Gastroenterology 2014;147:1043–1054
BASIC AND TRANSLATIONAL—ALIMENTARY TRACT TRIM59 Is Up-regulated in Gastric Tumors, Promoting Ubiquitination and Degradation of p53 Zhicheng Zhou,1,2 Zhongzhong Ji,1 You Wang,1 Jian Li,3 Hui Cao,4 Helen He Zhu,1 and Wei-Qiang Gao1,2 1
State Key Laboratory of Oncogenes and Related Genes, Renji-Med X Clinical Stem Cell Research Center, Ren Ji Hospital, School of Medicine; 2School of Biomedical Engineering and Med-X Research Institute, Shanghai Jiao Tong University, Shanghai; 3Department of General Surgery, First Affiliated Hospital, Nanchang University, Nanchang; and 4Department of General Surgery, Renji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, China
G
astric cancer is the fourth most frequent type of cancer and the second most common cause of death from cancer worldwide.1 Strikingly, gastric cancer cases in China alone account for 42% of cases globally. This incidence increases steadily, likely owing to the dietary habits of, and the high prevalence of Helicobacter pylori infection in, the Chinese population.2 Therefore, the discovery of new diagnostic and prognostic markers and a better understanding of molecular mechanisms for gastric tumorigenesis remain urgent problems. P53, a key tumor suppressor, regulates multiple critical biological processes including apoptosis, cell-cycle arrest, DNA repair, and so forth.3 Genetic and epigenetic alterations causing inactivation of P53 are implicated in approximately 50% of gastric cancer patients.4–6 Notably, gastric cancer tissues from 50% of stomach cancer patients show positive immunostaining for the P53 protein. Nevertheless, it was later shown that the positive staining largely was attributable to mutant P53, whereas the expression of wild-type P53 protein became undetectable/lost in gastric tumors with the wild-type p53 allele.5,6 Re-activation of the P53 pathway is an attractive strategy for pharmaceutical interference in tumor initiation and progression. However, the underlying mechanisms for the P53 down-regulation in gastric cancer patients have not been understood fully to date. The tripartite motif (TRIM) family proteins are evolutionarily conserved proteins that share a common N-terminal really interesting new gene (RING) finger domain followed by 1 or 2 B-boxes and coiled-coil sequences.7 Because of the RING finger domain, many of the TRIM proteins act as E3 ubiquitin ligases.7–9 The importance of TRIM proteins in cancers was first shown by the discovery of the translocation of several TRIM genes to other genes (eg, TRIM19 encoding the pml gene and rara gene fusion, trim24/ braf translocation, and trim24/rets fusion).10–14 In addition, TRIM proteins including TRIM13, TRIM19, TRIM24, and TRIM25 were shown to be involved in leukemia, breast, and
Abbreviations used in this paper: MDM2, murine double minute 2; mRNA, messenger RNA; q-PCR, quantitative polymerase chain reaction; shRNA, short hairpin RNA; TRIM, tripartite motif.
Keywords: Oncogene; Stomach Cancer; Tumor Formation; Progression.
© 2014 by the AGA Institute 0016-5085/$36.00 http://dx.doi.org/10.1053/j.gastro.2014.07.021
BASIC AND TRANSLATIONAL AT
BACKGROUND & AIMS: Little is known about factors that promote gastric carcinogenesis. We analyzed multiple microarray data sets for messenger RNAs (mRNAs) that were increased significantly in human gastric tumor samples, compared with the adjacent normal gastric tissue. We found expression of tripartite motif 59 (TRIM59), which encodes a putative ubiquitin ligase, to be increased, and investigated its effects in gastric cancer cell lines. METHODS: We analyzed microarray data sets from the Oncomine database. We used quantitative polymerase chain reaction and immunoblotting to measure levels of TRIM59 mRNA and protein in 50 human gastric cancer and paired normal tissues, obtained from Renji Hospital and the First Affiliated Hospital of Nanchang University, in China. We also measured protein levels in the gastric epithelial cell line GES-1; the cancer cell lines MKN45, AGS, SGC7901, BGC823, Snu5, N87, and Snu1; and in tissue arrays of 108 human gastric tumors. TRIM59 was knocked down and overexpressed in gastric cancer cell lines, and the effects on proliferation, clone formation, migration, and growth of xenograft tumors in nude mice were assessed. TRIM59-related signaling pathways were examined by immunoblotting and quantitative polymerase chain reaction. We analyzed interactions among TRIM59, P53, and ubiquitin in immunoprecipitation studies. RESULTS: Levels of TRIM59 mRNA and protein were increased significantly in gastric tumors compared with nontumor tissues; increased levels were associated with advanced tumor stage and shorter patient survival times. TRIM59 knockdown reduced proliferation, clone formation, and migration of gastric cancer cell lines, as well as growth of xenograft tumors in nude mice; overexpression of TRIM59 had the opposite effects. TRIM59 interacted physically with P53, increasing its ubiquitination and degradation. Increased levels of TRIM59 in human gastric tumors correlated with reduced expression of P53 target genes. CONCLUSIONS: The putative ubiquitin ligase TRIM59 is up-regulated in human gastric tumors compared with nontumor tissues. Levels of TRIM59 correlate with tumor progression and patient survival times. TRIM59 interacts with P53, promoting its ubiquitination and degradation, and TRIM59 might promote gastric carcinogenesis via this mechanism.
