TRPC1 regulates fMLP-stimulated migration and chemotaxis of neutrophil granulocytes.

BBAMCR-17469; No. of pages: 9; 4C: 7 Biochimica et Biophysica Acta xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbamcr

TRPC1 regulates fMLP-stimulated migration and chemotaxis of neutrophil granulocytes☆ O. Lindemann a,⁎, C. Strodthoff a, M. Horstmann a, N. Nielsen a, F. Jung a, S. Schimmelpfennig a, M. Heitzmann b, A. Schwab a a b

Institute of Physiology II, University Hospital Münster, Münster, Germany Institute of Experimental Musculoskeletal Medicine, University Hospital Münster, Münster, Germany

a r t i c l e

i n f o

Article history: Received 26 September 2014 Received in revised form 18 December 2014 Accepted 29 December 2014 Available online xxxx Keywords: Chemotaxis Neutrophil TRP-channel Migration Ca2+ FPR

a b s t r a c t Neutrophils form the first line of defense of the innate immune system and are rapidly recruited by chemotactic signals to sites of inflammation. Understanding the mechanisms of neutrophil chemotaxis is therefore of great interest for the potential development of new immunoregulatory therapies. It has been shown that members of the transient receptor potential (TRP) family of cation channels are involved in both cell migration and chemotaxis. In this study, we demonstrate that TRPC1 channels play an important role in fMLP mediated chemotaxis and migration of murine neutrophils. The knock-out of TRPC1 channels leads to an impaired migration, transmigration and chemotaxis of the neutrophils. In contrast, Ca2+ influx but not store release after activation of the TRPC1−/− neutrophils with fMLP is strongly enhanced. We show that the enhanced Ca2+ influx in the TRPC1−/− neutrophils is associated with a steepened front to rear gradient of the intracellular Ca2+ concentration with higher levels at the cell rear. Taken together, this paper highlights a distinct role of TRPC1 in neutrophil migration and chemotaxis. We propose that TRPC1 controls the activity of further Ca2+ influx channels and thus regulates the maintenance of intracellular Ca2+ gradients which are critical for cell migration. This article is part of a Special Issue entitled: 13th European Symposium on Calcium. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Neutrophils form the first line of defense of the innate immune system and are rapidly recruited by chemotactic signals to sites of inflammation (for review see [15]). One elementary requirement of this recruitment process is the ability of the neutrophils to migrate. After the initial adhesion neutrophils quickly start to migrate intravascularly on the endothelial cells in order to find a gap to cross the endothelial barrier [17,25]. Neutrophils then follow chemoattractant gradients to reach the site of inflammation. Migrating cells maintain a polarized morphology with membrane protrusions (lamellipodia) at the cell front and retraction of the trailing end [31,40]. This amoeboid-type of migration is a Ca2+ dependent process [16,22,29]. In migrating cells a front to rear gradient of cytosolic Ca2+ with an increasing concentration at the rear end has been described [2]. The increased cytosolic Ca2+ Abbreviations: DAG, diacylglycerol; fMLP, N-formyl-methionine-leucine-phenylalanine; FPR, N-formyl-methionine-leucine-phenylalanine receptor; IP3, inositol 1,4,5-trosphosphate; PLC, phospholipase C; ROCE, receptor operated calcium entry; SOCE, store operated calcium entry; TRPC, transient receptor potential classical; TRPM, transient receptor potential melastatin; WT, wildtype ☆ This article is part of a Special Issue entitled: 13th European Symposium on Calcium ⁎ Corresponding author at: Institut für Pysiologie II, Robert-Koch-Straße 27b, 48155 Münster, Germany. Tel.: +49 251 83 55336; fax: +49 251 83 55331. E-mail address: [email protected] (O. Lindemann).

concentration [Ca2+]i at the rear end is related among others to myosin II contraction and calpain mediated release of focal adhesions leading to the retraction of the uropod [9,27,38]. In addition to the global frontrear gradient of the [Ca2+]i transient Ca2+ flickers were observed at the front of migrating cells [39,41]. During chemotaxis this fast rise of [Ca2+]i is induced by activation of G-protein coupled chemoattractant receptors facilitating polarization and directed migration [26,29]. Usually, the initial increase of [Ca2+]i is induced by phospholipase C (PLC) mediated production of inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). IP3 triggers store operated Ca2+ entry (SOCE) by activation of STIM1 and Orai proteins (for review see [36]). DAG mediates receptor operated Ca2+ entry (ROCE) by direct activation of PKC isoforms or DAG sensitive ion channels such as members of the transient receptor potential (TRP) channel family [7,19]. Several members of the classical TRPC channel family are attractive candidates for being involved in receptor-operated Ca2+ entry required for neutrophil migration and chemotaxis. So far, two members of this family – TRPC1 and TRPC6 – have been related to chemotaxis [1,6,10, 11,18]. TRPC6 regulates specifically CXC chemokine mediated migration of neutrophils [6,18], while it is not yet unequivocally known whether TRPC1 is involved in neutrophil migration or chemotaxis. However, during allergen induced pulmonary infiltration, a reduced number of infiltrated eosinophils and neutrophils in TRPC1−/− mice have been observed in lung tissue which would be consistent with a role of

http://dx.doi.org/10.1016/j.bbamcr.2014.12.037 0167-4889/© 2015 Elsevier B.V. All rights reserved.

Please cite this article as: O. Lindemann, et al., TRPC1 regulates fMLP-stimulated migration and chemotaxis of neutrophil granulocytes, Biochim. Biophys. Acta (2015), http://dx.doi.org/10.1016/j.bbamcr.2014.12.037

2

O. Lindemann et al. / Biochimica et Biophysica Acta xxx (2015) xxx–xxx

TRPC1 channels in directed migration of these cells [43]. That TRPC1 channels can be required for chemotaxis has been shown in multiple other cell types [1,10,11]. The aim of this study was to elucidate the role TRPC1 channels in chemoattractant receptor mediated migration of neutrophils. Using wild-type (WT) and TRPC1 deficient (TRPC1−/−) neutrophils [20] we revealed that TRPC1 is an important regulator of neutrophil migration and chemotaxis. Surprisingly, the migratory defect in the TRPC1−/− neutrophils was associated with a rise in chemoattractant-induced Ca2+ influx. Furthermore, the loss of TRPC1 elicits a steepened front to rear gradient of the [Ca2+]i with a higher concentration at the uropod. Our data indicate that TRPC1 channels are important regulators of chemoattractant receptor mediated Ca2+ signaling which adjust the front to rear Ca2+ gradient in migrating neutrophils.

