Lipids (2014) 49:495–504 DOI 10.1007/s11745-014-3889-4

ORIGINAL ARTICLE

Triolein and Trilinolein Ameliorate Oxidized Low-Density Lipoprotein-Induced Oxidative Stress in Endothelial Cells Ting Luo • Ze-yuan Deng • Xiao-ping Li Huan Rao • Ya-wei Fan

•

Received: 5 April 2013 / Accepted: 11 February 2014 / Published online: 7 March 2014 Ó AOCS 2014

Abstract Uptake of oxidized low-density lipoprotein by endothelial cells is a critical step for the initiation of atherosclerosis. Triacylglycerol uptake in these cells is understood to be a part of the process. The present investigation, comparison among the effects of simple acylglycerol, including tristearin, triolein, and trilinolein, upon oxidized low-density lipoprotein -induced oxidative stress was undertaken. Results indicated that trilinolein (78 % ± 0.02) and triolein (90 % ± 0.01) increased cell viability of endothelial cells exposed to oxidized lowdensity lipoprotein, whereas tristearin decreased the cell viability (55 % ± 0.03) (P \ 0.05). Oxidized low-density lipoprotein treatment significantly increased apoptosis (23 %), compared to cells simultaneously exposed to trilinolein (19 %) or triolein (16 %), where apoptosis was reduced (P \ 0.05). On the other hand, exposure to tristearin further increased oxidized low-density lipoprotein induced cell apoptosis (34 %). Treatment with trilinolein or triolein on oxidized low-density lipoprotein -stimulated endothelial cells inhibited the expression of ICAM-1 and E-selectin mRNA. Moreover, both trilinolein and triolein demonstrated a strong antioxidant response to oxidative stress caused by oxidized low-density lipoprotein. Taken together, the results indicate trilinolein and triolein possess

anti-inflammatory properties, which are mediated via the antioxidant defense system. Keywords Fatty acids
Simple acylglycerol
Malondialdehyde
Superoxide dismutase
Glutathione peroxidase
Antioxidant defense system Abbreviations EC Endothelial cells FFA Free fatty acids GPX Glutathione peroxidase GSH Glutathione ICAM-1 Intracellular adhesion molecule-1 LLL Trilinolein LNA Linoleic Acid MDA Malondialdehyde MTT 3-(4,5-Dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide OLA Oleic acid OOO Triolein ox-LDL Oxidized low-density lipoprotein PBS Phosphate-buffered saline SA Simple acylglycerol SOD Superoxide dismutase SSS Tristearin STA Stearic acid

T. Luo
Z. Deng
X. Li
H. Rao
Y. Fan (&) State Key Laboratory of Food Science and Technology, Nanchang University, Nanchang 330047, China e-mail: [email protected]

Introduction

Z. Deng Nanoscale Science and Technology Laboratory, Institute for Advanced Study, Nanchang University, Nanchang 330047, China e-mail: [email protected]

Atherosclerosis is the primary etiology of cardiovascular disease [1]. The mechanism of atherosclerosis is only partly characterized, but the development of atherosclerotic plaques has been hypothesized to be a ‘‘response to injury’’

123

496

to the vessel wall [1–4]. Several different sources of injuries to the endothelium (including oxidized low-density lipoprotein (ox-LDL), mechanical stress, elevated homocysteine levels, immunological responses, or exposure to toxins or viruses) may all contribute to endothelial dysfunction [4]. In accordance with the ‘‘response to injury’’ hypothesis, endothelial dysfunction may be the first event in atherogenesis [3]. Oxidized low-density lipoprotein, a common factor used to establish experimental atherosclerosis [5–7], contributes greatly to the development and progression of atherosclerosis. Exposure of endothelial cells (EC) to ox-LDL produces diverse cellular effects, including induction of the expression of adhesion molecules in EC, a reduction in the synthesis of EC-derived relaxing factor, and enhancement of EC apoptosis [8]. In the atherogenic process, EC with lesions are associated with an up-regulation of intracellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1), and E-selectin [9–12], which are involved in the inflammatory process of AS. It has been widely accepted that atherosclerosis is related to a high intake of saturated fatty acids and cholesterol but inversely related to a low intake of unsaturated fatty acids [13–16]. It has been reported that linoleic acid (LNA) suppresses lipogenic gene expression and enhances oxidative metabolism in the liver [17]. Conversely, saturated fatty acids (e.g. palmitic) produce the opposite effect [17]. Cellular and molecular mechanisms of the effects of fatty acids and the incidence of atherosclerosis are still unclear. Previous studies have shown that the elevated dietary saturated fatty acids, related to the increasing ratio of low-density lipoprotein to high-density lipoprotein cholesterol ratio, as well as the concentrations of lowdensity lipoprotein and total cholesterol [18], may lead to the development of atherosclerosis [19]. Saturated fatty acids are considered to promote the metabolic syndrome and atherosclerotic cardiovascular disease by activating Toll-like receptor 4 [20]. Palmitate has been described to induce inflammation in adipocytes by activating the NF-jB transcription factor and inducing IL-6 and TNFa expression [21]. In contrast, unsaturated fatty acids (cis-monounsaturated and polyunsaturated fatty acids) protect against atherosclerosis by promoting favorable ratios of highdensity lipoprotein to low-density lipoprotein cholesterol and lowering concentrations of total cholesterol [18]. The 18-carbon fatty acids stearic acid (STA), oleic acid (OLA), and LNA are among the most common dietary fatty acids. These fatty acids are thought to induce potentially detrimental or beneficial changes in cardiovascular disease [22]. Controlled dietary experiments provided the comparisons of serum cholesterol averages for groups of men on chemically characterized diets. Results showed that dietary stearic acid has no effect on serum cholesterol

