai32/TRPV1-cre mice were bread in the University of Calgary Animal Resource Center (G. Zamponi and P. Stemkowski) by crossing mice homozygous for the Rosa-CAG-LSL-ChR2(H134R)-EYFP-WPRE conditional allele (loxP-flanked STOP cassette) [strain B6;129SGt(ROSA)26Sortm32(CAG⫺COP4*H134R/EYFP)Hze/J; hereafter Ai32] with mice expressing cre recombinase in TRPV1 cells [strain B6.129Trpv1tm1(cre)Bbm/J; hereafter TRPV1-cre] (both from Jackson Laboratories). All mice were housed under standard conditions with drinking water and food available ad libitum. All experiments were conducted on aged-matched animals, under protocols approved by the University of Calgary Animal Care Committee and in accordance with the international guidelines for the ethical use of animals in research and guidelines of the Canadian Council on Animal Care. Induction of colitis and in vivo study design. Colonic inflammation was induced in WT and TRPV1⫺/⫺ mice by administration of 2.5% (wt/vol) dextran sulfate sodium (DSS; MP Biochemicals, Solon, OH) in drinking water for 7 days. Mice were separated into three groups: control untreated, acute DSS (killed after 7 days on DSS), and recovery (killed 5 wk post-DSS discontinuation). Water consumption was monitored and found to be equal between groups. Weight changes were measured weekly in all experiments. Macroscopic damage was assessed and scored based on the following parameters: erythema (0, absent; 1, ⬍1 cm; 2, ⬎1 cm), edema (0, absent; 1, present), fecal blood (0, absent; 1, present), strictures (0, absent; 1, present), and adhesion (0, absent; 1, present). Colonic length and thickness were also measured at the time of death. Nonevoked pain behavior measurements. Nonevoked pain-related behaviors were assessed using the noninvasive animal behavior recognition system LABORAS (Metris, Hoofdorp, Holland). LABORAS is a fully automated behavior recognition and tracking system using mechanical vibrations to classify different natural behaviors (e.g., eating, drinking, climbing, locomotion, etc.) and has previously been validated for pharmacological studies (44). Mice were placed in the LABORAS cages for a period of 23 h, with drinking water and food available ad libitum and under normal light cycles. Natural behaviors recorded during the peak of nocturnal activity (9:00 PM to 1:00 AM) were used for analysis. Chemically evoked nocifensive behavior measurements. Mice were anesthetized with isofluorane and intracolonically administered either saline or 0.5% allyl isothiocyanate (mustard oil) (Sigma-Aldrich, Oakville, Ontario, Canada). Petroleum jelly was used around the perianal area to avoid stimulation of somatic areas. Mouse responses were video recorded for 20 min. No nocifensive behaviors were observed before intracolonic administration of mustard oil. Painrelated behaviors, encompassing abdominal retractions and freezing episodes (⬎5 s ⫽ 1; for freezing episodes ⬎15 s, each consecutive 15

s ⫽ 1), were then compiled and plotted as the number of nocifensive behaviors over time, as well as the total number of behaviors over 20 min (19). Visceromotor response to colorectal distension. Visceromotor response (VMR) to colorectal distension (CRD) was performed as previously described (7). Briefly, mice were anesthetized with xylazine and ketamine and implanted with two electrodes in the abdominal external oblique muscle. The electrodes were exteriorized through the back of the neck and protected by a plastic tube sutured to the skin. Mice were allowed to recover for 3 days before CRD. For recording, electrodes were connected to an electromyogram acquisition system via a Bio Amplifier (both from ADInstruments, Colorado Springs, CO), and a 10.5-mm-diameter balloon catheter (Edwards LifeSciences, Irvine, CA) was inserted 5 mm proximal to the mouse rectum. Mice were subjected to four 10-s distensions (15, 30, 45, and 60 mmHg pressure) with 5-min rest intervals. Electromyographic activity of the abdominal muscle was recorded, and VMR was calculated using LabChart 7 (ADInstruments). Because of the overt inflammatory response and extensive tissue damage observed in acutely treated mice, only control and recovery animals were subjected to CRD. In vivo intestinal permeability assay. Movement of 3-kDa FITCdextran (Sigma-Aldrich) from the gut lumen to plasma was used to assess intestinal permeability in mice. Mice were gavaged with 10 mg of FITC-dextran diluted in PBS 3.5 h before death. Blood was obtained via cardiac puncture and centrifuged at 1,000 g for 15 min at room temperature. Plasma samples were then collected, and fluorescence reading performed in duplicate using a Victor X4 microplate reader (Perkin-Elmer, Waltham, MA). Data were expressed as total fluorescence units in 200 ␮l of plasma. Myeloperoxidase activity assay. Myeloperoxidase (MPO) activity was used as an index of colonic granulocyte infiltration. Colonic tissue was homogenized in 0.5% hexadecyltrimethylammonium bromide phosphate buffer (30 ␮l/mg of tissue) using 0.9 –2.0-mm stainless steel beads and a Bullet blender (both from Next Advance, Averill Park, NY). Lysates were centrifuged at 13,000 g for 5 min at 4°C. Supernatants were mixed with potassium phosphate buffer (pH 6) containing hydrogen peroxide and O-dianisidine dihydrochloride (all from Sigma-Aldrich). Optical density was read at 450 nm for 2 min at 30-s intervals using a SpectraMax Plus microplate reader (Molecular Devices, Sunnyvale, CA), and values were expressed as MPO units per milligram of tissue. Measurement of colonic cytokine levels. Distal colonic samples from WT and TRPV1⫺/⫺ were homogenized in RIPA buffer [1⫻ PBS, 1% Igepal CA-630, 0.5% sodium deoxycholate, and 0.1% SDS (all from Sigma-Aldrich)] containing a Complete-Mini protease inhibitor tablet (Roche Diagnostics, Laval, Quebec, Canada). Lysates were centrifuged at 10,000 g for 10 min at 4°C, supernatants were collected, and protein concentration was quantified and normalized using a Bradford assay (Bio-Rad Laboratories, Mississauga, Ontario, Canada). The levels of TNF-␣, IL-6, and granulocyte colony-stimulating factor (G-CSF) in each sample were analyzed using a multiplex assay with the MILLIPLEX MAP Mouse Cytokine/Chemokine Panel (EMD Millipore, Billerica, MA) on a Luminex xMAP multiplexing technology (Eve Technologies, Calgary, Alberta, Canada). mRNA extraction and quantitative PCR from murine tissue. Thoracolumbar (T10-L1) and lumbosacral (L6-S1) dorsal root ganglia (DRGs) were collected in RNA Later (Invitrogen, Burlington, Ontario, Canada), incubated at 4°C overnight, and stored at ⫺80°C until use. Tissue samples were homogenized in RLT buffer (Qiagen, Toronto, Ontario, Canada) using 0.5-mm stainless steel beads and a Bullet blender. Total RNA was extracted using an RNeasy Mini kit (Qiagen), according to the manufacturer’s instructions, including on-column DNase digestion. The quality and quantity of RNA were determined using a Nanodrop 2000c spectrophotometer (ThermoFisher Scientific, Montréal, Quebec, Canada). Relative gene expression (normalized to GAPDH) was determined by qPCR using Quan-

AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00421.2014 • www.ajpgi.org

TRPV1 MEDIATES POSTINFLAMMATORY VISCERAL PAIN

titect SYBR Green PCR Master Mix (Qiagen) and a StepOnePlus real-time PCR detection system (Applied Biosystems, Burlington, Ontario, Canada). The following primers were used: GAPDH: gatgctggtgctgagtatgtcg, gtggtgcaggatgcattgctga; TRPV1: caacaagaaggggcttacacc, tctggagaatgtaggccaagac. Immunohistochemistry and colocalization analysis. Colonic tissue was rolled (distal to proximal), fixed in 4% paraformaldehyde overnight, and incubated in 30% sucrose at 4°C for 3 days before being embedded in optimal cutting temperature (OCT) solution (ThermoFisher Scientific). Frozen samples were stored at ⫺20°C until use. Embedded tissues were sliced (10-␮m thickness) and mounted on Superfrost Plus slides (VWR International, Mississauga, Ontario, Canada). Slides were washed twice in PBS, and nonspecific binding blocked for 1.5 h at room temperature in PBS containing 0.3% Triton X-100 (Sigma-Aldrich) and 3% heat-inactivated fetal bovine serum (HI-FBS). Slides were incubated at 4°C overnight with rat anti-SP (1:200; Millipore) and/or rabbit anti-CGRP (1:2,000; Millipore). Slides were washed in PBS twice and incubated in Alexa 594conjugated anti-rat and Alexa 488-/Alexa 630-conjugated anti-rabbit antibodies (1:1,000; Invitrogen). Slides were washed in PBS twice and mounted with Aqua PolyMount (Polysciences, Warrington, PA). Digital images were acquired with a Zeiss LSM 510 Meta confocal microscope and AxioCam HRm camera and analyzed with LSM510 Meta (all from Zeiss, Oberkochen, Germany) at ⫻20 or ⫻40 magnification (5 images/stack, 0.63 ␮m/optical section). The Ai32/TRPV1-cre mouse was used as a tool to enhance sensitivity and specificity for the detection of TRPV1 in colonic sections. Colonic sections were processed as mentioned above and coimmunostained with chicken anti-green fluorescence protein (GFP) (1: 1,000; Aves Laboratory, Tigard, OR) and Alexa 488-conjugated anti-chicken (1:1,000; Invitrogen) antibodies. Colocalization line scan was performed using ImageJ (plot profile plugin), and line scans of each channel were overlapped. Colocalization analysis was performed using an ImageJ algorithm originally developed in the laboratory of E. F. Stanley (University of Toronto, Toronto, Ontario, Canada) (29). Briefly, confocal images were threshold corrected, and the threshold was adjusted to the onset of the histogram of the frequency of staining intensities. Intensity correlation analysis was performed as previously described (29). Each image was background subtracted. On the basis of the algorithm, in an image where the intensities vary together, the product of the differences from the mean (PDM) will be positive. If the pixel intensities vary asynchronously (the channels are segregated so that a red pixel is above average and a corresponding green pixel is below average), then most of the PDM will be negative. The intensity correlation quotient (ICQ) is based on the nonparametric sign-test analysis of the PDM values and is equal to the ratio of the number of positive PDM values to the total number of pixel values. The ICQ values are distributed between ⫺0.5 and ⫹0.5 by subtracting 0.5 from this ratio: random staining: ICQ ⬇ 0; segregated staining: 0 ⬎ ICQ ⱖ ⫺0.5-0; dependent staining: 0 ⬍ ICQ ⱕ ⫹0.5. SP and CGRP enzyme immunoassays. Colonic samples were snap frozen immediately after collection and stored at ⫺80°C until use. Samples were homogenized in enzyme immunoassay (EIA) buffer (1 M phosphate solution containing 1% BSA, 4 M sodium chloride, 10 mM EDTA, and 0.1% sodium azide; 30 ␮l/mg of tissue) using 0.9 –2.0-mm stainless steel beads and a Bullet blender. Samples were centrifuged at 13,000 g for 10 min, and supernatant was assayed with SP (Cayman Chemical, Ann Arbor, MI) and CGRP (Bertin Pharma, Montigny Le Bretonneux, France) EIA kits, according to the manufacturer’s instructions. Plasmids. The NK-1-pcDNA3.1⫹ expression vector was purchased from Missouri S&T cDNA Resource Center (Rolla, MO). Rat TRPV1 containing an extracellular HA epitope (TRPV1-HA) was made by introducing a ClaI restriction site into TRPV1-pcDNA5/FRT (A. Patapoutian) between residues H614 and K615, located in the S5-S6 linker upstream of the reentrant loop, then cloning in annealed sticky-ended oligonucleotides coding for the HA sequence (20). TRP

G89

ankyrin 1 (TRPA1)-pcDNA5/FRT (A. Patapoutian) was used as a PCR template to make TRPA1-yellow fluorescent protein (YFP) by introducing NheI and KpnI sites and cloning into pEYFP-N1 (Clontech, Mountain View, CA). Functionality of TRPV1-HA and TRPA1YFP was validated in transfected human embryonic kidney (HEK) cells by measuring capsaicin- or mustard oil-evoked calcium mobilization, respectively. HEK cells, cultured DRG neurons, and in vitro experimental design. HEK 293 tsA201 cells (American Type Culture Collection, Manassas, VA) were cultured in DMEM supplemented with 10% HI-FBS, 100 ␮g/ml streptomycin, 100 U/ml penicillin, and 2 mM L-glutamine (all from Invitrogen). Cells were maintained at 37°C with 5% CO2 in 96% humidity and subcultured weekly with 2⫻ trypsinEDTA (Invitrogen). For experiments, cells were grown onto either culture-treated Petri dishes or polyornithine-coated (Sigma-Aldrich) glass coverslips and cotransfected with both the NK-1 receptor and TRPV1-HA or TRPA1-YFP plasmids using calcium phosphate (1 ␮g of DNA construct/ml). After an 8-h incubation period, cells were rinsed once in PBS and allowed to proliferate for 48 h before treatment. Depending on the experiments, HEK cells were treated with 150 nM or 1 ␮M SP (Sigma-Aldrich) for 1 or 18 h. For some experiments, the broad-spectrum PKC inhibitor GF109203X (1 ␮M; Tocris Bioscience, Bristol, UK) was used at the same time as SP treatment. The PKC agonist phorbol myristate acetate (PMA; 100 nM, 18 h; Millipore) was used as a positive control for PKC-mediated TRPV1 membrane targeting. Excised mouse DRGs were incubated in HBSS containing 2 mg/ml collagenase and 4 mg/ml dipase (Invitrogen) for 45 min at 37°C. DRGs were rinsed twice in HBSS and once in culture medium [DMEM supplemented with 10% HI-FBS, 50 ng/ml nerve growth factor, 100 ␮g/ml streptomycin, 100 U/ml penicillin, and 2 mM L-glutamine (all from Invitrogen)]. DRGs were then triturated five to seven times in culture media and seeded onto glass coverslips coated with both polyornithine and laminin (Sigma-Aldrich). DRG neurons were cultured for 6 h at 37°C with 5% CO2 in 96% humidity before treatment with SP (150 nM, 18 h). Surface labeling. Cells were cotransfected and treated according to experimental design. At the time of experiment, cells were chilled on ice for 20 min and then incubated with 0.75 mg/ml EZ-link SulfoNHS-LC-Biotin (Thermo Fisher Scientific) in HBSS for 1 h on a rocking platform at 4°C. Cells were washed and quenched for 20 min with 100 mM glycine-HBSS, rinsed twice with HBSS, and lysed in RIPA buffer ⫹ protease inhibitor. Lysates were centrifuged at 10,000 g for 10 min at 4°C, supernatants were collected, and protein concentration was quantified using a Bradford assay. For each sample, an aliquot of total lysate was kept aside for future use. For membrane protein isolation, 750 ␮g total protein was collected from each sample and adjusted to a final volume of 500 ␮l. Samples were incubated with high-capacity neutravidin agarose resin beads (Thermo Fisher Scientific) for 1.5 h at 4°C while tumbling. Samples were centrifuged at 3,000 g for 1 min at 4°C, and beads were washed four times in RIPA buffer. Both biotinylated fractions and total lysates were incubated with 4⫻ electrophoresis buffer for 10 min at room temperature, and a sample was stored at ⫺20°C until use for SDS-PAGE and Western blotting. Immunoprecipitation. Cells were cotransfected and treated according to experimental design. At the time of experiment, cells were rinsed once in PBS and lysed with RIPA buffer ⫹ protease inhibitor. Lysates were centrifuged at 10,000 g for 10 min at 4°C, and supernatants were collected. Protein concentration was quantified and normalized using a Bradford assay. Samples were immunoprecipitated with a rat anti-HA antibody (0.5 ␮l/ml; Roche) and protein A/G-Sepharose beads (1:1 ratio) overnight at 4°C. Beads were washed three times and incubated with 4⫻ electrophoresis buffer for 10 min at room temperature. Samples were stored at ⫺20°C until use for SDS-PAGE and Western blotting.

AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00421.2014 • www.ajpgi.org

G90

TRPV1 MEDIATES POSTINFLAMMATORY VISCERAL PAIN

Western blotting. Total lysates, biotinylated fractions and immunoprecipitated samples were separated by SDS-PAGE (7–10%) and transferred onto nitrocellulose membranes (Sigma-Aldrich). Membranes were blocked in 5% nonfat dry milk or 5% BSA in TBS ⫹ 0.1% Tween (TBS-T) for 1 h, then probed with either mouse anti-HA antibody (1:1,000; Covance, Dedham, MA), mouse anti-ubiquitin (1:1,000; BD Biosciences, Mississauga, Ontario, Canada), or rabbit anti-TRPV1 (1:1,000; Neuromics, Edina, MN) at 4°C overnight or rabbit anti-GFP antibody (1:5,000; Invitrogen) for 1 h at room temperature. Membranes were then washed three times with TBS-T and incubated with horseradish peroxidase (HRP)-conjugated antimouse or anti-rabbit antibodies (1:1,000; GE Healthcare, Pittsburgh, PA) for 1 h at room temperature. Bands were visualized using the Immobilon Western chemiluminescent HRP Substrate (Millipore), and band density was calculated using Image J. Mouse anti-GAPDH (1:1,000; Santa Cruz Biotechnology, Santa Cruz, CA) and anti-Na/K ATPase (1:1,000; Abcam, Toronto, Ontario, Canada) were used to control for equal loading of the total and membrane-associated fractions, respectively. Electrophysiology. Whole-cell patch-clamp experiments were performed on both isolated DRG neurons and HEK cells cotransfected with HA-tagged TRPV1, the SP receptor NK-1, and a GFP reporter gene. Cells were recorded with an extracellular solution containing (in mM) 140 NaCl, 1.5 CaCl2, 5 KCl, 2 MgCl2, 10 HEPES, and 25 D-glucose (all from Sigma-Aldrich), pH 7.4 adjusted with NaOH. HEK cells expressing TRPV1 and NK-1 were visualized with an

Control Recovery

100 80 1

2

5

6

2 1 0

Control

**

6 4 2

Control

**

4.0 2.0 0.3

Acute Recovery

Control

H

15

** 10

5

Control

Acute

Recovery

0.2 0.1 0.0

Acute Recovery

15

**

10

5

*

500 400 300 200 100 0

Control

Acute Recovery

I

Acute Recovery

*

75 50 25 2 1 0

0

0

0.3

Control

0.0

0

0.4

F 6.0

8

**

0.5

Acute Recovery

E

10

MPO activity (U/mg tissue)

Colon length (cm)

4

Weeks

D

TNF (pg/mg)

3

3

G-CSF (pg/mg)

120

**

4

Colonic wall thickness (mm)

140

C

FITC-Dextran (A.F.U.)