2. Material and methods 2.1. Animals Neutrophils isolated from 8–10 weeks old male/female 129Sv/ C57BL/6J WT and TRPC1−/− [20] mice were used for all experiments. Only cells from 129Sv/C57BL/6J littermates were analyzed. Experimental protocols were approved by the local committee for animal care.

2.2. Reagents Fibronectin, Laminin, fMLP, Histopaque 1077, Histopaque 1119 and RPMI 1640 were purchased from Sigma-Aldrich (Steinheim, Germany) and Hank's balanced salt solution (HBSS), Dulbeco's Modified Eagle Medium (DMEM) as well as PBS were purchased from (PAA, Freiburg, Germany). Fetal calf serum and Fura-2 AM were obtained from Invitrogen (Darmstadt, Germany). The mouse anti-FPR1 antibody was purchased from Abcam (Cambridge, UK) and the anti-β-actin antibody from Sigma-Aldrich.

2.3. Cell culture Murine myelocytic leukemia (WEHI-3B) cells were cultivated in bicarbonate-buffered DMEM containing 4 mM L-glutamine, 10% fetal calf serum 100 U/ml penicillin and 100 μg/ml streptomycin (Biochrom, Berlin, Germany) in a 37 °C humidified atmosphere of 5% CO2. Being a source of different cytokines WEHI-3B-conditioned medium is used to differentiate bone marrow neutrophils. WEHI-3B-conditioned medium was collected 4 days after the cells had reached confluence. Aliquots were frozen and stored for later use. Murine bEnd5 endothelial cells were cultivated in bicarbonatebuffered DMEM containing 4 mM L-glutamine, 10% fetal calf serum, 1% non-essential amino acids 100x (Gibco, Darmstadt, Germany), 1% sodium pyruvate (PAA, Freiburg, Germany), 0.1% β-mercaptoethanol (Gibco, Darmstadt, Germany), 100 U/ml penicillin and 100 μg/ml streptomycin (Biochrom, Berlin, Germany) in a 37 °C humidified atmosphere of 10% CO2.

2.4. Isolation of murine neutrophils Bone marrow neutrophils were isolated from 8–10 weeks old TRPC1−/− mice and the respective WT littermates as described before [18]. Freshly isolated neutrophils were cultivated in suspension for 16 h in RPMI 1640 medium supplemented with 10% WEHI-3Bconditioned medium, 10% heat-inactivated fetal calf serum, 100 U/ml penicillin and 100 μg/ml streptomycin in a 37 °C humidified atmosphere of 5% CO2.

2.5. Quantitative RT-PCR analysis (qRT-PCR) Total RNA was extracted from neutrophils differentiated during overnight cultures using TRI-reagent (Gibco, Darmstadt, Germany) and treated with DNase (Ambion, Darmstadt, Germany) at 25 °C for 30 min. 2 μg of total RNA was reversed transcribed into cDNA using random hexamer primers (Roche, Penzberg, Germany) and MuLV reverse transcriptase (Roche, Penzberg, Germany). 10 pM of each primer pair and 0.2 μl of the first-strand synthesis were mixed with 2xSsoFastTMEvaGreen®Supermix (Bio-Rad, Munich, Germany) and qRT-PCR was carried out in a real-time thermal cycler Cfx C1000 (BioRad, Munich, Germany) using the following conditions: Initial denaturation step 95 °C for 30 s, followed by 41 cycles of 95 °C for 5 s and 60 °C for 30 s. Fluorescence intensity was measured after the extension step of each cycle. Primer pairs used for the amplification of specific fragments from the first-strand synthesis are listed in Table 1. Primers for hypoxanthin phosphoribosyltransferase 1 (Hprt) and β-2 microglobulin (β2M) were used as endogenous controls. To quantify the results we used the comparative threshold cycle method 2−ΔΔCT [21]. All experiments were performed in triplets and repeated three times. 2.6. Western blotting Neutrophils were seeded in fibronectin-coated (1 μg/cm2) cell culture dishes and stimulated for 1 min with 1 μM fMLP. Afterwards cells were lysed with RIPA lysis buffer containing: 25 mM Tris–HCl pH7.6, 150 mM NaCl, 1% Nonident-P40, 0.1% SDS, 0.5% sodium deoxycholate and protease inhibitor (Complete Mini, Roche, Mannheim, Germany). The protein concentration of the lysates was determined with the Pierce BCA Protein Assay Kit (Thermo Scientific, Rockford, USA). Equal amounts of proteins were transferred on nitrocellulose membranes (PROTRAN, Schleichert Schuell, Dassel, Germany). After blocking unspecific binding sites (5% fat free milk and 0.5% Tween in PBS) proteins of interest were detected overnight using anti-FPR1 antibody (1:300) in the described blocking solution. After washing 3 times for 10 min (PBS, 0.5% Tween) blots were incubated for 1 h with a peroxidaseconjugated secondary antibody with subsequent washing 3 × 10 min with PBS/0.5% Tween. Blots were developed using a chemiluminescence kit (SuperSignal® West Femto, Pierce Biotechnology, Rockford, USA). Autoluminography was carried out with ChemiDoc XRS gel documentation system and Quantity One analysis software (Bio-Rad Laboratories, Hercules, USA). To control the loading of equal amounts of proteins, membranes were stripped after primary detection and subsequently probed with a monoclonal anti-β-actin (1:10,000) antibody. Western blots were repeated with cell lysates from three mice and were analyzed densitometrically. The protein band intensity was corrected by the band intensity of β-actin. 2.7. Trans-endothelial migration (TEM) bEnd5 endothelial cells were seeded in 24 well plates on laminincoated cell culture inserts with 8 μm pores (Greiner bio-one, Frickenhausen, Germany) so that they reached confluence after 3 days. Preceding the experiment, endothelial cells were incubated over night with 5 nM TNF-α (Peprotech, Hamburg, Germany). Transendothelial migration was performed with 10 5 neutrophils from overnight cultures and initiated with 100 nM fMLP in the lower well. After 1 h transmigrated neutrophils were counted in a CASY© cell counter (OLS, Bremen, Germany). 2.8. Endothelial crawling and adhesion of neutrophils bEnd5 endothelial cells were seeded in μ-slide I chambers (Ibidi, Martinsried, Germany) so that they reached confluence after 3 days. Preceding the experiment, endothelial cells were incubated over night with 5 nM TNF-α. Neutrophils from overnight cultures were seeded