123

Lipids (2014) 49:495–504

concentration [23]. OLA intake is associated with the prevention of cardiovascular disease [24]. The cholesterol lowering properties of LNA have been known for many years [25]. Most studies have evaluated how free fatty acids (FFA) influenced the formation of atherosclerosis [15, 26, 27], with little attention to triacylglycerol. However, it is the form of TAG that is of more importance. Since dietary lipids exist predominantly as TAG but not FFA, the study of triacylglycerol, is important to understand [28]. Three kinds of SM (tristearin (SSS), triolein (OOO), and trilinolein (LLL)) were chosen in our investigation to evaluate their effects on the function of ox-LDL-stimulated EC. SSS is as a triacylglycerol derived from three units of the saturated fatty acid. STA is obtained from animal fats. OOO is a symmetrical triacylglycerol derived from three units of the mono-unsaturated fatty acid OLA, and is the predominant fatty acid in olive oil [22]. LLL is a triacylglycerol derived from three units of polyunsaturated fatty acid LNA, can be obtained, for example, from sunflower oil [29]. Experimental studies have indicated that oxidative stress induced by ox-LDL in endothelial cells plays an important role in the pathogenesis of atherosclerosis [30]. Oxidative stress is a state of imbalance between pro-oxidants and antioxidative defenses towards pro-oxidants that can be caused either by the overproduction of reactive oxygen species or a decline of the antioxidant defense system [31]. It has been reported that olive oil, rich in OLA, possesses the antioxidant capacity, which makes this oil a preferable choice for diseases preventing diets [32]. The aim of the study is to compare the effects of simple acylglycerol on the function of EC in an atherosclerosis model and to uncover whether cellular antioxidant defense response was involved in the effects.

Materials and Methods Materials and Reagents Endothelial cells, human umbilical vein endothelial cells, were provided by Nanchang University Medical School. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and dimethylsulfoxide were purchased from Sigma (St. Louis, MO, USA). High-glucose Dulbecco’s Modified Eagle medium (DMEM), fetal bovine serum and Penicillin–Streptomycin Solution were purchased from GIBCO (Carlsbad, USA). Ox-LDL mL was purchased from Yiyuan Biotechnologies (Guangzhou, China). Trilinolein(9c,12c), tristearin, and triolein (purities were C98 %) were purchased from Sigma(St. Louis, MO, USA). Propidium iodide (PI) staining (50 lg/mL in PBS) was obtained from KeyGEN (Nanjing, China). The Annexin

Lipids (2014) 49:495–504

V-FITC Apoptosis Detection Kit was obtained from KeyGEN (Nanjing, China). The PrimerScriptTM RT-PCR kit was obtained from TaKaRa (Japan). Malondialdehyde (MDA), glutathione peroxidase (GPX), and the superoxide dismutase (SOD) assay kit was from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). LNA, STA, and OLA (purities were C98 %) were supplied by Sigma (Poole, Dorset, UK). Cell Culture Endothelial cells were cultured in Dulbecco’s Modified Eagle medium supplemented with 10 % fetal bovine serum, and were maintained in a humidified atmosphere containing 5 % CO2 at 37 °C. The medium was replaced every 2 days and the cells were passaged at 80 % confluence using a 0.25 % trypsin and 0.02 % EDTA solution. Cells between passages 3 and 10 were used in the present study.

497

(SSS, OOO, and LLL dissolved in 0.05 % cholate) for 24 h. MTT assay described above was used to evaluate the viability of the cells. Effects of SA or FFA on the Cell Survival Endothelial cells were treated with ox-LDL (50 lg/mL) and SA (SSS, OOO, and LLL) of 0.01 mmol/L for 24 h, or treated with ox-LDL (50 lg/mL) and fatty acids (LNA, OLA, and STA) of 0.01 mmol/L and 0.03 mmol/L for 24 h. The effect was measured with an MTT assay. Effects of SA on the Cell Apoptosis Endothelial cells were treated with ox-LDL (50 lg/mL) and SA (SSS, OOO, and LLL) of 0.01 mmol/L for 24 h. The effect was detected by Flow cytometry analysis. Analysis of the mRNA Expression

Effects of ox-LDL on the EC MTT Assay of Cell Viability Endothelial cells were counted and seeded into 96-well culture plates at a density of 5 9 103 cells/well. After treatment with ox-LDL (0, 25, 50, 75, 100, 150 lg/mL diluted in PBS) for 24 h, cells were washed twice with PBS and incubated with MTT (5 mg/mL in PBS) for 4 h. Then the media was removed and the water-insoluble formazan crystals that formed in the living cells were dissolved in 150 lL DMSO. Absorbance was recorded at 490 nm using a Thermo Scientific Multiskan MK3 Microplate Reader (Thermo Fisher, USA). The viability of EC in each well was noted as a percentage of the EC group not treated with ox-LDL. Six independent replicates were performed for each group. Flow Cytometry Analysis of ox-LDL-Stimulated Apoptosis Endothelial cells were cultured in 6-well plates and exposed to ox-LDL (0, 50, 100, 150 lg/mL) for 24 h. Cells were harvested, washed with PBS and stained with the annexin V-FITC Apoptosis Detection Kit (KeyGEN, Nanjing, China). The cells were incubated in the dark at 4 °C for 10–15 min and the number of cells undergoing apoptosis was determined by a BD FACSCalibur TM flow cytometry system (Becton–Dickinson, USA). Cytotoxicity of SA on the EC Endothelial cells were stimulated with different concentrations (0, 5, 10, 20, 50, 200, and 500 lmol/L) of SA