160

Macroscopic damage

180

0

G

B

H2O

DSS

IL-6 (pg/mg)

% of original weight

A

Olympus 1X51 epifluorescence microscope (Olympus, Center Valley, PA) and identified via eGFP fluorescence. TRPV1 currents were measured using conventional whole-cell patch clamp with pipette electrodes (⬃3 M⍀ resistance) pulled from borosilicate glass (Harvard Apparatus, Holliston, MA) using a DMZ Universal puller (Zeitz, Martinsried, Germany). The internal pipette solution contained the following (in mM): 120 CsCl2, 3 MgCl2, 10 EGTA, 10 HEPES, 2 ATP, and 0.5 GTP, pH 7.2 adjusted with CsOH. All experiments were conducted at 22 ⫾ 2°C. Recordings were carried out using an Axopatch 200B amplifier and the pClamp 10.4 software (Molecular Devices). Data were filtered at 1 kHz (8-pole Bessel) and digitized at 10 kHz with a Digidata 1,440 A A/D converter (Molecular Devices). Series resistance was 8.6 ⫾ 0.9 M⍀ before compensation (B85%), and average HEK and DRG cell capacitance were 26.3 ⫾ 2.95 pF and 16.85 ⫾ 2.1 pF, respectively. Only cells showing stable voltage control throughout the recording were used for analysis. Capsaicin was used at a concentration of 100 nM. The currents were recorded using a holding potential of 0 mV and stepping between ⫺100 and ⫹100 mV, in 20-mV intervals. Current densities (pA/pF) presented in Fig. 5C were measured in response to 100 nM capsaicin using a voltage step of ⫹100 mV. Statistical analysis. Numeric values were expressed as means ⫾ SE. The Student’s t-test was used to assess statistical significance when comparing two means, whereas one-way ANOVA followed by the Bonferroni post hoc test was used to compare three or more groups. For experiments comparing WT and TRPV1⫺/⫺ animals,

Control

Acute Recovery

Control

Acute Recovery

Fig. 1. Characterization of the dextran sulfate sodium (DSS) postinflammatory model of colitis. Disease severity was assessed in control, acute DSS, and recovery mice. A: an initial 5–7% weight loss was observed during the course of the DSS treatment. Recovery animals were back to their original weight 1 wk post-DSS discontinuation. B–F: acutely treated mice showed significant changes in macroscopic damage, colonic wall thickness and length, myeloperoxidase (MPO) activity, and epithelial intestinal permeability to FITC-dextran, all of which were reversible upon DSS discontinuation. G–I: while colonic levels of TNF-␣, IL-6, and granulocyte colony-stimulating factor (G-CSF) were significantly elevated in acutely treated animals, no differences could be observed between control and recovery littermates. Data are expressed as means ⫾ SE; n ⫽ 13–16 (A–E), 4 – 6 (F) animals/group. *P ⬍ 0.05, **P ⬍ 0.01 compared with untreated controls and recovery animals. AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00421.2014 • www.ajpgi.org

G91

TRPV1 MEDIATES POSTINFLAMMATORY VISCERAL PAIN

two-way ANOVA followed by the Bonferroni post hoc test was used to identify differences between groups. Statistical significance was established at P ⬍ 0.05. Statistical analyses were performed using Prism 6 (GraphPad, La Jolla, CA). RESULTS

Characterization of the DSS postinflammatory model of colitis. Mice were treated with 2.5% DSS for 7 days (acute DSS), after which a subgroup of animals was allowed to recover for 5 wk (recovery). Recovery animals were back to their original weight 1 wk post-DSS discontinuation (Fig. 1A). Acutely treated mice showed significant changes in macroscopic damage (Fig. 1B), colonic wall thickness (Fig. 1C), colon length (Fig. 1D), granulocyte infiltration (Fig. 1E), and intestinal epithelial permeability (Fig. 1F). Colonic levels of the proinflammatory cytokines TNF-␣, IL-6, and G-CSF were also measured as markers of disease activity and were found to be significantly upregulated in the acute phase of colitis (Fig. 1, G–I). All these changes were reversible upon DSS discontinuation, as no differences in any of the aforementioned parameters could be observed between control and recovery animals at the end of the 5-wk recovery period. Collectively, these results indicate overall remission of recovery mice. Acute colonic inflammation leads to persistent visceral pain. The LABORAS system was used to measure changes in nonevoked behaviors associated with visceral discomfort and pain (44). In keeping with recent studies using nonevoked behaviors to assess pain in a model of pancreatitis (11, 46), we chose to monitor the distance traveled by the animals and the amount of time they spent climbing. Both of these activities require stretch of the abdominal muscles and would therefore be affected in conditions of visceral pain. Analysis of the behavior recorded during the peak of nocturnal activity (9:00 PM to 1:00 AM) revealed that mice acutely treated with DSS covered ⬃2.5

*

40

**

20 0

Control

C'

Control Vehicle Acute Recovery

# nocifensive behaviours

80 60 40 20 0

0

5

D 2500 2000 1500

10

15

20

**

1000

*

500 0

Acute Recovery

Control

Acute Recovery

Control Recovery

0.20

* *

0.15 0.10 0.05 0.00

15

30

45

60

Distension pressure (mmHg)

C''

Total # nocifensive behaviours over 20 min

Distance (m)

60

Abdominal response (mVs-1)

B

Climbing time (sec)

A

times less distance than control littermates (Fig. 2A). A significant reduction in the time spent climbing could also be observed in these animals (Fig. 2B). Importantly, recovery mice demonstrated similarly altered behavior 5 wk post-DSS discontinuation, suggesting that these animals experience postinflammatory visceral discomfort. These observations were corroborated by chemically and mechanically evoked nocifensive responses. Both acutely treated and recovery mice showed a significant increase in the number of nocifensive behaviors (freezing episodes ⫹ abdominal contractions) in response to intracolonic administration of 0.5% mustard oil, compared with control and vehicle-treated mice (Fig. 2C). No nocifensive behaviors were observed before intracolonic administration of mustard oil. Furthermore, measure of VMR to CRD demonstrated increased abdominal responses in recovery animals subjected to distension pressures of 45 and 60 mmHg, compared with control littermates (Fig. 2D). Acutely treated mice were not subjected to CRD because of overt tissue damage. Taken together, these observations suggest that visceral pain triggered by acute colitis can persist long after the resolution of inflammation. Furthermore, our results demonstrate that nonevoked pain-related behaviors directly corroborate visceral hypersensitivity measured by chemically and mechanically evoked nocifensive responses. Persistent pain correlates with increased levels of SP and TRPV1 in recovery animals. The persistent visceral pain observed in recovery mice suggests that a single bout of colonic inflammation can induce long-lasting alterations at the nerve endings of colonic peptidergic afferent neurons. Given its implication in visceral hypersensitivity and IBD, we examined the modulation of the noxious transducer TRPV1 in the acute and recovery phases of colitis. TRPV1 mRNA and peripheral protein levels were assessed in whole colon-innervating DRGs (T10-L1, L6, and S1) and full-thickness colonic samples,

**

200 150

**

100 50 0

Control

Acute Recovery

Time (min) Fig. 2. Recovery mice exhibit postinflammatory visceral pain. A and B: mice subjected to acute DSS treatment showed a significant decrease in distance traveled and time spent climbing compared with control littermates. These behavioral changes persisted at least 5 wk post-DSS discontinuation (recovery). C= and C⬙: increases in abdominal retractions and freezing episodes (combined together as number of nocifensive behaviors) in response to intracolonic administration of 0.5% mustard oil could be observed in both acutely treated and recovery mice. D: these results were corroborated by visceromotor response (VMR) to colorectal distension (CRD), which showed visceral hypersensitivity in recovery animals at distension pressures of 45 and 60 mmHg. Data are expressed as means ⫾ SE; n ⫽ 7–12 (A, B, and D), 6 –10 (C) animals/group. *P ⬍ 0.05, **P ⬍ 0.01 compared with untreated controls; ⌽P ⬍ 0.05 compared with acutely treated animals. AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00421.2014 • www.ajpgi.org

G92

TRPV1 MEDIATES POSTINFLAMMATORY VISCERAL PAIN

were used to quantify these changes and revealed patterns of neuropeptide expression that corroborated our immunostaining data (Fig. 4, B and C). Importantly, levels of SP and CGRP were assessed on full-thickness colonic tissue samples, which accounted for neuropeptides found both within the nerve terminal of sensory afferent fibers and released within the colonic mucosa. TRPV1 plays a fundamental role in postinflammatory pain. To test whether the modulation of TRPV1 observed in recovery animals contributed to postinflammatory visceral pain, age-matched TRPV1⫺/⫺ mice were subjected to the same treatment as WT animals and disease activity and behavioral assessments performed as previously. TRPV1⫺/⫺ animals presented equivalent disease severity as WT mice during the acute stage of colitis, as measured by macroscopic damage (Fig. 5A), colonic wall thickness (Fig. 5B), colon length (Fig. 5C), and granulocyte infiltration (Fig. 5D). The time required for the complete resolution of inflammation was found to be similar to WT mice (Fig. 5, A–D). Colonic levels of TNF-␣ and IL-6 were also assessed in TRPV1⫺/⫺ mice as an index of disease activity. Similarly to WT animals, TRPV1⫺/⫺ mice showed upregulated levels of both cytokines in the acute phase of colitis, which were reversible upon DSS discontinuation (Fig.