3

Table 1 List of primers used for qPCR. Name

Forward (5′-…-3′)

Reverse (5′-…-3′)

Size

TRPC1 Accession: XM_006511053 [20] TRPC2 Accession: NM_001109897 [37] TRPC3 Accession: NM_019510 [42] TRPC4 Accession: NM_016984 [42] TRPC5 Accession: AF029983 [37] TRPC6 Accession: NM_013838 [42] TRPC7 Accession: NM_012035 [37] Hprt Accession: NM_013556 Β2M Accession: NM_009735

GCAACCTTTGCCCTCAAAGTG

GGAGGAACATTCCCAGAAATTTCC

234 bp

ACTTCACTACATATGATCTGGGTCAC

CACGTCCAGGAAGTTCCAC

111 bp

AGCCGAGCCCCTGGAAAGACAC

CCGATGGCGAGGAATGGAAGAC

218 bp

GGGCGGCGTGCTGCTGAT

CCGCGTTGGCTGACTGTATTGTAG

225 bp

GCTGAAGGTGGCAATCAAAT

AAGCCATCGTACCACAAGGT

GACCGTTCATGAAGTTTGTAGCAC

AGTATTCTTTGGGGCCTTGAGTCC

CCCAAACAGATCTTCAGAGTGA

TGCATTCGGACCAGATCAT

84 bp

TCCTCCTCAGACCGCTTTT

CCTGGTTCATCATCGCTAATC

90 bp

GCTATCCAGAAAACCCCTCAA

CATGTCTCGATCCCAGTAGACGGT

into ibidi slides for 10 min at 37 °C and washed gently with 1 ml Ringer's solution (122.5 mM NaCl, 5.4 mM KCl, 1.2 mM CaCl2, 0.8 mM MgCl2, 5.5 mM D-glucose, and 10.0 mM HEPES [pH 7.4]) containing 10nM fMLP. During the experiments a constant shear stress of ~ 2 dyn/cm2 was applied. Experiments were carried out at room temperature and images were acquired in 5 s intervals for 10 min. Camera and image acquisition were controlled by Metaflour software (Visitron Systems, Puchheim, Germany). For quantifying neutrophil movement cell centers were tracked throughout the whole image stack by employing AMIRA software (Template Graphics Software, Mercury Communication Systems, Carlsbad, CA). The tracking allowed the calculation of parameters such as migratory velocity (μm/min) and translocation (μm) by using self-made Java programs and the National Institutes of Health ImageJ software (http://imagej.nih.gov/ij/) [34]. Migration was defined as the movement of the cell center per time unit, the velocity was calculated by applying a three point difference quotient. Translocation was determined as the distance between the cells' positions at the start and the end of the experiment. For neutrophil adhesion on bEnd5 cells, these endothelial cells were seeded in ibidi μ-slide I chambers and stimulated over night with 5 nM TNF-α as described above. During the experiment 5 × 106 neutrophils from overnight cultures were flushed with 10 nM fMLP containing Ringer's solution (see above) into the chamber with a constant shear stress of ~ 2 dyn/cm2. The time span until reaching definite adhesion was evaluated for individual cells. After 5 min the number of adherent cells was analyzed. It is presented as a mean value of three adjacent visual fields. 2.9. 3D chemotaxis assays Chemotaxis assays were performed as previously described [18]. A chemoattractant gradient was established by using 1 μM fMLP plus 100 μg/ml patentblue. Images were acquired (5 s intervals for 30 min at 37 °C) using video cameras (Models XC-ST70CE and XC-77CE, Hamamatsu/Sony, Japan) and PC-vision frame grabber boards (Hamamatsu, Herrsching, Germany). Velocity and translocation were defined as described above. The chemotaxis index was determined as the quotient of the translocation into the direction of the chemoattractant gradient and the total distance covered during the course of the experiment. 2.10. Intracellular calcium measurements Measurement of intracellular Ca2+ of neutrophils was performed as described before [18]. During the recordings a control period with

90 bp 251 bp

299 bp

Ringer's solution was followed by stimulation with 1 μM fMLP. At the end of each experiment the measurements were calibrated by applying 1 μM ionomycin (MP Biomedicals, Solon, USA) containing Ringer's solution with 5 mM EGTA or 5 mM Ca2+. The cytosolic Ca2+ concentration [Ca2+]i was calculated as described before [8] and area under the curve was calculated as integral for the time period after application of the chemoattractant. The manganese quenching method was used as described before to obtain an indirect measure of fMLP-induced Ca2+ influx [18]. Manganese enters the cell via Ca2+ channels, binds with a higher affinity to Fura-2 and thereby eliminates the Ca2+ fluorescence [23]. Thus, the decrease of fluorescence intensity can be taken as an indirect measure of Ca2+ influx. During the experiments a control period was followed by stimulation with 1 μM fMLP. Regression analysis of fluorescence intensities over time was performed to determine the change in fluorescence quenching Δ m (%/t) for a 60 s time period 30 s before and 30 s after fMLP stimulation.

2.11. Ca2+ data processing In order to improve the detection of the cytosolic Ca2+ gradients within migrating neutrophils, binning was reduced to 1 pixel and time resolution during the measurement was increased to 2 s intervals. For image stack processing ImageJ software (http:// http://imagej.nih.gov/ij/) was used in the following steps. High frequency image noise was reduced with a Gaussian blur (2 pix ~ 0.54 μm). Background subtraction was effected using a Rolling-Ball algorithm. Next, the quotient of the two wavelengths 340 and 380 nm was calculated, while a threshold function was used for clean segmentation of the cells. Finally, the Ca2+ concentration was calculated pixel by pixel with individual calibrations for every cell. A quantification of [Ca2+]i gradients resulted from linear regression of line scan analyses (of a width of 5 pix ~ 1.35 μm) along the longitudinal axis of migrating neutrophils.

2.12. Statistical analysis All experiments were repeated at least three times. Values are reported as mean values ± SEM. All data were tested for normality before performing any statistical analysis. For normally distributed data the Student's t test was used, otherwise the Kruskal–Wallace or Mann– Whitney U test was used for statistical analyses. Differences between experimental groups reaching p ≤ 0.05 were considered as significant.