After incubation, the cells were washed twice with PBS and the total mRNA was extracted by Trizol reagent. RNA samples were dissolved in RNase-free water and their concentration and purity were determined spectrophotometrically. RNA was reverse-transcribed with a PrimerScriptTM RT-PCR kit according to the manufacturer’s protocol. The mRNA levels for specific genes were determined by real-time PCR using SYBR Premix Ex TaqTM. PCR products were quantified by the ABI 7900HT RealTime PCR system. The expressions of ICAM-1 and E-selectin genes were determined using SYBR Premix Ex TaqTM (TaKaRa Code: DRR041A) in the ABI 7900HT Real-Time PCR system. The real time PCR was performed as following program: 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s and 60 °C for 1 min. GAPDH gene was used as an internal control each sample performed in duplicate. The primer sequences for each gene were stated in Table 1. SOD, GPX Activities Analysis, and MDA Measurement The activities of SOD and GPX, and the content of intracellular MDA were determined in each experimental group, including the control group without the stimulation of ox-LDL and SA, ox-LDL (50 lg/mL) group, ox-LDL (50 lg/mL) ? LLL (0.01 mmol/L), ox-LDL (50 lg/ mL) ? OOO (0.01 mmol/L), and ox-LDL (50 lg/ mL) ? SSS (0.01 mmol/L), according to the manufacturer’s instructions. For the SOD assay, after being incubated in the 6-well plates, cells were stimulated by ox-LDL, ox-LDL and LLL, ox-LDL and OOO, or ox-LDL and SSS for 24 h. Then the

123

498

Lipids (2014) 49:495–504

Table 1 The PCR primers sequences of GAPDH, ICAM-1, and E-selectin Genes

Sequences

GAPDH Forward

CCACCCATGGCAAATTCCATGGCA

Reverse

TCTAGACGGCAGGTCAGGTCCACC

ICAM-1 Forward

AGCGGCTGACGTGTGCAGTA

Reverse

ATCACGTTGGGCGCCGGAAA

E-selectin Forward Reverse

GCTTCTGGCAGTTTCCGTTATGG TGGTGGACAGCATCGCATCTC

SOD levels in EC were measured by the xanthine/xanthine oxidase mediated cytochrome c reduction assay [33]. The total levels of MDA, the lipid peroxidation product in the lysates, were measured by the thiobarbituric acid-reactive substance (TBARS) assay [34]. The GPX activity assay was conducted by quantifying the rate of oxidation of the reduced glutathione (GSH) to the oxidized glutathione by H2O2, which is catalyzed by GPX [35]. Statistical Analysis All tests were carried out in triplicate. Data are presented as means ± SEM. ANOVA was used to compare sets of data. When a post hoc test was warranted (p \ 0.05), a Tukey’s procedure was used for the post hoc test. Significance was established at a level of *p \ 0.05, **p \ 0.01, ***p \ 0.001. All statistical analyses were carried out using SPSS 13.0 software for Windows.

Fig. 1 Effect of ox-LDL on cell viability. EC were exposed to the concentrations of ox-LDL (0, 25, 50, 75, 100, 150 lg protein/mL) shown for a period of 24 h. Cell viability was evaluated by MTT assay. Data (mean ± SEM, from 6 independent experiments) are relative to 0 lg protein/mL ox-LDL-treated control which is set as 1.0. Statistical analysis was carried out using ANOVA. *p \ 0.05, **p \ 0.01, ***p \ 0.001 when compared to the 0 lg protein/mL ox-LDL-treated control

cell death that results from acute cellular injury. Apoptosis differentiates itself from necrosis as the processes associated with apoptosis in disposal of cellular debris do not damage the organism in apoptosis [36, 37]. Incubation of EC with ox-LDL for 24 h resulted in a concentration-dependent increase in apoptotic cell (Fig. 2). Incubation of EC with 100 and 150 lg/mL of ox-LDL for 24 h significantly increased both the number of apoptosis and necrotic cells. EC treated with 50 lg/mL of ox-LDL for 24 h significantly increased the percentage of apoptotic cell, but had little effect on the number of necrotic cells (Figs. 1, 2). Therefore, 50 lg/mL of ox-LDL was used to induce apoptosis with limited levels of necrosis.

Results Cytotoxicity of SA on the EC Effects of ox-LDL on the EC Treatment with ox-LDL for 24 h significantly decreased the cell viability in a concentration-dependent fashion (Fig. 1). At ox-LDL concentrations [50 lmol/L, cell survival rates decreased to \50 %. Apoptosis was detected by Annexin V-FITC stain and distinguished from necrosis by PI staining. With cells gated in four quadrants, cells in the lower right (LR) and upper right (UR) were respectively considered to be early apoptotic (annexin?/PI-) and late apoptotic (annexin?/PI?), whereas the cells in the lower left and upper left quadrants were considered to be living and necrotic cells, respectively. The extent of apoptosis was expressed as the total of the percentages in the quadrants. Apoptosis is programmed cell death occurring in multicellular organisms. Necrosis is a form of traumatic