1044 Zhou et al
Gastroenterology Vol. 147, No. 5
prostate cancers through the regulation of transcriptional factors or tumor suppressors, indicating crucial roles of the TRIM family in tumorigenesis.15 We performed searches and a meta-analysis on microarray data sets from the Oncomine database (www. oncomine.com) for possible targets in the TRIM family whose expressions are altered significantly in gastric cancer. Interestingly, TRIM59, with unidentified biological functions, was the top hit found in our searches. We report in this study that TRIM59 is up-regulated in gastric cancer and strongly associated with poor patient outcome. TRIM59 promotes gastric cancer cell proliferation, migration, and xenograft tumor growth. Mechanistically, TRIM59 interacts with the P53 tumor suppressor, and, as a result, facilitates the ubiquitination and degradation of P53. In addition, increased expression of TRIM59 in human gastric tumor samples correlates with down-regulation of P53 target genes.
HEK293T, MKN45, or MGC803 cells were co-transfected with the P53 expression plasmid and the TRIM59-Flag plasmid or the empty vector as described earlier. A total of 10 mg/mL of cycloheximide (purchased from Sigma) was added to the culture medium at 48 hours after the plasmid transfection to 293T cells or at 36 hours to MKN45 cells. Cells were lysed in RIPA buffer containing protease and phosphatase inhibitors as described earlier after cycloheximide treatment at indicated time points. For MG132 treatment, at indicated hours after transfection, cells were incubated with MG132 (10 mmol/L) for an additional 3, 6, or 9 hours. Cells then were collected for immunoblots to determine the P53 protein amount.
Materials and Methods
Cell Lines, Plasmids, Transfection, and Lentivirus Production
Patient Samples
BASIC AND TRANSLATIONAL AT
Fifty fresh samples of human gastric cancer and paired normal tissues were obtained during surgery at the Department of General Surgery from Renji Hospital and the First Affiliated Hospital of Nanchang University. All samples were collected with patients’ informed consent. A total of 178-spot, paraffin-embedded, tissue array chips (HStm-Ade178Sur-01) including 67 paired gastric tumor and normal tissues, 39 tumor tissues, and 5 normal tissues with 7 to 9 years of follow-up information, were purchased from Shanghai Outdo Biotech, Ltd (Shanghai, China).
(Sigma, Saint Louis, MO), anti-P53 (Cell Signaling Technology, Boston, MA), mouse immunoglobulin G (Santa Cruz, Santa Cruz, CA), glyceraldehyde-3-phosphate dehydrogenase (Epitomics, Burlingame, CA), and anti-ubiquitin (Santa Cruz) antibodies.
Protein Half-Life Detection
Detailed descriptions of the cell lines, plasmids, transfection, and lentivirus production are available in the Supplementary Materials and Methods.
Cell Proliferation, Clonogenic, Transwell Migration, and In Vivo Xenograft Assay Detailed descriptions of the cell proliferation, clonogenic, Transwell (Corning, NY) migration, and in vivo xenograft assay are available in the Supplementary Materials and Methods.
Statistical Analysis Immunoblotting, Immunofluorescence, and Immunohistochemistry Detailed descriptions are available in the Supplementary Materials and Methods. Quantitative analysis of the immunostaining images was performed after color segmentation based on the fixed threshold value of hue, saturation, and intensity. Each image was assigned a score calculated by multiplying the staining intensity by the area of positive stained cells. “Upregulation” denoted that the score of the cancer tissue was higher than that of the paired normal tissue, whereas “downregulation” meant that the score of the cancer tissue was lower compared with the matched normal tissue.
Immunoprecipitation and Ubiquitination Assays Cells were washed with ice-cold phosphate-buffered saline and lysed in a lysis buffer (50 mmol/L Tris-HCl, pH 8.0; 150 mmol/L NaCl; 1% NP-40) supplemented with protease and phosphatase inhibitors (Roche, Penzberg, Germany) at 36 hours after transfection. Cell lysates were incubated with primary antibodies overnight at 4 C. TrueBlot anti-Mouse IgG IP Beads (eBioscience, San Diego, CA) then were added and incubated for another 4 hours at 4 C. The immunoprecipitates were washed 4 times with the lysis buffer and boiled for 5 minutes at 98 C in protein loading buffer. Immunoprecipitated proteins were detected by following immunoblots. Antibodies used in the coimmunoprecipitation experiments were as follows: anti-Flag
Statistical evaluation was conducted using the Student t test. Multiple comparisons were analyzed first by 1-way analysis of variance. The log-rank (Mantel–Cox) test was used for patient survival analysis. The Pearson correlation was used to analyze the strength of the association between expression levels of TRIM59 and its related genes in patient samples. A significant difference was defined as P < .05.