4


Fig. 1. TRPC1 channels are involved in endothelial migration and transmigration of neutrophils. (Ai) Trajectories of WT and TRPC1−/− neutrophils migrating on endothelial cells in the direction of flow (shear rate ~ 2 dyn/cm2); n = 50 cells from five independent experiments, t = 10 min.). Corresponding velocity (Aii) and translocation (Aiii) of WT and TRPC1−/− neutrophils on endothelial cells under flow conditions (n = 50 cells from five independent experiments, t = 10 min). (Bi) Adherent WT and TRPC1−/− neutrophils on endothelial cells (mean cell count from ≥ 4 independent experiments, t = 5 min) (Bii) Time span till adhesion of WT and TRPC1−/− neutrophils to endothelial cells (n ≥ 71 from ≥ 4 independent experiments). (C) Transendothelial migration of neutrophils under control conditions and following chemotactic stimulation (fMLP) (n = 3 from three independent experiments and animals). Values are reported as mean values + SEM. *p b 0.05.

Fig. 2. fMLP induced chemotaxis depends on TRPC1 channels. (A) Trajectories of WT and TRPC1−/− neutrophils chemotaxing towards fMLP (representative trajectories of n = 23 cells from three independent experiments, t = 30 min). Velocity (B), translocation (C), and chemotaxis index (D) of WT and TRPC1−/− neutrophils during chemotaxis towards fMLP (n = 23 cells each from at least three independent experiments). Values are reported as mean values + SEM. *p b 0.05. CI = chemotaxis index.



5

Fig. 3. Loss of TRPC1 enhances fMLP-induced Ca2 + influx. Mean [Ca2+]i response of WT and TRPC1−/− neutrophils after chemokinetic stimulation with fMLP in the presence (Ai) and absence (Bi) of extracellular Ca2+. The corresponding integrals of the [Ca2+]i are depicted in (Aii) and (Bii). (Ci–Cii) Manganese quench experiments with mean Fura-2 fluorescence intensity F when excited at its isobestic wavelength of 365 nm. F is normalized to the mean value of all measurement points. The light-gray area of the curves was not considered for the analysis of the slopes. The corresponding mean change of the slope Δ m (m2 − m1) is shown in (Ciii). n ≥ 74 cells from at least five independent experiments for each condition. Values of graphs are represented as mean values and values of integrals and Δ m are reported as mean values + SEM.*p b 0.05.

3. Results 3.1. Migration and transendothelial recruitment is decreased in TRPC1−/− neutrophils In the first set of experiments we investigated the role of TRPC1 channels in neutrophils for intravascular crawling on endothelial cells under flow conditions and chemokinetic stimulation with 10 nM fMLP. To this end we used ibidi μ-slide I chambers and exposed neutrophils during migration on endothelial cells to a shear stress of ~2 dyn/cm2. The migration of the TRPC1−/− neutrophils was strongly decreased under these conditions (see Fig. 1 Ai–Aiii). Velocity was 30% lower than that of WT cells (4.2 ± 0.20 μm/min versus 6.0 ± 0.20 μm/min). The translocation was even 40% lower in TRPC1−/− neutrophils (14.6 ± 0.9 versus 24.5 ± 1.5 μm). Neutrophil adhesion on endothelial cells was analyzed in the same flow chamber setup as described above and a constant number of suspended neutrophils was flushed over the endothelial cells with a shear stress of ~ 2 dyn/cm2. Neutrophil adhesion was not altered in TRPC1−/− cells (See Fig. 1 Bi–Bii). After 5 min. 13.0 ± 5.7 WT neutrophils and 14.0 ± 4.6 TRPC1−/− cells attached to the endothelial layer. While WT neutrophils adhered to the endothelium after 74 ± 21 s, TRPC1−/− cells did so after 91 ± 14 s.

The impact of the TRPC1 knock-out on transendothelial migration was investigated in TEM assays. In the absence of a chemotactic stimulus TRPC1 deficient and WT neutrophils behaved alike (see Fig. 1 C). In the presence of an fMLP gradient the number of transmigrated WT neutrophils increased by 154% from 1.84 x 104/ml to 4.67 x 104/ml. In contrast, the number of transmigrated TRPC1−/− neutrophils increased only by 59% from 2.06 x 104/ml to 3.27 x 104/ml.

3.2. Chemotaxis depends on TRPC1 channels During the neutrophil recruitment cascade, intravascular crawling and transmigration is followed by chemotactic migration through the extracellular matrix. In the next step, we therefore analyzed the chemotactic migration in a 3D collagen I matrix. Chemotaxis of TRPC1−/− neutrophils towards fMLP was decreased (see Fig. 2 A). Velocity was slightly reduced in TRPC1−/− neutrophils by 8% from 11.90 (±0.36) μm/min in WT cells to 10.90 (±0.28) μm/min in TRPC1−/− cells. In contrast, translocation was diminished more strongly by 28% from 157.0 (±10.30) μm in WT cells to 113.0 (±9.90) μm in TRPC1−/− neutrophils. Moreover, the chemotaxis index, which describes the efficiency of the directed migration, was reduced by 29% (0.38 ± 0.04 in WT and 0.27 ± 0.03 in TRPC1−/− neutrophils) (see Fig 2 B–D). Thus, the loss of TRPC1 strongly