123

When the concentrations were above 100 lmol/L, TAG showed a strong inhibitory effect on the viability of EC (p \ 0.05). Therefore, since TAG concentrations of no more than 100 lmol/L should be used for further experiments, concentrations of 10 lmol/L TAG were selected for subsequent experiments. Effects of SA or FFA on the EC Injured by ox-LDL Cell viability and apoptosis were used in the present study to evaluate whether TAG protected EC from injuring induced by ox-LDL. Pretreatment of EC with 50 lg/mL ox-LDL for 24 h significantly decreased the cell viability (p \ 0.05; Fig. 3). Compared with the ox-LDL treatment (50 lg/mL) group, treatment with LLL and OOO significantly increased

Lipids (2014) 49:495–504

499

Fig. 2 Effects of ox-LDL on apoptosis in EC. EC were exposed to ox-LDL (0, 50, 100, 150 lg/mL) for 24 h. Quantitative measurement of apoptosis and necrosis by flow cytometry after AV/PI double staining. a EC were exposed to ox-LDL (0 lg/mL) for 24 h. b EC were exposed to ox-LDL (50 lg/mL) for 24 h. c EC were exposed to

ox-LDL (100 lg/mL) for 24 h. d EC were exposed to ox-LDL (150 lg/mL) for 24 h. e Data were expressed as mean ± SEM from three independent experiments. Statistical analysis was carried out using ANOVA. *p \ 0.05, **p \ 0.01 when compared to the 0 lg protein/mL ox-LDL-treated control

the cell viability of ox-LDL-stimulated EC, indicating that both LLL and OOO have anti-cytotoxic activity. In contrast, SSS significantly decreased cell survival. Compared with the ox-LDL treatment (50 lg/mL) group, FFA treatment at both 10 and 30 lg/mL had no effects on the cell survival. According to the results obtained above, FFA was evaluated in subsequent experiments. Treatment with ox-LDL at 50 lg/mL for 24 h significantly increased apoptosis, but when simultaneously treated with LLL or OOO, apoptosis was reduced. SSS showed an adverse effect (Fig. 4). The apoptotic cells were increased in SSS ? ox-LDL treatment group, compared with ox-LDL group.

Effects of SA on the mRNA Expression in ox-LDLInduced EC The addition of ox-LDL increased the expression of ICAM-1 and E-selectin mRNA in EC. When compared with the ox-LDL group, cells simultaneously treated with LLL or OOO had reduced relative expression of ICAM-1 in EC from 4 ± 0.02 to 2 ± 0.002 and 1.6 ± 0.01. However, SSS treatment increased the relative expression of ICAM-1 to 10 ± 0.01. Cells treated with either LLL or OOO had reduced relative expression of E-selectin in EC from 1.20 ± 0.03 to 1.0 ± 0.01 and 0.8 ± 0.1, respectively, while SSS treatment had an inverse effect on the

123

500

Fig. 3 Effect of SA or FFA on ox-LDL-induced alteration of cell viability. EC were treated with ox-LDL (50 lg/mL) and concentration (10 lmol/L) of TAG (SSS, OOO, and LLL) or concentration (10 or 30 lmol/L) of FA (LNA, OLA, and STA). 24 h later, cell viability was evaluated by MTT assay. Results were shown as mean ± SEM from 6 independent experiments. Statistical analysis was carried out using Student’s t test. *p \ 0.05, **p \ 0.01 when compared to the ox-LDL-treated control. G indicates simple acylglycerol. LNA indicates the concentration of LNA is 10 lg/mL, 3LNA indicates the concentration of LNA is 30 lg/mL. OLA indicates the concentration of OLA is 10 lg/mL, 3OLA indicates the concentration of OLA is 30 lg/mL. STA indicates the concentration of STA is 10 lg/ mL, 3STA indicates the concentration of STA is 30 lg/mL

relative expression of E-selectin, from 1.2 ± 0.03 to 1.4 ± 0.01 (Fig. 5). SOD and GPX Activities, Measurement of MDA Content When EC were stimulated by ox-LDL, the activities of SOD and GPX were decreased respectively from 130 ± 16 U/mg protein to 75 ± 3 U/mg protein and from 160 ± 4 U/mg protein to 93 ± 4 U/mg protein. However, compared to cells treated with ox-LDL and LLL, LLL supplementation increased the SOD and GPX activities. Similar results were found in cells treated with ox-LDL and OOO. In contrast, the ox-LDL ? SSS group showed lowered SOD and GPX activities than the ox-LDL group (Tables 1, 2). LLL and OOO supplementation attenuated MDA levels observed in ox-LDL-treated cells, but addition of SSS increased the content of MDA from 58 ± 3 nmol/mg protein in ox-LDL and SSS simultaneous group vs. 46 ± 7 nmol/mg protein in ox-LDL group).