Results TRIM59 Is Up-Regulated in Human Gastric Cancer and Correlates With Disease Progression as Well as Shortened Patient Survival To determine the significance of TRIM59 in gastric cancer, we first analyzed multiple microarray data sets in the Oncomine database. As shown in Figure 1A, TRIM59 messenger RNA (mRNA) levels were increased significantly in human tumor samples as compared with the adjacent normal gastric tissue. Importantly, up-regulated TRIM59 was associated strongly with shortened patient survival (Figure 1B). These data indicated a positive correlation of TRIM59 expression with gastric cancer. To verify the microarray analysis results, we performed immunoblot and quantitative polymerase chain reaction (q-PCR) experiments on human gastric adenocarcinoma specimens and their matched normal tissues. Seven of 10
TRIM59 Is a Novel Proto-Oncogene 1045
BASIC AND TRANSLATIONAL AT
November 2014
Figure 1. TRIM59 expression is up-regulated in gastric cancer. (A) Analysis from the Oncomine database shows that mRNA expression levels of TRIM59 are significantly higher in gastric cancers compared with normal tissues. Data were pooled together from 2 published gastric cancer gene expression studies31,32 (P < .001), 46 normal tissues and 50 cancer tissues were analyzed. (B) Analysis of tumor TRIM59 DNA copy number in association with patient survival from the Oncomine database indicates a correlation of high TRIM59 copy number with shortened survival (the Cancer Genome Atlas, Gastric Statistics, P ¼ .0447, n ¼ 14, 28). (C) Immunoblot shows higher protein levels of TRIM59 in 7 of 10 tumor samples compared with the respective matched normal tissues (T, tumor; N, normal tissue). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is used as a loading control. (D) TRIM59 mRNA expression level in 10 paired tumor samples and normal tissues. (E) The mRNA level of TRIM59 in GES-1 and GES-7 gastric cancer cell lines with different differentiation status. Data were normalized against the TRIM59 expression level in GES-1 cells. (F) Immunoblot of TRIM59 confirms high expression level of TRIM59 in poor differentiated gastric cancer cell lines. Data are presented as means ± SEM. *P < .05, **P < .01, ***P < .001. (A and D) A t test was used for the statistical analysis. (B) The log-rank (Mantel–Cox) test was used. (E) One-way analysis of variance was used.
tumor samples showed increased protein levels of TRIM59 compared with their respective paired normal tissues (Figure 1C). In addition, q-PCR experiments showed that 5
tumors expressed significantly higher TRIM59 mRNA levels, whereas 4 tumor specimens showed comparable TRIM59 mRNA levels with normal tissues. Only 1 tumor showed
1046 Zhou et al
BASIC AND TRANSLATIONAL AT
decreased TRIM59 mRNA expression (Figure 1D). Therefore, the high expression of TRIM59 in gastric cancer may not originate solely from transcriptional up-regulation. We further assessed the expression of TRIM59 in multiple gastric cancer cell lines. As shown in Figure 1E and F, high mRNA and protein levels of TRIM59 correlated positively with poor differentiation status in gastric cancer cell lines because the highest expression of TRIM59 was found in the most aggressive cancer cell lines, AGS and Snu1, and the least expression was observed in the immortalized human gastric epithelial cell line GES-1, which is not tumorigenic. To further investigate the correlation of TRIM59 with gastric cancer progress, we performed an immunohistochemical staining for TRIM59 on primary human tumors from a large cohort of gastric cancer patients (n ¼ 111). Among the 111 patients, 67 biopsy specimens contained both tumors and matched normal tissues, whereas 39 biopsy specimens had only tumor tissues, and the other 5 specimens only contained normal tissues. Semiquantitative analysis showed a significantly increased intensity of TRIM59 staining in gastric tumors than normal tissues (Figure 2A and B). Notably, TRIM59 expression was correlated positively with the pathologic grade of gastric cancer (Figure 2C and Supplementary Table 1). A detailed description of the clinical features for the patient samples in this study is provided in Supplementary Table 2. As the disease state progresses, gastric tumor cells infiltrate across the mucous membrane into the muscular layer, serosa layer, and, ultimately, to metastatic sites. As shown in Figure 2D, deeper gastric wall infiltrations were detected more frequently in the tumor samples with up-regulated TRIM59. Moreover, increased expression of TRIM59 was linked significantly to shortened patient survival (P ¼ .045), because the 5-year overall survival rates for patients with high TRIM59 expression and low TRIM59 expression were 15.9% and 30.4%, respectively (Figure 2E).
TRIM59 Promotes Gastric Tumor Growth In Vitro and In Vivo We then examined the biological function of TRIM59 in gastric cancer using a lentivirus-mediated knockdown and overexpression system (Supplementary Figure 1A and B). As shown in Figure 3A, cell proliferation was suppressed significantly by TRIM59 RNA interference in AGS cells, and it was enhanced by ectopic expression of TRIM59 in MKN45 cells (Figure 3A and B). In addition, although TRIM59 knockdown attenuated the soft agar clone-forming capability of AGS cells, TRIM59 overexpression promoted clone formation in MKN45 cells because the number of soft agar clones was increased markedly (Figure 3C and D). We further assessed the impact of TRIM59 on cell migration using the Boyden Transwell chamber assays. As shown in Figure 3E and F, TRIM59–short hairpin RNA (shRNA) transfection hindered AGS cell migration, whereas forced expression of TRIM59 had the opposite effect on MKN45 cells. These data were consistent with our finding that increased TRIM59 is associated with a high degree of human gastric tumor infiltration (Figure 2D).