B'

100 80

C'

Control

Acute Recovery

3

4

B"

e

l

Re co ve ry

120

**

Ac ut

*

** 300

tro

*

140

Co n

Colonic TRPV1 (% control over GAPDH)

A

Relative TRPV1 mRNA (DRGs) (% control)

respectively. These experiments revealed a significant increase in both TRPV1 mRNA transcript and protein levels in recovery animals, a process that appears to be initiated after the acute phase of inflammation, as no differences could be observed between control and acutely treated animals (Fig. 3, A and B). It was previously reported that, in the gastrointestinal tract, ⬎80% of visceral afferent neurons express TRPV1, of which ⬃60% are also positive for SP (43, 52). Using immunohistochemistry on colonic sections from transgenic Ai32/TRPV1cre mice (Fig. 3C), we were able to colocalize TRPV1 to a subset of SP⫹ fibers in the colonic wall, more specifically in the muscularis layer (Fig. 3C=). Notably, plot profile and colocalization analysis demonstrated loci of colocalization between SP and TRPV1 along with an ICQ of 0.219 ⫾ 0.013 (n ⫽ 13), which indicates dependent staining between TRPV1 and SP (Fig. 3C“). Although these images only present partial coexpression of TRPV1 and SP and their interpretation is limited, it led us to speculate that the expression of neuropeptides such as SP and CGRP could also be modulated in the different phases of colitis in our model, similar to TRPV1. Figure 4A shows that, while an increase in both SP and CGRP could be detected in the acute phase of colitis, only SP levels remained elevated until the end of the recovery period. EIAs

200

TRPV1 100

GAPDH 0

Control

Acute Recovery

C"

1

1

100

2

2

R.I.U.

80

3

60 40 20 0

4

Merge

0

20

40

60

80

Distance (µm)

20µm

20µm

SP

V1

CGRP

Fig. 3. Colonic inflammation induces an increase in transient receptor potential vanilloid 1 (TRPV1) expression and protein levels in the recovery phase of colitis. A and B: recovery mice showed a significant increase in TRPV1 mRNA transcripts (A) and peripheral protein levels (B), as measured in whole colon-innervating dorsal root ganglia (DRGs) and distal colonic samples, respectively (n ⫽ 5– 8 animals/group). No differences in expression and protein levels could be observed between control and acutely treated animals. C=: transverse colonic sections from control Ai32/TRPV1-cre mice were immunostained for TRPV1 (V1) (purple), substance P (SP) (red), and calcitonin gene-related peptide (CGRP) (green). Partial colocalization of all 3 markers could be observed in the muscularis layer. C⬙: plot profile analysis demonstrates loci of colocalization between SP and TRPV1. Further colocalization analysis revealed an intensity correlation quotient value of 0.219 ⫾ 0.013 (n ⫽ 13 images from 3 Ai32/TRPV1-cre animals), indicating dependent staining between SP and TRPV1 or, in other words, the presence of a subset of SP ⫹ TRPV1 ⫹ nerve terminals in the muscularis layer (white arrows). Images were taken at ⫻40 magnification. Data are expressed as means ⫾ SE. *P ⬍ 0.05, **P ⬍ 0.01. RIU, refractive index unit. AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00421.2014 • www.ajpgi.org

G93

TRPV1 MEDIATES POSTINFLAMMATORY VISCERAL PAIN

5, E and F). Interestingly, elevated levels of IL-6 could be observed in TRPV1⫺/⫺ mice compared with WT in the acute phase of the disease. Another major difference noted between genotypes was the significant decrease in colonic SP levels in TRPV1⫺/⫺ mice in both the acute and recovery phases of colitis, as opposed to the sustained increase observed in WT animals (Fig. 5G). Nevertheless, these differences in cytokines and neuropeptide expression did not alter disease severity or the recovery process in TRPV1-deficient animals compared with WT mice. Functionally, the deletion of TRPV1 did not affect the development of visceral pain in the early phase of colitis; acutely treated TRPV1⫺/⫺ mice showed a significant reduction in both distance traveled (Fig. 6A) and time spent climbing (Fig. 6B) compared with control littermates, and no differences could be found between WT and TRPV1⫺/⫺ animals in the

A

Control

acute phase of colitis (P ⬎ 0.99 for both distance and climbing). Nevertheless, recovery TRPV1⫺/⫺ mice showed unaltered behavior compared with control TRPV1⫺/⫺ mice, which significantly contrasted with recovery WT animals. These results were corroborated by VMR to CRD, which revealed, not only no differences between control and recovery TRPV1⫺/⫺ mice (Fig. 6C=), but also a significant disparity between recovery WT and TRPV1⫺/⫺ mice at distension pressures of 45 and 60 mmHg (Fig. 6C”). Together, these results suggest that TRPV1 is not required for the development of acute inflammation and pain but is essential for the establishment of postinflammatory hypersensitivity in our model. Although intracolonic administration of mustard oil was originally used to screen for peripheral sensitization in WT mice (Fig. 2C), it should be noted that mustard oil has been shown to directly activate TRPV1 in vivo (30, 31). For this

Acute

CGRP

Recovery

50µm

SP

Merge

C 3

*

*

* 1000

[SP] (pg/mL)

[CGRP] (ng/mL)

B 2 1 0

800

*

600 400 200 0

Control

Acute Recovery

Control

Acute Recovery

Fig. 4. Acute and recovery mice show differential expression of SP and CGRP. Immunocytochemistry of transverse colonic sections (A) and enzyme immunoassays (B and C) showed significant increases in both neuropeptides SP and CGRP in mice acutely treated with DSS. While CGRP levels were back to control levels in recovery animals, elevated SP immunoreactivity and colonic levels persisted at least 5 wk post-DSS discontinuation. Images were taken at ⫻20 magnification. Data are expressed as means ⫾ SE; n ⫽ 5– 8 (A and B), 9 –12 (C) animals/group. *P ⬍ 0.05. AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00421.2014 • www.ajpgi.org

G94

TRPV1 MEDIATES POSTINFLAMMATORY VISCERAL PAIN

3 2 1 0

Control

0.4 0.3 0.2 0.1 0.0

Acute Recovery

Control

4 2 0

Control

Acute Recovery

**

6 4 2 0

Control

Acute Recovery

F 1000

**

750 500

IL-6

** TNF

MPO activity (U/mg tissue)

6

8

Acute Recovery

E (% WT or KO control)

D

C

**

0.5

Colon length (cm)

**

B

250 125 0

Control

Acute Recovery

(% WT or KO control)

4

Colonic wall thickness (mm)

Macroscopic damage

A

TRPV1-/- mice

WT mice

10000

*

5000 200 100 0

Control

Acute Recovery

SP

(% WT or KO control)

G 200

*

150

**

100 50 0

Control

Acute Recovery

Fig. 5. TRPV1 deletion does not affect disease severity or recovery in TRPV1⫺/⫺ mice. A–D: acutely treated TRPV1⫺/⫺ mice showed equivalent disease severity as wild-type (WT) mice, as illustrated by increased macroscopic damage and colonic wall thickness, reduced colonic length, and upregulated mucosal granulocyte infiltration. All parameters were back to control levels 5 wk post-DSS discontinuation. E and F: TRPV1⫺/⫺ mice displayed the same pattern of TNF-␣ and IL-6 expression as WT throughout the course of the disease (initial increase in the acute phase of colitis, followed by control levels in the recovery phase). TRPV1⫺/⫺ mice showed significantly elevated levels of IL-6 compared with WT in the acute phase of colitis. G: in contrast to the sustained increase in SP observed in WT mice throughout the course of the disease, acute and recovery TRPV1⫺/⫺ mice showed significantly lower levels of colonic SP compared with their control littermates. Data are expressed as means ⫾ SE; n ⫽ 9 –13 (A–D), 3– 8 (E–G) animals/group. WT data are the same as presented in Figs. 1 and 3. *P ⬍ 0.05, **P ⬍ 0.01 compared with WT controls; ⌽P ⬍ 0.05, ⌽⌽P ⬍ 0.01 compared with TRPV1⫺/⫺ controls; 冱P ⬍ 0.05 between groups. KO, knockout.