Discussion The role of ox-LDL in atherogenesis has been documented [38]. Endothelial dysfunction or activation elicited by

123

Lipids (2014) 49:495–504

ox-LDL is assumed to be the key step in the initiation of atherosclerosis [39]. It has been reported that ox-LDL induces apoptosis of various cultured cells including lymphocytes, macrophages, smooth muscle cells and fibroblasts [40–42]. Consequently, ox-LDL was used in the atherosclerosis model. The present study implicated the role of ox-LDL in the pathogenesis of atherosclerosis, which was characterized by cell apoptosis and the increasing expression of adhesion molecules. According to the ‘‘response to injury’’ hypothesis, the first stage in the atherosclerotic process results in dysfunction of the vascular endothelium. This dysfunction promotes leukocyte adhesion to vascular endothelium. Leukocyte adhesion to the endothelium is promoted by the appearance of adhesion molecules at the surface of neutrophils, monocytes, and endothelial cells [43]. This phenomenon is reversible at this stage, as the inhibition of adhesion molecule expression prevents the endothelial dysfunction and halts the development of atherosclerotic lesions [44]. Consequence, the expression of adhesion molecules in endothelial cells is used to judge whether SA have the potential to trigger or prevent the initial development of atherogenesis. The antioxidant defense systems were studied because the development and progression of atherosclerosis is associated with oxidative stress. The role of the antioxidant defense system (ADS), including SOD, CAT and GPX, constitutes a major cell protection against acute oxygen and xenobiotic toxicity [45, 46]. The present results confirmed that when EC were exposed to ox-LDL, MDA contents were increased, the GPX and SOD activity were decreased. The addition of LLL or OOO significantly elevated activities of SOD and GPX and decreased e MDA contents, indicating that LLL and OOO prevented ox-LDL-induced EC injury by strengthening antioxidant defense mechanism. Antioxidant defense enzymes GPX and SOD are inducible enzymes. They can be induced by a slight oxidative stress due to compensatory responses. However, a severe oxidative stress suppresses the activities of these enzymes due to oxidative damage and a loss in compensatory mechanisms [43]. Consequently, the addition of oxLDL may precipitate the decrease of SOD and GPX. In the SSS ? ox-LDL treated cells, the activities of SOD and GPX were further decreased, similar to some previously published reports [44, 45]. Atherosclerosis, which has been related to oxidative stress, may be promoted by a high intake of saturated fatty acids [45]. Furthermore, it has also been reported that the occurrence of atherosclerosis may be attenuated by upregulation of antioxidant enzymes [46]. On the other hand, lipid peroxidation, an important process contributing to membrane cell damage, has been suggested as being associated with the initiation and

Lipids (2014) 49:495–504

501

Fig. 4 Effects of SA on ox-LDL-induced apoptosis of EC. EC were exposed to ox-LDL (50 lg/mL) and SA (10 lmol/L) for 24 h. Quantitative measurement of apoptosis and necrosis by flow cytometry after AV/PI double stain. a The control group. b EC were exposed to ox-LDL (50 lg/mL) for 24 h. c EC were induced by oxLDL (50 lg/mL) ? LLL (10 lmol/L) for 24 h. d EC were induced

by ox-LDL (50 lg/mL) ? OOO (10 lmol/L) for 24 h. e EC were induced by ox-LDL (50 lg/mL) ? SSS (10 lmol/L) for 24 h. f Data are expressed as means ± SEM from three independent experiments. Statistical analysis was carried out using Student’s t test. *p \ 0.05, **p \ 0.01 when compared to the ox-LDL-treated control

progression of atherosclerosis [38]. Antioxidants and antioxidative enzymes protect cells and tissues from oxidative injury [47]. Among lipid peroxidation products, MDA serves as a key factor in determining the damage to cells. The present study showed that a decreased level of MDA was detected. This result could be explained by the fact that in our experiment, cell culture media were discarded, and then the MDA concentration in the cell was determined. PUFA existing in simple acylglycerol were oxidized by oxLDL, which contributed to the relatively low contents of ox-LDL to react with PUFA, existed in the cell constituents. Consequently, reduced intracellular MDA was generated in the presence of LLL or OOO. Long-chain fatty acids, such as OLA, LNA, and STA, are first hydrolyzed in the intestine in the process of digestion and absorption. Hydrolyzed fatty acids are absorbed, subjected to re-esterification, and then incorporated into chylomicron in the enterocytes as TAG [48]. The

main component of lipids in chylomicrons and VLDL particles are TAG and cholesterol, and excessive TAG or cholesterol, precipitated in the arterial wall, increases the risk of cardiovascular disease [49]. In our investigation, to discern between triacylglycerol structures versus FFA effects, 10 lg/mL FFA and TAG groups were compared (Fig. 3). Since the simple acylglycerols are triacylglycerols derived from three homogenous fatty acids, the effect of a threefold higher molar concentration of the given FFA was compared to the simple triacylglycerol. Compared with the ox-LDL treatment group, FFA at both 10 and 30 lg/mL had no effects on cell survival. On the other hand, the addition of 10 lg/mL TAG had a significant effect on cell viability. These results demonstrate that the triacylglycerol structure is much more important when compared with the equivalent concentration of homologous fatty acids. Listenberger [50] reported that triacylglycerols accumulation protects against lipotoxicity, while saturated fatty acids

123

502

Lipids (2014) 49:495–504

Fig. 5 Modulation effects of SA on ox-LDL-induced ICAM-1 and E-selectin mRNA expression. The EC were treated with ox-LDL (50 lg/mL) and SA (10 lmol/L) for 24 h. Expression of ICAM-1 and E-selectin mRNA was analyzed by RT-PCR. The values

(means ± SEM from three independent experiments) indicate the ratio of ICAM-1 and E-selectin mRNA expression to GAPDH mRNA expression. Statistical analysis was carried out using Student’s t test. *p \ 0.05, **p \ 0.01 when compared to the ox-LDL-treated control

Table 2 Enzyme activities of superoxide dismutase (SOD), glutathione peroxidase (GPX), and the content of MDA in EC Group

SOD (U/mg
protein)

GPX (U/mg
protein)