Gastroenterology Vol. 147, No. 5
To verify the positive role of TRIM59 in gastric tumor progression in vivo, we performed xenograft tumor assays using AGS cells and MKN45 cells stably transfected by TRIM59-shRNA or TRIM59-overexpression lentiviruses, respectively. We found that TRIM59 knockdown significantly inhibited xenograft tumor growth in nude mice (Figure 4A). Immunofluorescent staining of Ki67 showed significantly fewer proliferative cells in TRIM59-shRNA xenograft tumors (Figure 4B and C). On the other hand, lentiviral expression of TRIM59 resulted in accelerated xenograft tumor growth (Figure 4D and E). These data collectively indicate that TRIM59 acted as a novel tumor-promoting molecule and positively regulates gastric tumor growth.
TRIM59 Negatively Regulates the P53 Tumor Suppressor and Represses the Expression of P53 Downstream Molecules To understand the molecular mechanism by which TRIM59 promotes gastric cancer, we tested several signaling transduction pathways that have been shown previously to be critical in gastric tumorigenesis and possibly regulated by TRIM59.16 We discovered that in the AGS gastric cancer cell line, phosphorylation of Ras signaling components p38, p44/p42, and PKC (protein kinase C) were suppressed upon TRIM59 knockdown (Supplementary Figure 2). Because previous reports showed that inactivation of P53 is one of the most common events in gastric cancers,17 we determined the P53 expression level after TRIM59 knockdown, and found that this procedure led to an increase in P53 protein level (Figure 5A). We further examined several P53 downstream molecules and found that 14-3-3s, p21, and p27 were up-regulated in TRIM59shRNA lentivirus-transfected AGS cells (Figure 5A and B). The expression of cyclin D1, a cyclin negatively regulated by p21, was decreased in TRIM59 knockdown AGS cells (Figure 5A). Those data suggest that TRIM59 exerted an inhibitory effect on the P53 signaling pathway. In addition, we observed no change in mRNA levels of p53 in TRIM59shRNA lentivirus-transfected cells, suggesting a posttranscriptional regulation of P53 by TRIM59 (Figure 5B). To determine if TRIM59 affected the P53 transcriptional activity, we co-transfected a luciferase reporter plasmid containing P53-responsive elements with the sh-TRIM59 lentivirus into AGS cells or with the TRIM59 expression plasmid into MKN45 cells. As shown in Figure 5C, TRIM59 knockdown significantly increased the luciferase activity, whereas overexpression of TRIM59 led to attenuated intensity of the P53 luciferase reporter. It should be noted that AGS cells and MKN45 cells do not contain any p53 mutation. We further examined the impact of TRIM59 on mutant P53 in the MGC803 cell line carrying the p53 mutation. As shown in Supplementary Figure 3A and B, overexpression of TRIM59 did not affect the protein amount of endogenous mutant P53. Besides proliferation inhibition, P53 can act as a tumor suppressor, largely through its role in apoptosis induction.18 We observed an increase of cell death after transient TRIM59 knockdown (Supplementary Figure 4). Consistently, we found significantly increased
TRIM59 Is a Novel Proto-Oncogene 1047
BASIC AND TRANSLATIONAL AT
November 2014
Figure 2. Increased expression of TRIM59 correlates with gastric cancer progression and poor survival in patients. (A) Immunohistochemical staining of normal and gastric cancer tissues with anti-TRIM59 antibody. Representative patient samples of clinical stages I, II, and III are shown. A total of 111 patient samples were stained and analyzed. (B) Quantitative analysis of TRIM59 staining shows significantly higher staining intensity in gastric tumor samples compared with normal tissues (72 normal tissues and 108 tumor samples). IOD, integral optical density. (C) Analysis of TRIM59 staining intensity in association with clinical stages of gastric tumor samples (n ¼ 108). (D) Up-regulated TRIM59 expression positively correlated with high degrees of gastric tumor infiltration. When the intensity of TRIM59 immunohistochemistry staining was higher in the tumor tissue than its paired normal tissue, the expression of TRIM59 was defined as “high expression.” When the intensity of TRIM59 IHC staining was lower in the tumor tissue than its paired normal tissue or no change was detected, its expression was defined as “low expression” (n ¼ 23 in the low-expression group, no change of TRIM59 expression levels was found in 3 of the 23 tumor samples; n ¼ 42 in the high-expression group). (E) High intensity of TRIM59 immunostaining strongly associates with poor patient survival (n ¼ 44 in the TRIM59 high-expression group, n ¼ 23 in the TRIM59 low-expression group). Data are presented as means ± SEM. *P < .05. (B and C) A t test was used for the statistical analysis. (E) The log-rank (Mantel–Cox) test was used.
1048 Zhou et al
Gastroenterology Vol. 147, No. 5
BASIC AND TRANSLATIONAL AT
Figure 3. TRIM59 promotes gastric cancer cell proliferation, clone formation, and migration. (A) TRIM59 knockdown reduces the proliferation rate of AGS cells. The first shTRIM59 sequence was ACATTACAGGCAACCATTAAA and the second shTRIM59 sequence was TTGCACTAAGGGCTATTATTG (means ± SD; n ¼ 8; blank, nontreated cells). (B) Overexpression of TRIM59 accelerantes the proliferation of MKN45 cells (means ± SD; n ¼ 8). (C) TRIM59 knockdown inhibits the capability of clone formation in soft agar of AGS cell. The first sh-TRIM59 sequence was used in this experiment (means ± SEM; n ¼ 4). (D) Overexpression of TRIM59 promotes MKN45 cell clone formation in soft agar (means ± SEM; n ¼ 3). (E and F) TRIM59 knockdown inhibits AGS cell migration, whereas TRIM59 overexpression exerts the opposite effect (means ± SEM; n ¼ 5). *P < .05; ***P < .001. One-way analysis of variance was used for the statistical analysis.
expression of P53 and more apoptotic cancer cells distinguished by the positive cleaved caspase-3 staining in shTRIM59 xenograft tumors (Figure 5D and E).