6


reduced the directional movement of the neutrophils, while their velocity was influenced only minimally. 3.3. Loss of TRPC1 channels enhances fMLP-induced rise of [Ca2+]i Next, we wanted to determine the involvement of TRPC1 channels in fMLP-induced intracellular Ca2+ signaling. To this end, we measured the [Ca2+]i during stimulation of the neutrophils with fMLP. These experiments are illustrated in Fig. 3. The left panel depicts the mean [Ca2+]i over time, while the right panel displays the respective integrals (area under the curve, Fig. 3 A–B) calculated for the time period following the application of 1 μM fMLP. The addition of fMLP caused an increase of cytosolic Ca2+ in both cell types with an initial fast rise, a more slowly evolving second maximum peak and a much slower decrease to baseline (see Fig 3 Ai–Aii). Quite surprisingly, the fMLPinduced second increase of cytosolic Ca2+ was much higher in TRPC1−/− neutrophils than in WT cells. In the following set of experiments, we wanted to determine whether the more pronounced fMLP-induced rise of the [Ca2+]i in TRPC1−/− neutrophils is due to increased store release or influx from the extracellular space. By omitting Ca2+ in the extracellular medium it is possible to analyze exclusively the mobilization of Ca2+ from internal stores. In the absence of extracellular Ca2+, fMLP elicited only a small increase of the [Ca2+]i (see Fig. 3 B). Notably, stimulation with fMLP caused a similar rise of the [Ca2+]i in both cell types. Thus, the fMLP-induced depletion of intracellular Ca2+ stores was not altered by the loss of TRPC1 channels. The Mn2+ quench technique enables the analysis of the Ca2+ influx over the cell membrane. The quenching of the Ca2+ bound Fura-2 fluorescence by Mn2+ is an indirect measure for the Ca2+ influx. Fig. 3Ci– 3Cii depict the percentage decrease of the Fura-2 fluorescence intensity after fMLP stimulation, and Fig. 3Ciii describes the change of slope Δ m (m2 − m1) before (m1) and after application of 1 μM fMLP (m2). fMLP elicited a higher quenching rate of the fura-2 fluorescence in TRPC1−/− as compared to WT neutrophils. These results clearly show that the defect in fMLP mediated migration and chemotaxis of the TRPC1−/− neutrophils was accompanied by an increased and prolonged Ca2+ influx. 3.4. Loss of TRPC1 increases expression of other TRPC channels In order to determine the expression profile of TRPC channel family members in murine neutrophils, we performed a series of quantitative RT-PCRs (see Fig. 4 A). The mRNA expression of TRPC1, TRPC2, TRPC3, TRPC4, TRPC6 and TRPC7 was normalized to the expression of the β2M gene and Hprt gene (not shown). Starting from a very low level there was a small increase in TRPC3 and TRPC4 mRNA expression and a slight increase in TRPC2 RNA expression in the TRPC1−/− neutrophils. Protein expression of formyl peptide receptor 1 (FPR1) was analyzed by Western Blot (see Fig. 4 Bi–Bii). No difference in FPR1 expression could be detected when comparing WT with TRPC1−/− neutrophils. 3.5. TRPC1 regulates maintenance of Ca2+ gradients which are essential for cell migration In the last set of experiments we wanted to clarify, whether the increased rise of [Ca2+]i in the TRPC1−/− neutrophils influenced the cytosolic distribution of Ca2+ during migration. Image processing enabled us to depict the gradients of [Ca2+]i more clearly (see Fig. 5). During fMLP stimulated migration the neutrophils exhibited front to rear gradients of [Ca2+]i. While the [Ca2+]i at the cell front was increased in the TRPC1−/− cells (Fig. 5 Bi), the overall gradients of [Ca2+]i were steeper in the TRPC1−/− cells in comparison to the WT cells (Fig. 5 Bii). Thus, the increased Ca2+ influx after fMLP stimulation in the TRPC1−/− neutrophils was linked to a steeper front to rear gradient of [Ca2+]i leading to a defect in directed migration.

Fig. 4. Expression of TRPC3 and TRPC4 is enhanced in TRPC1−/− neutrophils. (A) Quantitative RT PCR expression levels of TRPC1, TRPC2, TRPC3, TRPC4, TRPC5 and TRPC6 in WT and TRPC1−/− neutrophils relative to β2 microglobulin (n = 3 from three independent experiments and animals). (Bi) Western blot analysis of FPR1 expression after fMLP stimulation of neutrophils. (Bii) For densitometric quantification equal loading was normalized to expression of β-actin (n = 3 from three independent experiments and animals). Values are reported as mean values + SEM.

4. Discussion More than 20 years ago Brundage et al. found a front to rear gradient of cytosolic Ca2+ in chemotactic cells with an increasing concentration towards the rear [2,3]. In addition to these long range cytosolic Ca2+ gradients, spatially and temporally strictly confined Ca2+ flickers have been observed at the front of migrating cells [14,41]. Especially during chemotaxis, these Ca2+ flickers at the cell front could result from the activation of G-protein coupled chemoattractant receptors. The central question addressed in this study is whether TRPC1 channels, which have been shown to be involved in directed migration and chemotaxis of transformed canine kidney cells [10,11] and glioma cells [1], contribute to fMLP mediated intravasal migration and chemotaxis of murine neutrophils. We could show that TRPC1 channels are important regulatory components of fMLP-driven migration and chemotaxis in neutrophils. This is illustrated by the decreased migration on endothelial cells and endothelial transmigration of the TRPC1−/− neutrophils. Nevertheless, adhesion of fMLP-stimulated neutrophils to endothelial cells was not affected by the loss of TRPC1. In this context it is noteworthy that the defect of the migratory behavior was more pronounced when neutrophils were migrating on endothelial cells (even under static conditions) than in a collagen I matrix. While the migratory speed in a collagen I gel differed only minimally (− 8%), TRPC1−/− neutrophils migrated much more slowly on endothelial cells than WT neutrophils (−34%). So far, we can only speculate whether this differential behavior can be linked to different integrins employed on endothelial cells (β2) or on collagen I (β1). Moreover, chemotaxis of the TRPC1 deficient neutrophils towards fMLP was impaired. Thus, the loss of TRPC1 causes a migratory and chemotactic defect in neutrophils after activation of the fMLP receptor. The physiological relevance of this migratory and chemotaxis defect is supported by an allergen-induced pulmonary inflammation model



7

Fig. 5. Steepened Ca2 + gradients in TRPC1−/− neutrophils. (Ai) Representative ratiometric pseudocolor images of Fura-2 loaded WT and TRPC1−/− neutrophils after image processing and corresponding linescan analyses of [Ca2+]i gradients with linear regression (Aii). (Bi) Rear–front difference of [Ca2+]i as a function of [Ca2+]i at the cell front of migrating neutrophils. Each dot represents a measurement point of a single cell. Depending on the duration of the experiment up to 34 data point are included from one cell. (n ≥ 8 cells each from at least 3 independent experiments and animals). Graph contains the following descriptive statistics: weighted median (filled square), weighted 75% quartile (positive outlier) and weighted 25% quartile (negative outlier). (Bii) Summary of the linear regression analyses of [Ca2+]i gradients from linescans of migrating WT and TRPC1−/− neutrophils. The relative gradient of [Ca2+]i is normalized to [Ca2+]i at the cell front (n ≥ 7 cells each from at least 3 independent experiments and animals). Boxplots contain the following descriptive statistics: median (horizontal line), mean (filled square), interquartile range (box), and whiskers (outlier). *p b 0.05.