MDA (nmol/mg
protein)

Control

129.76 ± 15.36e

160.13 ± 3.90e

23.08 ± 4.02a

93.07 ± 3.78

b

45.70 ± 6.33c

99.64 ± 4.98

c

36.57 ± 6.25b

109.48 ± 5.23

d

30.63 ± 4.39b

77.81 ± 6.92a

58.34 ± 1.94d

ox-LDL ox-LDL ?LLL ox-LDL ? OOO ox-LDL ? SSS

75.16 ± 3.45

b

96.84 ± 8.62

c

112.51 ± 5.22

d

56.89 ± 8.56a

All data are means ± SEM, n = 8. The group without the stimulation of ox-LDL and simple acylglycerol was set as the control group. Within a column, values with the same superscript letter are not significantly different from each other

such as palmitic acid are poorly incorporated into triacylglycerol and cause cell apoptosis. Consequently, it appears to be more important to utilize TAG in dietary fats to evaluate the effect of lipids in AS. Results evaluating monounsaturated fatty acid and polyunsaturated fatty acid on LDL oxidation have been conflicting [51]. Several studies have shown that diets rich in MUFA using with either olive oil or rapeseed oil as the principal source of fat lead to the production of LDL that are more resistant to oxidation than those found in individuals consuming a diet rich in n-6 PUFA [52–54]. Others have observed that a reduction in inflammatory parameters (leukotriene B4 and thromboxane B2) is associated with higher degrees of unsaturation [55]. Our observations demonstrated that the anti-inflammatory effect of OOO was greater than LLL. One potential explanation is that a high intake of dietary n-6 polyunsaturated fatty acid, including LNA, contributes to excess chronic inflammation, primarily by prompting the synthesis of proinflammatory eicosanoids derived from arachidonic acid and/or inhibiting the synthesis of antiinflammatory eicosanoids from eicosapentaenoic and/or docosahexaenoic acids [56]. There might be an additional

123

explanation. The methylene group in LNA molecular structure is activated because of its being situated between the two double bonds, thus LLL is vulnerable to ox-LDL. The oxidation products are potentially toxic. SSS, OOO, and LLL are widespread around the natural world and dietary compositions, such as olive oil (about 70 % oleic acid), sunflower oil (about 60 % linoleic acid), and lard oil (more than 10 % stearic acid). Although only investigations of simple acylglycerols with regard to the function of endothelial cells injured by oxidized LDL were carried out in this study, more complicated TAG will be investigated in our further studies.

Conclusion Ox-LDL was used to establish the AS model in vitro. This study has demonstrated that ox-LDL-stimulation not only induces EC death and apoptosis, but also leads to a high impairment in the antioxidant defense system. The extent of attenuation of adhesion molecules expression appears to be dependent on the type and

Lipids (2014) 49:495–504

concentration of fatty acids in TAG. Both LLL and OOO have been implicated in the prevention and regression of atherogenesis, and the efficacy of OOO was better than LLL in in-vitro models of AS. Further, the improvement of antioxidant defense system was involved in the mechanism, shown by the inhibitory effects of LLL and OOO on ox-LDL-induced MDA overproduction, GPX and SOD reduction. Therefore, we suggest that oxidative damage caused by ox-LDL in EC may be attenuated by dietary enrichment with LLL or OOO due in part to an enhancement of antioxidant defense. Clearly, treatment of cells with triacylglycerols vs. fatty acids can produce surprisingly different results. Triolein and LLL ameliorate ox-LDL-induced oxidative stress in endothelial cells mainly through an improvement in the antioxidant defense system. Acknowledgments We are grateful to the National Natural Science Foundation of China (No. 31060214), the Natural Science Foundation of Jiangxi Province (No. 2009GZY0148), and the Research Program of State Key Laboratory of Food Science and Technology, Nanchang University (SKLF-QN-201109) for financial support. We thank Dr. Neil Shay from Oregon State University and Dr. Yahua Chen from National University of Singapore for assistance with helpful scientific discussion and editing. Conflict of interest interest.

503

10.

11.

12. 13.

14.

15. 16. 17.

18.

The authors have declared no conflicts of 19.

References 20. 1. Vanepps JS, Vorp DA (2007) Mechano-pathobiology of atherogenesis: a review. J Surg Res 142:202–217 2. Ross R (1986) The pathogenesis of atherosclerosis–an update. N Engl J Med 314:488–500 3. Ross R (1993) The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature 362:801 4. Davies MJ, Woolf N, Rowles PM et al (1988) Morphology of the endothelium over atherosclerotic plaques in human coronary arteries. Br Heart J 60:459 5. Jialal I, Grundy SM (1993) Effect of combined supplementation with C-tocopherol, ascorbate, and beta carotene on low-density lipoprotein oxidation. Circulation 88:2780–2786 6. Boushehri SN, Yusof RM, Nasir M et al (2012) Effect of vitamin supplementation on serum oxidized low-density lipoprotein levels in male subjects with cardiovascular disease risk factors. Iran J Basic Med Sci 15(4):958–964 7. Mosca L, Rubenfire M, Mandel C et al (1997) Antioxidant nutrient supplementation reduces the susceptibility of low density lipoprotein to oxidation in patients with coronary artery disease. JACC 30:392–399 8. Harada-Shiba M, Kinoshita M, Kamido H, Shimokado K (1998) Oxidized low density lipoprotein induces apoptosis in cultured human umbilical vein endothelial cells by common and unique mechanisms. J Biol Chem 273:9681–9687 9. Manka DR, Wiegman P, Din S, Sanders JM, Green SA, Gimple LW, Ragosta M, Powers ER, Ley K, Sarembock IJ (1999) Arterial injury increases expression of inflammatory adhesion

21.