TRIM59 Interacts With P53 and Enhances Ubiquitination and Degradation of P53 To further substantiate the negative role of TRIM59 in the regulation of P53, we investigated the impact of ectopic
TRIM59 expression in 293T cells on P53. In line with our hypothesis, protein levels of P53 reduced proportionally with progressively increasing amounts of TRIM59, suggesting that TRIM59 negatively regulates P53 abundance in a dose-dependent way (Figure 6A and B, left). Furthermore, as shown in Figure 6B (right), overexpression of TRIM59 resulted in a decreased endogenous P53 protein level in the gastric cancer cell line MKN45. The RING domain was proven to be essential for the protein degradation function
TRIM59 Is a Novel Proto-Oncogene 1049
Figure 4. TRIM59 enhances the tumorigenicity of gastric cancer cells in vivo. (A) TRIM59 gene silencing by shRNA resulted in suppressed tumorigenicity of AGS cells in vivo. Only 4 of 10 mice inoculated with TRIM59-shRNA lentivirus-infected AGS cells form a tumor. The first sh-TRIM59 sequence was used in this experiment. (B) Reduced tumor volumes and weights of xenografts generated by AGS cells transfected with TRIM59-shRNA (n ¼ 10; blank, nontreated AGS cells). (C) Xenograft tumors from TRIM59-shRNA AGS cells contain significantly less Ki67-positive proliferative cells (n ¼ 10, 5 fields were random picked, examined under a fluorescent microscope, captured and counted per xenograft sample). (D) Enhanced tumorigenicity of MKN45 cells in vivo by TRIM59 overexpression. (E) Increased tumor volumes and weights of xenografts generated by MKN45 cells stably expressing TRIM59 (n ¼ 10) (means ± SEM). *P < .05, ***P < .001. One-way analysis of variance was used for the statistical analysis.
of multiple TRIM family proteins. We constructed truncated TRIM59-expressing plasmid without the RING domain. As shown in Supplementary Figure 5, unlike the full-length TRIM59, ectopic expression of the DRING truncated form of TRIM59 did not affect the P53 protein amount, suggesting that the RING domain is required for the regulatory role of TRIM59 on P53. As shown in Figure 6C (left panel), the halflife of P53 protein was shortened significantly in 293T cells transfected with TRIM59, indicating that TRIM59 negatively affected P53 stability. Consistently, ectopic expression of TRIM59 significantly reduced the half-life of endogenous P53 in the gastric cancer cell line MKN45 (Figure 6C, right). In addition, we observed that treatment with MG132, a proteasome inhibitor, led to a significant increase of the P53 protein half-life, supporting the notion that TRIM59 regulates P53 stability by proteasome-mediated mechanisms. Consistent with our observation that the protein level of mutant P53 in the MGC803 cell line was not changed by TRIM59, overexpression of TRIM59 did not affect the protein half-life of endogenous mutant P53 in MGC803 cells (Supplementary Figure 3C). We next investigated the molecular mechanism through which TRIM59 promoted P53 degradation. Toward this
goal, we first explored whether TRIM59 interacts with P53. Co-immunoprecipitation results showed that TRIM59 bound to P53 in 293 T cells (Figure 6D, left). The physical association of endogenous TRIM59 and P53 also was observed in 293T and gastric cell line AGS and GES-1 (Figure 6D, right). In addition, the RING domain was not required for the interaction of TRIM59 and P53 because the DRING-truncated TRIM59 still formed a protein complex with P53 (Supplementary Figure 5B). Immunofluorescent staining showed that TRIM59 and P53 co-localized in MKN45 cells (Supplementary Figure 6). Given the fact that a large number of TRIM family proteins serve as E3 ligases, and in light of our findings that TRIM59 enhanced P53 degradation and formed a protein complex with P53, we hypothesized that TRIM59 promoted P53 protein ubiquitination. In agreement with our hypothesis, we observed by co-immunoprecipitation experiments that the ubiquitination of P53 was augmented by TRIM59 overexpression in MKN45 cells, whereas it was diminished by TRIM59 knockdown in AGS cells (Figure 6E). To test if murine double minute 2 (MDM2), a classic ubiquitin E3 ligase for P53, played a role in the regulatory process of the P53 protein stability by TRIM59, we examined the impact of
BASIC AND TRANSLATIONAL AT
November 2014
1050 Zhou et al
Gastroenterology Vol. 147, No. 5
BASIC AND TRANSLATIONAL AT
Figure 5. TRIM59 negatively regulates P53 tumor-suppressor stability and represses the expression of P53 downstream molecules. (A) Immunoblot results show that TRIM59 knockdown by shRNA leads to up-regulation of P53 tumor suppressor and its downstream targets 14-3-3s, p21, and the cell-cycle regulator cyclin D1, but does not affect the protein amount of p27 in the AGS cell line. Right: Quantification of 3 independent experiments is shown. The immunoblotting intensity of nontransfected cells was used for data normalization. (B) TRIM59 knockdown increases the mRNA expression of P53 downstream genes 14-3-3s, p21, and NOXA, although it does not change the p53 mRNA level in the AGS cell line (n ¼ 3). (C) TRIM59 inhibits the luciferase activities of P53 reporter containing multiple P53 DNA binding sites in the MKN45 cell line. The expression of the luciferase gene was driven by the P53-responsive target DNA sequence (responds to and can be activated by P53). Experiments were performed in triplicate. (D) The protein level of P53 is up-regulated in xenograft tumors generated from AGS cells stably transfected with TRIM-shRNA. (E) Knockdown of TRIM59 expression increases apoptosis in xenograft tumors of AGS cells. Representative pictures are shown. Means ± SEM. *P < .05, **P < .01. A t test was used for the statistical analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
MDM2 by shRNA-mediated knockdown. As shown in Supplementary Figure 7, MDM2 knockdown attenuated the promoting effect of TRIM59 on P53 degradation, suggesting that MDM2 contributed to the regulation of the P53 by TRIM59. Collectively, our data suggest that TRIM59 is a negative regulator of P53 signaling, which enhances P53 ubiquitination and its subsequent degradation.