which revealed a reduced number of infiltrated leukocytes in the lung of TRPC1 deficient mice [43]. Neutrophil activation is strongly mediated by formyl peptides which are released during the degradation of bacterial cells or mitochondria of host cells. Formyl peptides are described as end-target chemottractants leading the neutrophils directly to the site of inflammation to fight pathogens [13]. In this context it has been shown that formyl peptides are hierarchically more relevant for neutrophil activation than host derived intermediary chemoattractants [12,13]. This underlines the physiological relevance of these end-target chemoattractants during an inflammatory process. One of the first steps upon chemoattractant binding to the G protein-coupled formyl peptide receptor (FPR) is the rise of cytosolic Ca2+. This Ca2+ mobilization is mediated by phospholipase Cβ2 (PLCβ2) [30]. PLCβ2 hydrolyzes PIP2 into DAG and IP3. The latter induces the release of Ca2+ from intracellular stores leading to activation of cell membrane Ca2+ channels (SOCE). In human neutrophils Orai1 has been described to be the predominant SOCE channel that mediates fMLPinduced Ca2+ entry [32]. ROCE is mainly induced by DAG which directly activates cell membrane Ca2+ channels. The activation by DAG has been shown for several TRPC channels like TRPC3, TRPC6 and TRPC7 [7]. A direct contribution to a chemoattractant receptor-induced Ca2+ entry could be shown for TRPC6 channels in CXCR2 signaling and for TRPM2 in chemotaxis towards fMLP [18,28]. However, so far it is not known whether in addition to TRMP2 channels other Ca2+ permeable channels are related to FPR signaling. In this study we could show that TRPC1 contributes to fMLP-induced rise of the [Ca2+]i, but apparently in a more complex way than simply being a Ca2+ permeable channel itself.

TRPC1 channels rather seem to regulate the activity of other elements of the FPR signaling pathway. This is evidenced by the Mn2+ quench experiments, which revealed enhanced Ca2+ influx after FPR activation in the TRPC1−/− neutrophils. In contrast, the Ca2+ mobilization in the absence of extracellular Ca2+ was not altered in the TRPC1−/− neutrophils indicating that fMLP-induced Ca2+ store depletion does not depend on TRPC1 channels. The question remains how TRPC1 channels modulate the fMLPinduced rise of the [Ca2+]i. TRPC1 forms functional heterotetrameric channel complexes with all members of the TRPC channel family [37]. In Gn11 neurons TRPC1 decreases the Ca2+ selectivity of TRPC heteromers, while the loss of TRPC1 in theses heteromers enhances their Ca2+ permeability [37]. This could be a possible explanation for our observations that the loss of TRPC1 channels led to an increase of fMLP-induced Ca2+ influx. On the other hand, we cannot rule out that altered expression of other TRP(C) channels accounts for the increased rise of the [Ca2+]i in TRPC1−/− neutrophils. However, the expression of TRPC3 and TRPC4 was only slightly enhanced in TRPC1−/− neutrophils. Another candidate, which is involved in the fMLP-induced Ca2+ signaling, is the ADPR-sensitive TRPM2 channel. fMLP-induced Ca2+ influx has been shown to be supported by TRPM2, which is activated by the CD38 enzyme reaction and thus mediates neutrophil chemotaxis [28]. However, to the best of our knowledge it is not yet known, whether TRPM2 channels are also regulated by TRPC1. Interestingly, the enhanced Ca2+ signaling after FPR activation in the TRPC1−/− neutrophils is associated with a steeper front to rear Ca2+ gradient. Although the [Ca2+]i at the front of the TRPC1−/− neutrophils


8


was increased, the overall Ca2+ gradient of the TRPC1 deficient cells was steepened in comparison to WT cells. The global gradient of [Ca2+]i is at least in part formed by the subcellular distribution of Ca2+ storing organelles [35]. The thin lamellipodium is virtually organelle-free [5] so that Ca2+ release from intracellular Ca2+ stores occurs predominantly in the cell body [33]. Along these lines, the steepened intracellular Ca2+ gradient in TRPC1−/− cells might be a result of an increased filling state of the Ca2+ stores. Ca2+ signaling during chemotaxis requires spatiotemporal fine-tuning. On the one hand this is based on the high buffering capacity of Ca2+ binding proteins in the cytosol, and on the other hand caused by a quick uptake of Ca2+ to the endoplasmatic reticulum or Ca2+ export over the plasma membrane [4]. In the TRPC1−/− neutrophils the increased Ca2+ influx after FPR activation may lead to an increased uptake of Ca2+ to the endoplasmatic reticulum or mitochondira which then increase the leak efflux from the stores thereby causing a steepening of the overall intracellular Ca2+ gradient. However, we are well aware that this model still requires experimental verification. Brundage et al. linked the steepening of the intracellular Ca2+ gradient to turning of eosinophils, while the Ca2+ gradient was flattened during periods of more directed migration [2,3]. Potentially, the migratory and chemotactic defect in the TRPC1−/− neutrophils is based on the steepened gradient of [Ca2+]i. Thus, possibly the permanently increased Ca2+ concentration at the rear end of the migrating TRPC1−/− neutrophils is constantly signaling the cell to turn and reorient within the chemotactic gradient. This reorientation could be mediated by enhanced calpain activity which facilitates the retraction of the uropod. In summary, Ca2+ is one of the big players in cell migration and chemotaxis. In the last years, several members of the TRP channel family have been shown to be involved in several steps of the migration machinery. This study identifies TRPC1 to be involved in fMLP mediated migration and chemotaxis of murine neutrophils. The loss of TRPC1 reduces neutrophil migration, transmigration and chemotaxis, while fMLP induced Ca2+ influx is enhanced. The fMLP-mediated rise of the [Ca2+]i is linked to a steepened front to rear Ca2+ gradient in the TRPC1 deficient neutrophils leading to a less directed migration. Hence, the chemoattractant receptor triggered increase of [Ca2+]i must be tightly regulated, since aberrations in concentration or time course of the elevation of the [Ca2+]i lead to a loss of functionality of the migration machinery. The physiological relevance of our findings on the role of TRPC1 in chemotaxis is underlined by the allergen induced immune deficiency of TRPC1−/− mice in which less neutrophils infiltrate the lungs [43]. Thus, TRPC1 could be an interesting target for immunotherapy in neutrophil based immune diseases like asthma [24]. Acknowledgements We thank the group of Alexander Dietrich (LMU Munich) for providing us the TRPC1−/− mice. This works was supported by the IZKF Münster, Deutsche Forschungsgemeinschaft, Cells-in-Motion Cluster of Excellence (EXC 1003 – CiM), University of Münster, Germany and the Marie-Curie Initial Training Network (IonTraC – 289648). References [1] V.C. Bomben, K.L. Turner, T.T. Barclay, H. Sontheimer, Transient receptor potential canonical channels are essential for chemotactic migration of human malignant gliomas, J. Cell. Physiol. 226 (2011) 1879–1888. [2] R.A. Brundage, K.E. Fogarty, R.A. Tuft, F.S. Fay, Calcium gradients underlying polarization and chemotaxis of eosinophils, Science 254 (1991) 703–706. [3] R.A. Brundage, K.E. Fogarty, R.A. Tuft, F.S. Fay, Chemotaxis of newt eosinophils — calcium regulation of chemotactic response, Am. J. Physiol. 265 (1993) C1527–C1543. [4] D.E. Clapham, Calcium signaling, Cell 131 (2007) 1047–1058. [5] J.R. Couchman, D.A. Rees, Organelle–cytoskeleton relationships in fibroblasts — mitochondria, golgi-apparatus, and endoplasmic-reticulum in phases of movement and growth, Eur. J. Cell Biol. 27 (1982) 47–54. [6] N. Damann, G. Owsianik, S. Li, C. Poll, B. Nilius, The Calcium-conducting ion channel transient receptor potential canonical 6 is involved in macrophage inflammatory protein-2-induced migration of mouse neutrophils, Acta Physiol. 195 (2009) 3–11.