22.

23. 24.

25.

26.

27.

28.

molecules in the carotid arteries of apolipoprotein-E-deficient mice. J Vasc Res 36:372–378 O’Brien KD, Allen MD, McDonald TO, Chait A, Harlan JM, Fishbein D, McCarty J, Ferguson M, Hudkins K, Benjamin CD (1993) Vascular cell adhesion molecule-1 is expressed in human coronary atherosclerotic plaques. Implications for the mode of progression of advanced coronary atherosclerosis. J Clin Invest 92:945–951 Allen S, Khan S, Al-Mohanna F, Batten P, Yacoub M (1998) Native low density lipoprotein-induced calcium transients trigger VCAM-1 and E-selectin expression in cultured human vascular endothelial cells. J Clin Invest 101:1064–1075 Huo Y, Ley K (2001) Adhesion molecules and atherogenesis. Acta Physiol Scand 173:35–43 Clarke SD (2004) The multi-dimensional regulation of gene expression by fatty acids: polyunsaturated fats as nutrient sensors. Curr Opin Lipidol 15:13–18 Martin M, Wanda VC, Lisa CH, Jan LB (2001) Compared with saturated fatty acids, dietary monounsaturated fatty acids and carbohydrates increase atherosclerosis and VLDL cholesterol levels in LDL receptor-deficient, but not apolipoprotein E-deficient, mice. Proc Natl Acad Sci USA 98:13294–13299 Calder Philip C (2006) Polyunsaturated fatty acids and inflammation. Prostaglandins Leukot Essent Fatty Acids 75:197–202 De Caterina R, Zampolli A (2001) n-3 fatty acids: antiatherosclerotic effects. Lipids 36:S69–S78 Sudheendran S, Chang CC, Deckelbaum RJ (2010) N-3 vs. saturated fatty acids: effects on the arterial wall. Prostaglandins Leukot Essent Fatty Acids 82:205–209 Mensink RP, Zock PL, Kester AD, Katan MB (2003) Effects of dietary fatty acids and carbohydrates on the ratio of serum total to HDL cholesterol and on serum lipids and apolipoproteins: a metaanalysis of 60 controlled trials. Am J Clin Nutr 77:1146–1155 Oh K, Hu FB, Manson JE, Stampfer MJ, Willett WC (2005) Dietary fat intake and risk of coronary heart disease in women: 20 years of follow-up of the nurses’ health study. Am J Epidemiol 161:672–679 Fessler MB, Rudel LL, Brown M (2011) Toll-like receptor signaling links dietary fatty acids to the metabolic syndrome. Curr Opin Lipidol 20(5):379–385 Ajuwon KM, Spurlock ME (2005) Palmitate activates the NF-jB transcription factor and induces IL-6 and TNFa expression in 3T3-L1 adipocytes. J Nutr 135:1841–1846 Hunter KA, Crosbie LC, Weir A, Miller GJ, Dutta-Roy AK (1999) The effects of structurally defined triglycerides of differing fatty acid composition on postprandial haemostasis in young, healthy men. Atherosclerosis 142:151–158 Khosla P, Sundram K (1996) Effects of dietary fatty acid composition on plasma cholesterol. Prog Lipid Res 35:93–132 Mattson FH, Grundy SM (1985) Comparison of the effects of dietary saturated, monounsaturated and polyunsaturated fatty acids on plasma lipids and lipoproteins in man. J Lipid Res 26:194–202 Bronte-Stewart B, Keys A, Brock JF, Moodie AD, Keys MH, Anronis A (1955) Serum cholesterol, diet and coronary heart disease: an inter-racial survey in the Cape Peninsula. Lancet 2:1103–1108 Pankow JS, Duncan BB, Schmidt MI et al (2004) Fasting plasma free fatty acids and risk of type 2 diabetes. Diabetes Care 27:77–82 Schauer IE, Reusch JE (2005) Free fatty acids and vascular smooth muscle cells: implications for atherosclerosis. Arterioscler Thromb Vasc Biol 25:1079–5642 Karupaiah T, Sundram K (2007) Effects of stereospecific positioning of fatty acids in triacylglycerol structures in native and

123

504

29. 30.

31.

32.

33.

34.

35.

36. 37. 38.

39.

40.

41.

42.

43.