The Tumor-Promoting Activity of TRIM59 Is Overridden by P53 To explore the biological significance of P53 in the tumorpromoting function of TRIM59, we examined the influence of P53 knockdown on tumorigenicity of TRIM59-shRNA lentivirus-stable–transfected AGS cells (Figure 7A). As shown in Figure 7B and C, P53 knockdown significantly attenuated the hypoproliferative phenotype and clone-forming capacity of TRIM59 knockdown AGS cells. Furthermore, tumor xenograft experiments showed that additional P53 knockdown accelerated the impeded in vivo tumor growth of TRIM59
knockdown cancer cells (Figure 7D). In aggregate, these data suggest that TRIM59 promotes gastric tumor growth at least partially through P53.
Expression of TRIM59 Inversely Correlates With P53 Downstream Molecules in Human Gastric Tumor Samples Given our observations that TRIM59 was up-regulated in human gastric tumors and that TRIM59 negatively regulated P53 protein stability, we proposed that the expression of TRIM59 and P53 downstream factors would be correlated negatively in human gastric tumors. q-PCR experimental results showed a significant inverse correlation between the mRNA level of TRIM59 and the P53 downstream factor p21 (Figure 7E), as well as a positive correlation between TRIM59 and cyclin D1 (Figure 7F). We compared the TRIM59 and P53 protein levels from surgically removed human gastric tumor samples using immunoblotting. We found a strong inverse correlation between TRIM59 and wild-type P53 protein
TRIM59 Is a Novel Proto-Oncogene 1051
BASIC AND TRANSLATIONAL AT
November 2014
Figure 6. TRIM59 binds to P53, which in turn facilitates the ubiquitination and degradation of P53. (A) The protein level of P53 decreases correspondingly with progressively increasing amounts of TRIM59 in 293T cells. (B) The expression of TRIM59 reduces the protein abundance of co-transfected P53 in 293T cells (left) and endogenous P53 in the gastric cancer cell line MKN45 (right) (n ¼ 3). (C) The half-life of P53 in 293T cells (left) and MKN45 cells (right) transfected with TRIM59 is prolonged by MG132 treatment (n ¼ 3). (D) Trim59 co-immunoprecipitates with P53 in 293T cells transfected with P53 and flag-tagged TRIM59 (left). Endogenous P53 and TRIM59 form a protein complex in AGS, GES-1, and 293T cells (right). (E) Ubiquitination of P53 is enhanced by TRIM59 overexpression and is attenuated by TRIM59 knockdown. AGS cells transfected with scramble shRNA or sh-TRIM59, and MKN45 cells transfected with empty vector or TRIM59 vector, were lysed at 36 hours after transfection. Cells were incubated with the proteasome inhibitor MG132 (10 mmol/L) for 9 hours before harvest. The cell lysates then were subjected to immunoprecipitations using antibody against P53. Anti-ubiquitin or the anti-P53 antibody was used for immunoblotting to determine the ubiquitination status of P53. (1) AGS cells transfected with scramble shRNA; (2) AGS cells transfected with sh-TRIM59; (3) MKN45 cells transfected with empty vector; (4) MKN45 cells transfected with TRIM59 expression plasmid. Experiments were repeated 3 times. Immunoblotting results of TRIM59 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from 10% of the input are shown at the bottom panel. Means ± SEM. *P < .05, **P < .01. One-way analysis of variance was used for the statistical analysis. DMSO, dimethyl sulfoxide.
levels (P ¼ .0347) (Supplementary Figure 8A). In contrast, the TRIM59 protein level did not correlate well with that of P53 in tumor samples carrying p53 mutations (Supplementary Figure 8B), which provided a possible explanation for the intriguing question of why the P53 mutant protein accumulates in gastric cancer patient samples.
These findings together suggest that TRIM59 forms a protein complex with P53, an interaction that in turn facilitates the ubiquitination of P53 and promotes its degradation. Up-regulated TRIM59 in gastric cancer inhibits the P53 tumor-suppressor signaling, resulting in accelerated tumor growth and progression.