[7] A. Dietrich, H. Kalwa, B.R. Rost, T. Gudermann, The diacylgylcerol-sensitive TRPC3/6/ 7 subfamily of cation channels: functional characterization and physiological relevance, Pflugers Arch. - Eur. J. Physiol. 451 (2005) 72–80. [8] V. Dreval, P. Dieterich, C. Stock, A. Schwab, The role of Ca2+ transport across the plasma membrane for cell migration, Cell. Physiol. Biochem. 16 (2005) 119–126. [9] R.J. Eddy, L.M. Pierini, F. Matsumura, F.R. Maxfield, Ca2+-dependent myosin II activation is required for uropod retraction during neutrophil migration, J. Cell Sci. 113 (2000) 1287–1298. [10] A. Fabian, T. Fortmann, P. Dieterich, C. Riethmueller, P. Schoen, S. Mally, B. Nilius, A. Schwab, TRPC1 channels regulate directionality of migrating cells, Pflugers Arch. Eur. J. Physiol. 457 (2008) 475–484. [11] A. Fabian, T. Fortmann, E. Bulk, V.C. Bomben, H. Sontheimer, A. Schwab, Chemotaxis of MDCK-F cells toward fibroblast growth factor-2 depends on transient receptor potential canonical channel 1, Pflugers Arch. - Eur. J. Physiol. 461 (2011) 295–306. [12] B. Heit, L.X. Liu, P. Colarusso, K.D. Puri, P. Kubes, PI3K accelerates, but is not required for, neutrophil chemotaxis to fMLP, J. Cell Sci. 121 (2008) 205–214. [13] B. Heit, S. Tavener, E. Raharjo, P. Kubes, An intracellular signaling hierarchy determines direction of migration in opposing chemotactic gradients, J. Cell Biol. 159 (2002) 91–102. [14] E.J. Hillson, M.B. Hallett, Localised and rapid Ca2+ micro-events in human neutrophils: conventional Ca2+ puffs and global waves without peripheral-restriction or wave cycling, Cell Calcium 41 (2007) 525–536. [15] E. Kolaczkowska, P. Kubes, Neutrophil recruitment and function in health and inflammation, Nat. Rev. Immunol. 13 (2013) 159–175. [16] H. Komuro, T. Kumada, Ca2+ transients control CNS neuronal migration, Cell Calcium 37 (2005) 387–393. [17] K. Ley, C. Laudanna, M.I. Cybulsky, S. Nourshargh, Getting to the site of inflammation: the leukocyte adhesion cascade updated, Nat. Rev. Immunol. 7 (2007) 678–689. [18] O. Lindemann, D. Umlauf, S. Frank, S. Schimmelpfennig, J. Bertrand, T. Pap, P.J. Hanley, A. Fabian, A. Dietrich, A. Schwab, TRPC6 regulates CXCR2-mediated chemotaxis of murine neutrophils, J. Immunol. 190 (2013) 5496–5505. [19] W.S. Liu, C.A. Heckman, The sevenfold way of PKC regulation, Cell. Signal. 10 (1998) 529–542. [20] X.B. Liu, K.T. Cheng, B.C. Bandyopadhyay, B. Pani, A. Dietrich, B.C. Paria, W.D. Swaim, D. Beech, E. Yildrim, B.B. Singh, L. Birnbaumer, I.S. Ambudkar, Attenuation of storeoperated Ca2+ current impairs salivary gland fluid secretion in TRPC1(−/−) mice, Proc. Natl. Acad. Sci. U. S. A. 104 (2007) 17542–17547. [21] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(− Delta Delta C) method, Methods 25 (2001) 402–408. [22] J.T.H. Mandeville, F.R. Maxfield, Effects of buffering intracellular free calcium on neutrophil migration through three-dimensional matrices, J. Cell. Physiol. 171 (1997) 168–178. [23] J.E. Merritt, R. Jacob, T.J. Hallam, Use of manganese to discriminate between calcium influx and mobilization from internal stores in stimulated human-neutrophils, J. Biol. Chem. 264 (1989) 1522–1527. [24] J. Monteseirin, Neutrophils and asthma, J. Investig. Allergol. Clin. Immunol. 19 (2009) 340–354. [25] W.A. Muller, Mechanisms of leukocyte transendothelial migration, Ann. Rev. Pathophysiol. Mech. Dis. (2011) 323–344. [26] V. Niggli, Signaling to migration in neutrophils: importance of localized pathways, Int. J. Biochem. Cell Biol. 35 (2003) 1619–1638. [27] S.P. Palecek, A. Huttenlocher, A.F. Horwitz, D.A. Lauffenburger, Physical and biochemical regulation of integrin release during rear detachment of migrating cells, J. Cell Sci. 111 (1998) 929–940. [28] S. Partida-Sanchez, A. Gasser, R. Fliegert, C.C. Siebrands, W. Dammermann, G. Shi, B.J. Mousseau, A. Sumoza-Toledo, H. Bhagat, T.F. Walseth, A.H. Guse, F.E. Lund, Chemotaxis of mouse bone marrow neutrophils and dendritic cells is controlled by ADPRibose, the major product generated by the CD38 enzyme reaction, J. Immunol. 179 (2007) 7827–7839. [29] E.J. Pettit, F.S. Fay, Cytosolic free calcium and the cytoskeleton in the control of leukocyte chemotaxis, Physiol. Rev. 78 (1998) 949–967. [30] M.J. Rabiet, E. Huet, F. Boulay, The N-formyl peptide receptors and the anaphylatoxin C5a receptors: an overview, Biochimie 89 (2007) 1089–1106. [31] A.J. Ridley, M.A. Schwartz, K. Burridge, R.A. Firtel, M.H. Ginsberg, G. Borisy, J.T. Parsons, A.R. Horwitz, Cell migration: integrating signals from front to back, Science 302 (2003) 1704–1709. [32] U.Y. Schaff, N. Dixit, E. Procyk, I. Yamayoshi, T. Tse, S.I. Simon, Orai1 regulates intracellular calcium, arrest, and shape polarization during neutrophil recruitment in shear flow, Blood 115 (2010) 657–666. [33] A. Schwab, F. Finsterwalder, U. Kersting, T. Danker, H. Oberleithner, Intracellular Ca 2+ distribution in migrating transformed renal epithelial cells, Pflugers Arch. - Eur. J. Physiol. 434 (1997) 70–76. [34] A. Schwab, A. Wulf, C. Schulz, W. Kessler, V. Nechyporuk-Zloy, M. Romer, J. Reinhardt, D. Weinhold, P. Dieterich, C. Stock, S.C. Hebert, Subcellular distribution of calcium-sensitive potassium channels (IK1) in migrating cells, J. Cell. Physiol. 206 (2006) 86–94. [35] A. Schwab, A. Fabian, P.J. Hanley, C. Stock, Role of ion channels and transporters in cell migration, Physiol. Rev. 92 (2012) 1865–1913. [36] J.T. Smyth, S.Y. Hwang, T. Tomita, W.I. DeHaven, J.C. Mercer, J.W. Putney, Activation and regulation of store-operated calcium entry, J. Cell. Mol. Med. 14 (2010) 2337–2349. [37] U. Storch, A.L. Forst, M. Philipp, T. Gudermann, M. Schnitzler, Transient receptor potential channel 1 (TRPC1) reduces calcium permeability in heteromeric channel complexes, J. Biol. Chem. 287 (2012) 3530–3540.