Lipids (2014) 49:495–504 randomized fats: a review of their nutritional implications. Nutr Metab (Lond) 4:16 Thomas A (2002) Fats and fatty oils. Ullmann’s Encyclopedia of Industrial Chemistry. Wiley-VCH, Weinheim Ou HC, Lee WJ et al (2010) Ellagic acid protects endothelial cells from oxidized low-density lipoprotein-induced apoptosis by modulating the PI3 K/Akt/eNOS pathway. Toxicol Appl Pharm 248:134–143 Xi S, Chen LH (2000) Effects of dietary fish oil on tissue glutathione and antioxidant defense enzymes in mice with murine aids. Nutr Res 20:1287–1299 Shela G, Olga MB (2003) Comparison of the contents of the main biochemical compounds and the antioxidant activity of some Spanish olive oils as determined by four different radical scavenging tests. J Nutr Biochem 14(3):153–159 Yang S, Zhu H, Li Y, Lin H, Gabrielson G, Trush MA, Diehl AM (2000) Mitochondrial adaptations to obesity-related oxidant stress. Arch Biochem Biophys 378:259–268 Wang B, Peng L, Zhu L, Ren P (2007) Protective effect of total flavonoids from Spirodela polyrrhiza (L.) Schleid on human umbilical vein endothelial cell damage induced by hydrogen peroxide. Colloids Surf B Biointerfaces 60:36–40 Diehl AM, Chacon MA, Wagner P (1988) The effect of chronic ethanol feeding on ornithine decarboxylase activity and liver regeneration. Hepatology 8:237–242 Peter Marcus E (2011) Programmed cell death: apoptosis meets necrosis. Nature 471:310–312 Zhivotovsky Boris (2004) Apoptosis, necrosis and between. Cell Cycle 3:64–66 Steinberg D, Parthasarathy S, Carew TE, Khoo JC, Witztum JL (1989) Beyond cholesterol. Modifications of low-density lipoprotein that increase its atherogenicity. N Engl J Med 320:915–924 Claise C, Edeas M, Chaouchi N, Chalas J, Capel L, Kalimouttou S, Vazquez A, Lindenbaum A (1999) Oxidized-LDL induce apoptosis in HUVEC but not in the endothelial cell line EA.hy 926. Atherosclerosis 147:95–104 Bjorkerud B, Bjorkerud S (1996) Contrary effects of lightly and strongly oxidized LDL with potent promotion of growth versus apoptosis on arterial smooth muscle cells, macrophages, and fibroblasts. Arterioscler Thromb Vasc Biol 16:416–424 Escargueil I, Negre-Salvayre A, Pieraggi MT, Salvayre R (1992) Oxidized low density lipoproteins elicit DNA fragmentation of cultured lymphoblastoid cells. FEBS Lett 305:155–159 Escargueil-Blanc I, Meilhac O, Pieraggi MT, Arnal JF, Salvayre R, Negre-Salvayre A (1997) Oxidized LDLs induce massive apoptosis of cultured human endothelial cells through a calciumdependent pathway. Prevention by aurin tricarboxylic acid. Arterioscler Thromb Vasc Biol 17:331–339 Bittencourt HD, Curi R (2001) Antiproliferative prostaglandins and the MRP/GS-X pump role in cancer immunosuppression and

123

44.

45.

46.

47. 48.

49.

50.

51.

52.

53.

54.

55.

56.

insight into new strategies in cancer gene therapy. Biochem Pharmacol 62:811–819 Gorjao R, Azevedo-Martins AK, Rodrigues HG, Abdulkader F, Arcisio-Miranda M, Procopio J, Curi R (2009) Comparative effects of DHA and EPA on cell function. Pharmacol Ther 122:56–64 Peter OK (1997) The effect of dietary fat, antioxidants, and prooxidants on blood lipids, lipoproteins, and atherosclerosis. J Am Diet Assoc 97:31–41 Ramona LB (2010) Dietary rice protein isolate attenuates atherosclerosis in apoE-deficient mice by upregulating antioxidant enzymes. Atherosclerosis 212:107–115 Halliwell B (2000) The antioxidant paradox. Lancet 355:1179–1180 Lei L, Li J, Li GY, Hu JN, Tang L, Liu R, Fan YW, Deng ZY (2012) Stereospecific analysis of triacylglycerol and phospholipid fractions of five wild freshwater fish from Poyang Lake. J Agric Food Chem 60:1857–1864 Harchaoui KEL, Visser ME, Kastelein JJP, Stroes ES, DallingaThie GM (2009) Triglycerides and cardiovascular risk. Curr Cardiol Rev 5(3):216–222 Listenberger LL, Han X, Lewis SE, Cases S, Farese RV Jr, Ory DS, Schaffer JE (2003) Triglyceride accumulation protects against fatty acid-induced lipotoxicity. Proc Natl Acad Sci USA 100:3077–3082 Kratz M, Cullen P, Wahrburg U (2002) The impact of dietary mono- and poly- unsaturated fatty acids on risk factors for atherosclerosis in humans. Eur J Lipid Sci Technol 104:300–311 Berry EM, Eisenberg S, Haratz D, Friedlander Y, Norman Y, Kaufmann NA, Stein Y (1991) Effects of diets rich in monounsaturated fatty acids on plasma lipoproteins: the Jerusalem Nutrition Study: high MUFAs vs high PUFAs. Am J Clin Nutr 53:899–907 Reaven P, Parthasarathy S, Grasse BJ, Miller E, Almazan F, Mattson FH, Khoo JC, Steinberg D, Witztum JL (1991) Feasibility of using an oleate-rich diet to reduce the susceptibility of low-density lipoprotein to oxidative modification in humans. Am J Clin Nutr 54:701–706 Reaven P, Parthasarathy S, Grasse BJ, Miller E, Steinberg D, Witztum JL (1993) Effects of oleate rich and linoleate rich diets on the susceptibility of low density lipoprotein to oxidative modification in mildly hypercholesterolemic subjects. J Clin Invest 91:668–676 Bogani P, Galli C, Villa M, Visioli F (2007) Postprandial antiinflammatory and antioxidant effects of extra virgin olive oil. Atherosclerosis 190:181–186 Johnson GH, Fritsche K (2012) Effect of dietary linoleic acid on makers of inflammation in healthy persons: a systematic review of randomized controlled trials. J Acad Nutr Diet 112(7):1029–1041