1052 Zhou et al
Gastroenterology Vol. 147, No. 5
BASIC AND TRANSLATIONAL AT
Figure 7. TRIM59 exerts the tumor-promoting activities through the P53 tumor suppressor. (A) sh-TRIM59 and sh-P53 were used to knock down TRIM59 and P53, respectively, in AGS cells. The first sh-TRIM59 sequence was used in this experiment. The shRNA for P53 knockdown was AGTAGATTACCACTGGAGTCTT. (B) P53 knockdown attenuates the inhibitory effect on the AGS cell proliferation by TRIM59 knockdown. Cells were incubated with the CellTiter 96 Aqueous One Solution reagent (Promega, Madison, WI) for 3 hours. The absorbance at 490 nm then was measured on a microplate reader for quantification of viable cells (n ¼ 3). (C) Knockdown of P53 expression significantly increased the impaired clone formation of TRIM59shRNA–transfected AGS cancer cells (n ¼ 4). (D) P53 knockdown accelerated the impeded in vivo tumorigenicity of AGS cancer cells stably expressing sh-TRIM59 (n ¼ 10). (E and F) mRNA expression levels of TRIM59 negatively correlated with (E) the P53 downstream gene p21 (n ¼ 40) and positively correlated with (F) cyclin D1 (n ¼ 36) in human gastric cancer samples. Means ± SEM. *P < .05, **P < .01, ***P < .001. (A–D) One-way analysis of variance was used for the statistical analysis. (E and F) The Pearson correlation was used for the analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Discussion The present study provides experimental evidence that TRIM59 is overexpressed significantly in gastric tumors and the immunostaining intensity of TRIM59 correlates
positively with the tumor clinical stage. Significantly shortened overall survival is seen in patients with high TRIM59 expression compared with those with low TRIM59 expression. We propose that RNA or protein
November 2014
Supplementary Material Note: To access the supplementary material accompanying this article, visit the online version of Gastroenterology at www.gastrojournal.org, and at http://dx.doi.org/10.1053/ j.gastro.2014.07.021.
References 1. Jemal A, Bray F, Center MM, et al. Global cancer statistics. CA Cancer J Clin 2011;61:69–90. 2. Lin Y, Ueda J, Kikuchi S, et al. Comparative epidemiology of gastric cancer between Japan and China. World J Gastroenterol 2011;17:4421–4428. 3. Vogelstein B, Lane D, Levine AJ. Surfing the p53 network. Nature 2000;408:307–310. 4. Imazeki F, Omata M, Nose H, et al. p53 gene mutations in gastric and esophageal cancers. Gastroenterology 1992;103:892–896. 5. Bellini MF, Cadamuro AC, Succi M, et al. Alterations of the TP53 gene in gastric and esophageal carcinogenesis. J Biomed Biotechnol 2012;2012:891961. 6. Gabbert HE, Muller W, Schneiders A, et al. The relationship of p53 expression to the prognosis of 418 patients with gastric carcinoma. Cancer 1995;76:720–726. 7. Ozato K, Shin DM, Chang TH, et al. TRIM family proteins and their emerging roles in innate immunity. Nat Rev Immunol 2008;8:849–860. 8. Versteeg GA, Rajsbaum R, Sanchez-Aparicio MT, et al. The E3-ligase TRIM family of proteins regulates signaling pathways triggered by innate immune pattern-recognition receptors. Immunity 2013;38:384–398. 9. Nisole S, Stoye JP, Saib A. TRIM family proteins: retroviral restriction and antiviral defence. Nat Rev Microbiol 2005;3:799–808. 10. Klugbauer S, Rabes HM. The transcription coactivator HTIF1 and a related protein are fused to the RET receptor tyrosine kinase in childhood papillary thyroid carcinomas. Oncogene 1999;18:4388–4393. 11. Le Douarin B, Zechel C, Garnier JM, et al. The N-terminal part of TIF1, a putative mediator of the ligand-dependent activation function (AF-2) of nuclear receptors, is fused to B-raf in the oncogenic protein T18. EMBO J 1995;14: 2020–2033. 12. Goddard AD, Borrow J, Freemont PS, et al. Characterization of a zinc finger gene disrupted by the t(15;17) in acute promyelocytic leukemia. Science 1991;254: 1371–1374. 13. de The H, Lavau C, Marchio A, et al. The PML-RAR alpha fusion mRNA generated by the t(15;17) translocation in acute promyelocytic leukemia encodes a functionally altered RAR. Cell 1991;66:675–684. 14. Kakizuka A, Miller WH Jr, Umesono K, et al. Chromosomal translocation t(15;17) in human acute promyelocytic leukemia fuses RAR alpha with a novel putative transcription factor, PML. Cell 1991;66:663–674. 15. Hatakeyama S. TRIM proteins and cancer. Nat Rev Cancer 2011;11:792–804. 16. Valiyeva F, Jiang F, Elmaadawi A, et al. Characterization of the oncogenic activity of the novel TRIM59 gene
BASIC AND TRANSLATIONAL AT