O. Lindemann et al. / Biochimica et Biophysica Acta xxx (2015) xxx–xxx [38] L. Svensson, A. McDowall, K.M. Giles, P. Stanley, S. Feske, N. Hogg, Calpain 2 controls turnover of LFA-1 adhesions on migrating T lymphocytes, Plos One 5 (2010). [39] F.C. Tsai, A. Seki, H.W. Yang, A. Hayer, S. Carrasco, S. Malmersjoe, T. Meyer, A polarized Ca2+, diacylglycerol and STIM1 signalling system regulates directed cell migration, Nat. Cell Biol. 16 (2014) 133–144. [40] D.J. Webb, J.T. Parsons, A.F. Horwitz, Adhesion assembly, disassembly and turnover in migrating cells — over and over and over again, Nat. Cell Biol. 4 (2002) E97–E100. [41] C. Wei, X. Wang, M. Chen, K. Ouyang, L.S. Song, H. Cheng, Calcium flickers steer cell migration, Nature 457 (2009) 901–905.

9

[42] N. Weissmann, A. Sydykov, H. Kalwa, U. Storch, B. Fuchs, M. Schnitzler, R.P. Brandes, F. Grimminger, M. Meissner, M. Freichel, S. Offermanns, F. Veit, O. Pak, K.H. Krause, R.T. Schermuly, A.C. Brewer, H.H. Schmidt, W. Seeger, A.M. Shah, T. Gudermann, H.A. Ghofrani, A. Dietrich, Activation of TRPC6 channels is essential for lung ischaemia– reperfusion induced oedema in mice, Nat. Commun. 3 (2012). [43] E. Yildirim, M.A. Carey, J.W. Card, A. Dietrich, G.P. Flake, Y. Zhang, J. Bradbury, Y. Rebolloso, D.R. Germolec, D.L. Morgan, D.C. Zeldin, L. Birnbaumer, Severely blunted allergen-induced pulmonary Th2 cell response and lung hyperresponsiveness in type 1 transient receptor potential channel-deficient mice, Am. J. Physiol. Lung Cell. Mol. Physiol. 303 (2012) L539–L549.


In vitro effects of bisphosphonates on chemotaxis, phagocytosis, and oxidative burst of neutrophil granulocytes.

Neutrophil Granulocytes in Ovarian Cancer - Induction of Epithelial-To-Mesenchymal-Transition and Tumor Cell Migration.

Phosphatase Wip1 negatively regulates neutrophil migration and inflammation.

Structural analysis of human neutrophil migration. Centriole, microtubule, and microfilament orientation and function during chemotaxis.

CD64 expression by neutrophil granulocytes.

Neutrophil function in anergic surgical patients: neutrophil adherence and chemotaxis.

Neutrophil chemotaxis and adhesion in preterm babies.

Effect of quinolones on human neutrophil chemotaxis.

PKD signaling pathway regulates the cofilin phosphatase slingshot 2 in neutrophil chemotaxis.

Chemotaxis during neural crest migration.

Redistribution of myeloperoxidase and elastase in human neutrophil granulocytes.

Neutrophil chemotaxis in patients with burns.

Impaired neutrophil chemotaxis in Pelger-Huët anomaly.

Angiopoietin-1 enhances neutrophil chemotaxis in vitro and migration in vivo through interaction with CD18 and release of CCL4.

Exosomes Mediate LTB4 Release during Neutrophil Chemotaxis.

Stimulation of human eosinophil and neutrophil polymorphonuclear leukocyte chemotaxis and random migration by 12-L-hydroxy-5,8,10,14-eicosatetraenoic acid.

mTOR and differential activation of mitochondria orchestrate neutrophil chemotaxis.

Inhibition of human neutrophil chemotaxis and chemiluminescence by amphotericin B.

Effects of proinflammatory mediators on canine neutrophil chemotaxis and aggregation.

Staphylococcal Superantigen-Like Protein 1 and 5 (SSL1 & SSL5) Limit Neutrophil Chemotaxis and Migration through MMP-Inhibition.

TRPC1 regulates calcium-activated chloride channels in salivary gland cells.

A dual-docking microfluidic cell migration assay (D2-Chip) for testing neutrophil chemotaxis and the memory effect.

The antifolate 10-deazaaminopterin inhibits neutrophil chemotaxis and superoxide generation.

Neutrophil (PMN) phagocytosis and chemotaxis after reperfusion injury.