reason, mustard oil-evoked nocifensive responses were not assessed in TRPV1⫺/⫺, as it would have been ambiguous to conclude whether altered nocifensive behaviors resulted from persistent sensitization or the absence of TRPV1 as a mustard oil chemosensor. SP selectively sensitizes TRPV1 by modulating its expression at the cell surface in vitro. Given the sustained increase in SP observed in the colonic mucosa of recovery animals and the functional role of TRPV1 highlighted in our model, we tested whether SP could mediate TRPV1 sensitization in HEK cells cotransfected with HA-tagged TRPV1 and the SP receptor NK-1. While SP did not affect the total levels of TRPV1, cell-surface biotinylation revealed that prolonged exposure to SP induced a significant increase in membrane-bound TRPV1, compared with untreated controls or acutely treated (1 h treatment) HEK cells (Fig. 7, A and C). This effect appears to be selective for TRPV1, as no differences in either total or membrane-bound levels of TRPA1, another member of the TRP channel family prominently involved in visceral nociception, could be detected between control and SP-treated HEK

cells cotransfected with YFP-tagged TRPA1 and NK-1 (Fig. 7, B and C). Several cellular mechanisms are involved in the overall process of ion channel sensitization. For example, PKCdependent TRPV1 phosphorylation and membrane trafficking are known to be implicated in channel potentiation (39, 41, 57). Knowing that PKC is a downstream effector of the NK-1 receptor, we investigated the involvement of PKC in SP-mediated TRPV1 sensitization in transfected HEK cells. Although it could block PKC-induced TRPV1 membrane trafficking in response to PMA (100 nM, 18 h), the broadspectrum PKC inhibitor GF109203X failed to prevent SPmediated increase in TRPV1 membrane expression in our model, thus suggesting a PKC-independent mechanism (Fig. 7, C and D). Channel ubiquitination is an important posttranslational modification involved in appropriate trafficking of transmembrane proteins and was therefore investigated as a potential mechanism involved in SP-mediated TRPV1 sensitization. Figure 7E reveals that SP mediates robust polyubiquitination of TRPV1, which, given its stable level in whole-cell lysates,

AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00421.2014 • www.ajpgi.org

G95

TRPV1 MEDIATES POSTINFLAMMATORY VISCERAL PAIN

B

Climbing time (sec) (% WT or KO control)

Distance (m) (% WT or KO control)

A

TRPV1-/- mice

WT mice 200 150 100

* *

50 0

Control

Acute

100

*

*

50 0

Control

Recovery

Acute

Recovery

C"

C' 0.15

V1-/- Control V1-/-

Abdominal response (mVs-1)

Abdominal response (mVs-1)

150

Recovery

0.10 0.05

0.20 0.15 0.10 0.05 0.00

0.00 15

30

45

60

Distension pressure (mmHg)

45 mmHg

60 mmHg

Control

does not appear to trigger proteosomal degradation of the channel. Finally, to verify the functional effect of SP-mediated TRPV1 membrane targeting, whole-cell patch-clamp recordings were conducted in both cultured DRG neurons and transfected-HEK cells. Prolonged exposure to SP induced a significant increase in capsaicin-evoked currents in both primary and recombinant cultures systems, thus corroborating our biochemical observations (Fig. 8). DISCUSSION

Chronic abdominal pain is an important manifestation of IBD. However, the underlying mechanisms of neuronal sensitization involved in the establishment and persistence of visceral pain remain incompletely understood. In the present study, we examined the contribution of TRPV1 to peripheral sensitization and visceral pain in the context of both the acute and recovery phases of colitis. Our results indicate that visceral pain arising from acute colonic inflammation can persist past the resolution phase of the disease, a mechanism that appears to be dependent on TRPV1. Our results corroborate previous reports demonstrating visceral hypersensitivity up to 7 wk postcolitis (1, 15, 23). In the present study, we used the LABORAS system to measure nonevoked pain-related behaviors. Altered behaviors, including reduction of mobility and time spent climbing, were observed in both acutely treated and recovery animals. These results were supported by mustard oil-evoked nocifensive behaviors and pain-related visceromotor reflexes. Although a similar approach has previously been validated in a model of pancreatitis-related pain (11, 46), this is, to our knowledge, the first study making a clear parallel between nonevoked painrelated behaviors and commonly used chemically or mechanically evoked pain assessment tools in a model of colitis. It is important to note that, although they are commonly used to

45 mmHg

Fig. 6. TRPV1 is essential for the development of persistent visceral pain in recovery animals. A and B: although no differences between WT and TRPV1⫺/⫺ mice could be found with regard to distance traveled and time spent climbing in the acute phase, TRPV1⫺/⫺ mice showed unaltered pain-related behaviors in the recovery phase of colitis, compared with control TRPV1⫺/⫺. C: this observation was confirmed by similar VMR to increasing CRD in control and recovery TRPV1⫺/⫺ mice. WT mice showed significant visceral hypersensitivity compared with TRPV1⫺/⫺ animals in the recovery phase of colitis. Data are expressed as means ⫾ SE; n ⫽ 9 –13 (A and B), 5– 8 (C) animals/group. WT data are the same as presented in Fig. 2. *P ⬍ 0.05 compared with WT controls; ⌽⌽P ⬍ 0.01 compared with TRPV1⫺/⫺ controls; 冱P ⬍ 0.05.

60 mmHg

Recovery

assess hypersensitivity, techniques using evoked nocifensive responses do not account for all modalities of visceral pain. In fact, they provide quantitative measures of hypersensitivity based on the peripheral sensitization of 1) low- and highthreshold mechanosensitive visceral afferent fibers in the case of VMR to CRD and 2) chemosensitive afferent neurons expressing TRPV1 and TRPA1 during chemical stimulation. In contrast, assessment of pain-related behaviors takes into consideration both peripheral and central sensitization mechanisms, as well as emotional components (i.e., stress) associated with visceral pain. In addition to being far less invasive, this technique may in fact represent a more holistic measurement tool to assess pain and discomfort. This could explain, at least in part, the slight discrepancy in the results obtained from VMR to CRD and the LABORAS recordings in our model. Indeed, although changes in mobility and climbing activity observed in the recovery animals would normally be associated with allodynia (pain to innocuous stimuli), the VMR technique showed visceral hypersensitivity only upon noxious distension pressures (45– 60 mmHg), rather that innocuous stimulation (15–30 mmHg). This may reflect the involvement of additional central mechanisms other than peripheral sensitization in our model. Although chronic hypersensitivity has previously been described in the context of IBD (37, 47), the molecular players involved in the development of postinflammatory neuronal sensitization remain unclear. Our results indicate that postinflammatory pain is accompanied by increased colonic levels of both TRPV1 and SP in recovery animals. It should be noted that an increase in TRPV1 expression has previously been reported in the acute phase of experimental colitis and human IBD (14 –16, 35, 38, 54, 55). For example, Eijkelkamp et al. (15) have shown, using the DSS model of colitis, an increase in TRPV1 protein levels during acute DSS colitis but not in the remission phase of the disease. The disparity between these

AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00421.2014 • www.ajpgi.org

G96

Co nt ro l SP (1 50 nM SP -1 h) (1 µM -1 SP h) (1 50 nM -1 8h )

TRPV1 MEDIATES POSTINFLAMMATORY VISCERAL PAIN

A

D

SP GF109203X

-

+

+ -

+ +

-

+ -

+ PMA + GF109203X

Membrane-TRPV1 Na/K ATPase Total TRPV1 GAPDH

Membrane-TRPA1 Na/K ATPase Total TRPA1 GAPDH

TRPV1 200 150

**

*

Control

SP

TRPV1-HA (95kDa) TRPA1

100

IP: HA IB: Ubiquitin TRPV1-HA

50

IP: HA, IB: HA

(1 Co 50 ntr S n o SP P( M-1 l (1 1uM h) 50 G 1 F+ G nM h) SP F1 -18 (1 09 h) 50 20 nM 3X -1 8h ) SP (1 Co 50 ntr S n o SP P( M-1 l (1 1uM h) 50 nM 1h -1 ) 8h )

0

SP

Membrane-bound TRP channel (% control/total TRPV1)

C

E Ubiquitinated TRPV1

B

Fig. 7. Prolonged exposure to SP induces membrane accumulation of TRPV1 in vitro. A: treatment with 150 nM SP for 18 h induced a significant increase in membrane-bound TRPV1 in human embryonic kidney (HEK) cells cotransfected with the NK-1 receptor and HA-tagged TRPV1, compared with untreated controls or cells acutely treated with SP (150 nM or 1 ␮M for 1 h). An anti-HA antibody was used to detect TRPV1 in both biotinylated fractions and total lysates by immunoblotting. No differences in TRPV1 total protein levels could be observed between treatments. Na⫹-K⫹ ATPase and GAPDH were used as loading controls for the biotinylated fractions and total lysates, respectively. B: SP treatment did not affect the total or membrane-bound levels of TRP ankyrin 1 (TRPA1) in HEK cells cotransfected with the NK-1 receptor and yellow fluorescent protein-tagged TRPA1. A green fluorescent protein antibody was used to detect TRPA1 in both biotinylated fractions and total lysates by immunoblotting. Subsequent experiments were performed using 150 nM SP for 18 h. C: immunoblots were quantified by densitometric analysis. D: the use of the broad-spectrum PKC inhibitor GF109203X (GF) (10 ␮M, 18 h) did not affect TRPV1 membrane expression in SP-treated HEK cells. The PKC agonist phorbol myristate acetate (PMA) (100 nM, 18 h) was used as a positive control to enhance TRPV1 membrane expression. E: Western blotting of immunoprecipitated (IP) TRPV1 showed strong polyubiquitination of TRPV1 upon SP treatment (representative blot of 3 samples per treatment group). IP samples were probed for ubiquitin (top), and the total level of TRPV1 in the IP fraction was used as a loading control (bottom). IB, immunoblot. Data are expressed as means ⫾ SE. n ⫽ 3– 6 (A–F). *P ⬍ 0.05, **P ⬍ 0.01 compared with untreated controls.

studies and ours might originate from the differential anatomical expression of TRPV1 in the gastrointestinal tract. Indeed, studies in mice have demonstrated a proximodistal gradient of TRPV1 expression along the length of the colon (34). Therefore, sampling from different colonic regions could explain, at least in part, the differences reported with regard to the modulation of TRPV1 protein levels during acute inflammation. Although the overall absence of colonic inflammation observed in recovery mice might appear to conflict with the role of SP in neurogenic inflammation, elevated colonic levels of SP have been reported in the context of both irritable bowel syndrome, a condition not believed to be driven by active

inflammation, and the remission phase of IBD (5, 25, 27, 28). This suggests that locally released SP might not be sufficient to promote substantial inflammatory responses on its own. Interestingly, although both SP and CGRP levels were upregulated in the acute phase of colitis, only SP levels remained elevated until the end of the recovery period. This observation is corroborated by previous studies demonstrating differential regulation and function of SP and CGRP in colitis. Notably, although an increase in SP-positive fibers has been reported in colonic biopsies from patients with IBD, the opposite has been found for CGRP (5, 27, 28). It was also demonstrated that SP is required for the development of oxazalone-induced colitis in

AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00421.2014 • www.ajpgi.org

TRPV1 MEDIATES POSTINFLAMMATORY VISCERAL PAIN

SP

+100 mV 0 mV -100 mV 1000 pA 50 ms

DRG neurons

**

300

Capsaicin-evoked current (pA/pF)

HEK cells

Control

Fig. 8. SP treatment potentiates capsaicin-evoked currents in HEK cells and DRG neurons. Whole-cell patch-clamp recordings showed that treatment with 150 nM SP for 18 h induced elevated capsaicin-evoked currents in HEK cells cotransfected with TRPV1 and the NK-1 receptor, as well as in dissociated DRG neurons. Data are expressed as means ⫾ SE. n ⫽ 6 –7. *P ⬍ 0.05, **P ⬍ 0.01 compared with untreated controls.

*

200

100

0 200 pA 50 ms

G97

Con

SP

HEK cells

mice, whereas the deletion of CGRP results in an increase in disease susceptibility, thus suggesting a protective role for CGRP in colitis (16, 17, 36, 45). The involvement of SP in colonic inflammation is further reinforced by additional studies demonstrating increased NK-1 receptor expression in colonic biopsies from patients with IBD, as well as reduced severity of experimental colitis upon NK-1 pharmacological inhibition (21, 49). Other proinflammatory mediators such as serotonin, histamine, proteases, and the cyclooxygenase-2 metabolite prostaglandin E2 have all been shown to sensitize TRPV1 and participate in the pathogenesis of DSS-induced acute colitis (3, 22, 24, 31, 40, 53, 57). However, the complete clearance of granulocytes from the colonic mucosa, as indicated by control levels of MPO activity, as well as the overall absence of inflammation in recovery mice suggest that these mediators are unlikely to account for the persistent sensitization observed in our model. Together with the results discussed above, these observations led us to speculate that the sustained upregulation of SP observed in recovery animals could perhaps be part of a feedback loop culminating in TRPV1 sensitization. Using a combination of recombinant and primary culture systems, we found that prolonged exposure to SP induced a significant increase in capsaicin-evoked currents in both HEK cells and DRG neurons, which correlated with an increase in TRPV1 surface expression. These results, along with previous studies, confirm the expression of NK-1 in DRG neurons and its functional coupling to TRPV1 (30, 56). Importantly, SP did not affect membrane targeting of TRPA1, thus implying differential regulation of peripheral noxious transducers by SP. Several mechanisms are involved, individually or in concert, in ion channel sensitization. For instance, phosphorylation and cellular trafficking have been extensively studied in the context of TRPV1 channel function. Specifically, phosphorylation by PKC has been shown to lower the activation threshold of TRPV1 and promote its targeting to the cell membrane (39, 41, 57). Nevertheless, inhibition of PKC failed to affect SPmediated TRPV1 membrane accumulation in our model. Instead, our results indicate that SP induces polyubiquitination of TRPV1, a posttranslational modification shared by several cellular pathways, including endosomal recycling and proteosomal degradation (32). Notably, ubiquitination of the chemokine G protein-coupled receptor CXC chemokine receptor 7 was recently identified as a critical step in its appropriate targeting from and to the plasma membrane (10). The stable levels of TRPV1 protein found in whole-cell lysates during SP

Con

SP

DRG neurons

treatment suggest that SP-mediated TRPV1 ubiquitination does not reflect an increased rate of proteosomal degradation. Therefore, we hypothesize that SP induces the accumulation of ubiquitinated TRPV1 by either blocking the rerouting of the channel for degradation and/or increasing TRPV1 endosomal recycling to the cell surface. Further experiments are warranted to establish whether the interaction observed between SP and TRPV1 in our in vitro experiments is relevant in the recovery model of colitis and, if it is, whether it occurs in an autocrine or paracrine manner. Our immunostaining data show substantial colocalization of SP and TRPV1 in a subset of nerve terminals in the muscularis layer. That being said, the interpretation of these images and their analysis remains limited, and we cannot ascertain at this point that the increase in SP measured in the recovery mice originates solely from TRPV1⫹ afferents in vivo because loci of SP expression were also observed at sites distant from TRPV1⫹ terminals. Notably, enteric neurons represent a prominent source of SP in the gastrointestinal tract and could also play a role in SP-mediated TRPV1 sensitization, but this remains speculative at this point. In brief, although our results cannot firmly demonstrate at this point a functional interaction between TRPV1 and SP in vivo, they suggest that some nerve terminals may release SP at the site of TRPV1 expression, thus leading us to postulate that SP-induced TRPV1 sensitization may participate in postinflammatory hypersensitivity in the recovery model of colitis. To assess whether TRPV1 was the driving force behind the development of postinflammatory pain in our model, we assessed visceral pain in TRPV1-deficient mice subjected to DSS colitis. Although previous studies have shown that pharmacological blockage of TRPV1 could reduce inflammatory pain in the rat trinitrobenzenesulfonic acid (TNBS) model of colitis (14, 38), our results demonstrate that TRPV1⫺/⫺ animals experienced similar levels of visceral pain as WT mice in the acute phase of DSS-induced colitis. In contrast to DSS, TNBS has been shown to directly activate and sensitize TRPA1 (18). This indicates that both the inflammatory response and visceral pain associated with the DSS and TNBS models are governed by intricately different mechanisms, which could explain the differences between studies with regard to the role of TRPV1 in acute pain. Furthermore, TRPV1 is not the only noxious transducer involved in pain signaling at the periphery. Voltagegated sodium and potassium channels, as well as TRPA1 and TRPV4, have been shown to be modulated by proinflammatory mediators, thus contributing to neuronal hyperexcitability and inflammatory pain (6, 12, 13, 48). That being said, it is

AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00421.2014 • www.ajpgi.org

G98

TRPV1 MEDIATES POSTINFLAMMATORY VISCERAL PAIN

conceivable that other cellular pathways could compensate for the absence of TRPV1 in the establishment of acute visceral hypersensitivity. Nevertheless, once the inflammation has resolved, persistent pain may be driven by a much more limited number of mediators, including the TRPV1 channel. TRPV1 is believed to be the main determinant of SP release in the gastrointestinal tract. In agreement with this, our data show that TRPV1-deficient mice are unable to upregulate SP expression during the acute and recovery phases of colitis. Furthermore, we demonstrated that, in sharp contrast to the acute phase, the deletion of TRPV1 prevented the development of visceral pain in the recovery phase of colitis, suggesting differential roles for TRPV1 in acute vs. chronic pain. Taken together, these results support our in vitro data suggesting a feedback sensitization loop between SP and TRPV1. Although a few studies have shown a protective role for TRPV1 in acute colitis (33, 51), others have demonstrated that pharmacological inhibition or genetic deletion of the channel could lessen disease severity (26, 50). Importantly, the deletion of TRPV1 did not affect disease severity or recovery in our model. Although we did observe a significant increase in IL-6 in TRPV1⫺/⫺ compared with WT animals during acute colitis, the macroscopic damage score and other disease activity index remained unchanged between genotypes. Taken together, our observations suggest that, while TRPV1 is not required for the development of acute pain and inflammation in our recovery model of colitis, it is essential for the establishment of persistent visceral hypersensitivity in the recovery phase of the disease. To achieve better therapeutic approaches, we must avoid referring to pain as an entity but rather attempt to identify the specific molecular triggers involved in the development and persistence of visceral pain. Here, we propose a working hypothesis in which, in the context of colitis, chronic exposure of sensory afferent nerve terminals to SP sensitizes TRPV1, which in turn leads to postinflammatory pain. Agents that could specifically disrupt SP-mediated sensitization of TRPV1 could therefore represent an attractive therapeutic avenue to alleviate chronic pain following acute inflammatory injury. ACKNOWLEDGMENTS We thank Patrick Whelan and Sravan Mandadi, as well as Gerald Zamponi and Patrick Stemkowski for providing the TRPV1⫺/⫺ and Ai32/TRPV1-cre mice, respectively. We also thank Ardem Patapoutian for providing the TRPV1 and TRPA1 cDNA and Lauren Taylor for assisting with VMR recordings. GRANTS This study was supported by a grant from the Canadian Institutes for Health Research (CIHR). T. Lapointe holds fellowships from CIHR, the Canadian Association of Gastroenterology, and Alberta Innovates Health Solutions. C. Altier holds a Canada Research Chair in inflammatory pain. DISCLOSURES No conflicts of interest, financial or otherwise, are declared by the authors. AUTHOR CONTRIBUTIONS Author contributions: T.K.L. and C.A. conception and design of research; T.K.L., L.B., M.C.I., R.F., and K.C. performed experiments; T.K.L., L.B., M.C.I., and C.A. analyzed data; T.K.L., L.B., M.C.I., and C.A. interpreted results of experiments; T.K.L. and C.A. prepared figures; T.K.L. drafted manuscript; T.K.L., G.D., N.V., and C.A. edited and revised manuscript; T.K.L., L.B., M.C.I., R.F., K.C., G.D., N.V., and C.A. approved final version of manuscript.

REFERENCES 1. Adam B, Liebregts T, Gschossmann JM, Krippner C, Scholl F, Ruwe M, Holtmann G. Severity of mucosal inflammation as a predictor for alterations of visceral sensory function in a rat model. Pain 123: 179 –186, 2006. 2. Akbar A, Yiangou Y, Facer P, Brydon WG, Walters JRF, Anand P, Ghosh S. Expression of the TRPV1 receptor differs in quiescent inflammatory bowel disease with or without abdominal pain. Gut 59: 767–774, 2010. 3. Amadesi S, Nie J, Vergnolle N, Cottrell GS, Grady EF, Trevisani M, Manni C, Geppetti P, McRoberts JA, Ennes H, Davis JB, Mayer EA, Bunnett NW. Protease-activated receptor 2 sensitizes the capsaicin receptor transient receptor potential vanilloid receptor 1 to induce hyperalgesia. J Neurosci 24: 4300 –4312, 2004. 4. Averbeck B, Reeh PW. Interactions of inflammatory mediators stimulating release of calcitonin gene-related peptide, substance P and prostaglandin E(2) from isolated rat skin. Neuropharmacology 40: 416 –423, 2001. 5. Bernstein CN, Robert ME, Eysselein VE. Rectal substance P concentrations are increased in ulcerative colitis but not in Crohn’s disease. Am J Gastroenterol 88: 908 –913, 1993. 6. Beyak MJ, Ramji N, Krol KM, Kawaja MD, Vanner SJ. Two TTXresistant Na⫹ currents in mouse colonic dorsal root ganglia neurons and their role in colitis-induced hyperexcitability. Am J Physiol Gastrointest Liver Physiol 287: G845–G855, 2004. 7. Boué J, Basso L, Cenac N, Blanpied C, Rolli-Derkinderen M, Neunlist M, Vergnolle N, Dietrich G. Endogenous regulation of visceral pain via production of opioids by colitogenic CD4(⫹) T cells in mice. Gastroenterology 146: 166 –175, 2014. 8. Bourinet E, Altier C, Hildebrand ME, Trang T, Salter MW, Zamponi GW. Calcium-permeable ion channels in pain signaling. Physiol Rev 94: 81–140, 2014. 9. Brain SD, Williams TJ, Tippins JR, Morris HR, MacIntyre I. Calcitonin gene-related peptide is a potent vasodilator. Nature 313: 54 –56, 1985. 10. Canals M, Scholten DJ, de Munnik S, Han MKL, Smit MJ, Leurs R. Ubiquitination of CXCR7 controls receptor trafficking. PLoS One 7: e34192, 2012. 11. Cattaruzza F, Johnson C, Leggit A, Grady E, Schenk AK, Cevikbas F, Cedron W, Bondada S, Kirkwood R, Malone B, Steinhoff M, Bunnett N, Kirkwood KS. Transient receptor potential ankyrin 1 mediates chronic pancreatitis pain in mice. Am J Physiol Gastrointest Liver Physiol 304: G1002–G1012, 2013. 12. Cenac N, Altier C, Chapman K, Liedtke W, Zamponi G, Vergnolle N. Transient receptor potential vanilloid-4 has a major role in visceral hypersensitivity symptoms. Gastroenterology 135: 937–946; e1– e2, 2008. 13. Cenac N, Altier C, Motta JP, d’Aldebert E, Galeano S, Zamponi GW, Vergnolle N. Potentiation of TRPV4 signalling by histamine and serotonin: an important mechanism for visceral hypersensitivity. Gut 47: 497–505, 2000. 14. De Schepper HU, De Winter BY, Van Nassauw L, Timmermans JP, Herman AG, Pelckmans PA, De Man JG. TRPV1 receptors on unmyelinated C-fibres mediate colitis-induced sensitization of pelvic afferent nerve fibres in rats. J Physiol 586: 5247–5258, 2008. 15. Eijkelkamp N, Kavelaars A, Elsenbruch S, Schedlowski M, Holtmann G, Heijnen CJ. Increased visceral sensitivity to capsaicin after DSSinduced colitis in mice: spinal cord c-Fos expression and behavior. Am J Physiol Gastrointest Liver Physiol 293: G749 –G757, 2007. 16. Engel MA, Khalil M, Mueller-Tribbensee SM, Becker C, Neuhuber WL, Neurath MF, Reeh PW. The proximodistal aggravation of colitis depends on substance P released from TRPV1-expressing sensory neurons. J Gastroenterol 47: 256 –265, 2012. 17. Engel MA, Khalil M, Siklosi N, Mueller-Tribbensee SM, Neuhuber WL, Neurath MF, Becker C, Reeh PW. Opposite effects of substance P and calcitonin gene-related peptide in oxazolone colitis. Dig Liver Dis 44: 24 –29, 2012. 18. Engel MA, Leffler A, Niedermirtl F, Babes A, Zimmermann K, Filipovic MR, Izydorczyk I, Eberhardt M, Kichko TI, Mueller-Tribbensee SM, Khalil M, Siklosi N, Nau C, Ivanovic-Burmazovic I, Neuhuber WL, Becker C, Neurath MF, Reeh PW. TRPA1 and substance P mediate colitis in mice. Gastroenterology 141: 1346 –1358, 2011. 19. Fichna J, Lapointe T, Chapman K, Janecka A, Vergnolle N, Altier C, Storr MA. New neostigmine-based behavioral mouse model of abdominal pain. Pharmacol Rep 64: 1146 –1154, 2012.

AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00421.2014 • www.ajpgi.org

TRPV1 MEDIATES POSTINFLAMMATORY VISCERAL PAIN 20. Flynn R, Chapman K, Iftinca M, Aboushousha R, Varela D, Altier C. Targeting the transient receptor potential vanilloid type 1 (TRPV1) assembly domain attenuates inflammation-induced hypersensitivity. J Biol Chem 289: 16675–16687, 2014. 21. Goode T, O’Connell J, Anton P, Wong H, Reeve J, O’Sullivan GC, Collins JK, Shanahan F. Neurokinin-1 receptor expression in inflammatory bowel disease: molecular quantitation and localisation. Gut 47: 387–396, 2000. 22. Grant AD, Cottrell GS, Amadesi S, Trevisani M, Nicoletti P, Materazzi S, Altier C, Cenac N, Zamponi GW, Bautista-Cruz F, Lopez CB, Joseph EK, Levine JD, Liedtke W, Vanner S, Vergnolle N, Geppetti P, Bunnett NW. Protease-activated receptor 2 sensitizes the transient receptor potential vanilloid 4 ion channel to cause mechanical hyperalgesia in mice. J Physiol 578: 715–733, 2007. 23. Hughes PA, Brierley SM, Martin CM, Brookes SJH, Linden DR, Blackshaw LA. Post-inflammatory colonic afferent sensitisation: different subtypes, different pathways and different time courses. Gut 58: 1333– 1341, 2009. 24. Kajihara Y, Murakami M, Imagawa T, Otsuguro K, Ito S, Ohta T. Histamine potentiates acid-induced responses mediating transient receptor potential V1 in mouse primary sensory neurons. Neuroscience 166: 292–304, 2010. 25. Keszthelyi D, Troost FJ, Jonkers DM, Helyes Z, Hamer HM, Ludidi S, Vanhoutvin S, Venema K, Dekker J, Szolcsányi J, Masclee AA. Alterations in mucosal neuropeptides in patients with irritable bowel syndrome and ulcerative colitis in remission: a role in pain symptom generation? Eur J Pain 17: 1299 –1306, 2013. 26. Kimball ES, Wallace NH, Schneider CR, D’Andrea MR, Hornby PJ. Vanilloid receptor 1 antagonists attenuate disease severity in dextran sulphate sodium-induced colitis in mice. Neurogastroenterol Motil 16: 811–818, 2004. 27. Kimura M, Masuda T, Hiwatashi N, Toyota T, Nagura H. Changes in neuropeptide-containing nerves in human colonic mucosa with inflammatory bowel disease. Pathol Int 44: 624 –634, 1994. 28. Koch TR, Carney JA, Go VL. Distribution and quantitation of gut neuropeptides in normal intestine and inflammatory bowel diseases. Dig Dis Sci 32: 369 –376, 1987. 29. Li Q, Lau A, Morris TJ, Guo L, Fordyce CB, Stanley EF. A syntaxin 1, Galpha(o), and N-type calcium channel complex at a presynaptic nerve terminal: analysis by quantitative immunocolocalization. J Neurosci 24: 4070 –4081, 2004. 30. Linley JE, Ooi L, Pettinger L, Kirton H, Boyle JP, Peers C, Gamper N. Reactive oxygen species are second messengers of neurokinin signaling in peripheral sensory neurons. Proc Natl Acad Sci USA 109: E1578 – E1586, 2012. 31. Lopshire JC, Nicol GD. Activation and recovery of the PGE2-mediated sensitization of the capsaicin response in rat sensory neurons. J Neurophysiol 78: 3154 –3164, 1997. 32. MacGurn JA, Hsu PC, Emr SD. Ubiquitin and membrane protein turnover: from cradle to grave. Annu Rev Biochem 81: 231–259, 2012. 33. Massa F, Sibaev A, Marsicano G, Blaudzun H, Storr M, Lutz B. Vanilloid receptor (TRPV1)-deficient mice show increased susceptibility to dinitrobenzene sulfonic acid induced colitis. J Mol Med 84: 142–146, 2006. 34. Matsumoto K, Kurosawa E, Terui H, Hosoya T, Tashima K, Murayama T, Priestley JV, Horie S. Localization of TRPV1 and contractile effect of capsaicin in mouse large intestine: high abundance and sensitivity in rectum and distal colon. Am J Physiol Gastrointest Liver Physiol 297: G348 –G360, 2009. 35. Matsumoto K, Lo MW, Hosoya T, Tashima K, Takayama H, Murayama T, Horie S. Experimental colitis alters expression of 5-HT receptors and transient receptor potential vanilloid 1 leading to visceral hypersensitivity in mice. Lab Invest 92: 769 –782, 2012. 36. Mazelin L, Theodorou V, Fioramonti J, Bueno L. Vagally dependent protective action of calcitonin gene-related peptide on colitis. Peptides 20: 1367–1374, 1999. 37. Minderhoud IM, Oldenburg B, Wismeijer JA, van Berge Henegouwen GP, Smout AJ. IBS-like symptoms in patients with inflammatory bowel disease in remission; relationships with quality of life and coping behavior. Dig Dis Sci 49: 469 –474, 2004. 38. Miranda A, Nordstrom E, Mannem A, Smith C, Banerjee B, Sengupta JN. The role of transient receptor potential vanilloid 1 in mechanical and

39. 40.

41.

42. 43.

44.

45.

46.

47.

48. 49.

50.

51. 52.

53.

54.

55. 56.

57.

G99

chemical visceral hyperalgesia following experimental colitis. Neuroscience 148: 1021–1032, 2007. Morenilla-Palao C, Planells-Cases R, Garcia-Sanz N, Ferrer-Montiel A. Regulated exocytosis contributes to protein kinase C potentiation of vanilloid receptor activity. J Biol Chem 279: 25665–25672, 2004. Moriyama T, Higashi T, Togashi K, Iida T, Segi E, Sugimoto Y, Tominaga T, Narumiya S, Tominaga M. Sensitization of TRPV1 by EP1 and IP reveals peripheral nociceptive mechanism of prostaglandins. Mol Pain 1: 3, 2005. Numazaki M, Tominaga T, Toyooka H, Tominaga M. Direct phosphorylation of capsaicin receptor VR1 by protein kinase Cepsilon and identification of two target serine residues. J Biol Chem 277: 13375–13378, 2002. O’Neill J, Brock C, Olesen AE, Andresen T, Nilsson M, Dickenson AH. Unravelling the mystery of capsaicin: a tool to understand and treat pain. Pharmacol Rev 64: 939 –971, 2012. Perry MJ, Lawson SN. Differences in expression of oligosaccharides, neuropeptides, carbonic anhydrase and neurofilament in rat primary afferent neurons retrogradely labelled via skin, muscle or visceral nerves. Neuroscience 85: 293–310, 1998. Quinn LP, Stean TO, Trail B, Duxon MS, Stratton SC, Billinton A, Upton N. LABORAS: Initial pharmacological validation of a system allowing continuous monitoring of laboratory rodent behaviour. J Neurosci Methods 130: 83–92, 2003. Reinshagen M, Flamig G, Ernst S, Geerling I, Wong H, Walsh JH, Eysselein VE, Adler G. Calcitonin gene-related peptide mediates the protective effect of sensory nerves in a model of colonic injury. J Pharmacol Exp Ther 286: 657–661, 1998. Schwartz ES, La JH, Scheff NN, Davis BM, Albers KM, Gebhart GF. TRPV1 and TRPA1 antagonists prevent the transition of acute to chronic inflammation and pain in chronic pancreatitis. J Neurosci 33: 5603–5611, 2013. Simren M, Axelsson J, Gillberg R, Abrahamsson H, Svedlund J, Bjornsson ES. Quality of life in inflammatory bowel disease in remission: the impact of IBS-like symptoms and associated psychological factors. Am J Gastroenterol 97: 389 –396, 2002. Stewart T, Beyak MJ, Vanner S. Ileitis modulates potassium and sodium currents in guinea pig dorsal root ganglia sensory neurons. J Physiol 552: 797–807, 2003. Stucchi AF, Shofer S, Leeman S, Materne O, Beer E, McClung J, Shebani K, Moore F, O’Brien M, Becker JM. NK-1 antagonist reduces colonic inflammation and oxidative stress in dextran sulfate-induced colitis in rats. Am J Physiol Gastrointest Liver Physiol 279: G1298 – G1306, 2000. Szitter I, Pozsgai G, Sandor K, Elekes K, Kemeny A, Perkecz A, Szolcsanyi J, Helyes Z, Pinter E. The role of transient receptor potential vanilloid 1 (TRPV1) receptors in dextran sulfate-induced colitis in mice. J Mol Neurosci 42: 80 –88, 2010. Takami Y, Mantyh CR, Pappas TN, Takahashi T, Koda K, Miyazaki M. Extrinsic surgical denervation ameliorates TNBS-induced colitis in rats. Hepatogastroenterology 56: 682–686, 2009. Tan LL, Bornstein JC, Anderson CR. Distinct chemical classes of medium-sized transient receptor potential channel vanilloid 1-immunoreactive dorsal root ganglion neurons innervate the adult mouse jejunum and colon. Neuroscience 156: 334 –343, 2008. Tang HB, Inoue A, Oshita K, Nakata Y. Sensitization of vanilloid receptor 1 induced by bradykinin via the activation of second messenger signaling cascades in rat primary afferent neurons. Eur J Pharmacol 498: 37–43, 2004. Vermeulen W, De Man JG, De Schepper HU, Bult H, Moreels TG, Pelckmans PA, De Winter BY. Role of TRPV1 and TRPA1 in visceral hypersensitivity to colorectal distension during experimental colitis in rats. Eur J Pharmacol 698: 404 –412, 2013. Yiangou Y, Facer P, Dyer NH, Chan CL, Knowles C, Williams NS, Anand P. Vanilloid receptor 1 immunoreactivity in inflamed human bowel. Lancet 357: 1338 –1339, 2001. Zhang H, Cang CL, Kawasaki Y, Liang LL, Zhang YQ, Ji RR, Zhao ZQ. Neurokinin-1 receptor enhances TRPV1 activity in primary sensory neurons via PKCepsilon: a novel pathway for heat hyperalgesia. J Neurosci 27: 12067–12077, 2007. Zhang X, Li L, McNaughton PA. Proinflammatory mediators modulate the heat-activated ion channel TRPV1 via the scaffolding protein AKAP79/150. Neuron 59: 450 –461, 2008.

AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00421.2014 • www.ajpgi.org