quantification of TRIM59 in gastric biopsy by q-PCR, immunoblot, or immunostaining could be used in combination with pathologic examination to predict biological behaviors of the gastric cancer. The molecular–pathologic diagnosis will be useful in personalized treatment optimization. It is important to note that we have shown that TRIM59 promotes gastric tumorigenesis through down-regulation of P53 protein abundance and suppression of P53 downstream signals. It was predicted that TRIM59 might function in the SV40/Tag/pRB/P53 pathway based on differential microarray analysis.16 However, the hypothesis and the underlying molecular mechanisms have never been investigated before. We show evidence in this study that although a full rescue is not observed, P53 significantly attenuates the tumor-promoting effect of TRIM59. We believe that P53 is at least partially responsible for the function of TRIM59 in gastric tumorigenesis, but we do not exclude other targets of TRIM59 in this intricate biological process. We show in this study that TRIM59 physically binds to P53 and enhances the ubiquitination of P53. TRIM59 overexpression leads to a significant decrease of P53 protein half-life whereas TRIM59 gene silencing by shRNA results in prolonged stability of P53. Human homolog of MDM2 is a well-known E3 ubiquitin ligase that promotes P53 degradation.19,20 Our data suggest that MDM2 contributes to the regulatory role of TRIM59 on P53 ubiquitination. Whether TRIM59 possesses E3 ligase activity for P53 in vivo and works synergistically with MDM2 will be interesting to explore in the future. Besides TRIM59, several other proteins from the TRIM family including TRIM28, TRIM29, and TRIM31 were identified as overexpressed in gastric cancers.21–24 Interestingly, TRIM29 promotes cancer cell proliferation through its inhibitory effect on nuclear activities of P53. Unlike TRIM59, TRIM29 lacks the RING finger domain and represses P53 activity by preventing the nuclear import of P53.25 It also has been shown that the binding and deacetylation of TRIM29 by HDAC9 impairs the association between TRIM29 and P53.26 In contrast, the mechanisms by which TRIM28 and TRIM31 influence gastric tumorigenesis have not been explored to date. Therefore, multiple TRIM family proteins may be involved in the regulation of P53 signals but function through distinct mechanisms. In conclusion, our study has shown the biological and clinical significance of TRIM59 in gastric cancer. TRIM59 exerts an inhibitory effect on P53 and its downstream signals, thereby promoting tumor growth and progression. It has been proven by different research groups that restoration of P53 function leads to marked regression of established lymphomas, sarcomas, and liver carcinomas in vivo.27–29 Re-expression of wild-type P53 attenuates tumor growth in mice carrying the p53R172H mutation, although it does not accomplish full tumor regression.30 Pharmaceutical intervention in the interaction between Trim59 and P53 may provide a promising strategy to reactivate P53 signaling in gastric cancer patients with wildtype P53.
TRIM59 Is a Novel Proto-Oncogene 1053
1054 Zhou et al
17.
18. 19. 20.
21.
22.
23.
24.
25. BASIC AND TRANSLATIONAL AT
26.
27.
28.
in mouse cancer models. Mol Cancer Ther 2011;10: 1229–1240. Matozaki T, Sakamoto C, Suzuki T, et al. p53 gene mutations in human gastric cancer: wild-type p53 but not mutant p53 suppresses growth of human gastric cancer cells. Cancer Res 1992;52:4335–4341. Polyak K, Xia Y, Zweier JL, et al. A model for p53induced apoptosis. Nature 1997;389:300–305. Haupt Y, Maya R, Kazaz A, et al. Mdm2 promotes the rapid degradation of p53. Nature 1997;387:296–299. Honda R, Tanaka H, Yasuda H. Oncoprotein MDM2 is a ubiquitin ligase E3 for tumor suppressor p53. FEBS Lett 1997;420:25–27. Sugiura T. The cellular level of TRIM31, an RBCC protein overexpressed in gastric cancer, is regulated by multiple mechanisms including the ubiquitin-proteasome system. Cell Biol Int 2011;35:657–661. Kosaka Y, Inoue H, Ohmachi T, et al. Tripartite motifcontaining 29 (TRIM29) is a novel marker for lymph node metastasis in gastric cancer. Ann Surg Oncol 2007; 14:2543–2549. Yokoe T, Toiyama Y, Okugawa Y, et al. KAP1 is associated with peritoneal carcinomatosis in gastric cancer. Ann Surg Oncol 2010;17:821–828. Sugiura T, Miyamoto K. Characterization of TRIM31, upregulated in gastric adenocarcinoma, as a novel RBCC protein. J Cell Biochem 2008;105:1081–1091. Yuan Z, Villagra A, Peng L, et al. The ATDC (TRIM29) protein binds p53 and antagonizes p53-mediated functions. Mol Cell Biol 2010;30:3004–3015. Yuan Z, Peng L, Radhakrishnan R, et al. Histone deacetylase 9 (HDAC9) regulates the functions of the ATDC (TRIM29) protein. J Biol Chem 2010;285:39329–39338. Ventura A, Kirsch DG, McLaughlin ME, et al. Restoration of p53 function leads to tumour regression in vivo. Nature 2007;445:661–665. Christophorou MA, Ringshausen I, Finch AJ, et al. The pathological response to DNA damage does not contribute to p53-mediated tumour suppression. Nature 2006;443:214–217.
Gastroenterology Vol. 147, No. 5 29. Xue W, Zender L, Miething C, et al. Senescence and tumour clearance is triggered by p53 restoration in murine liver carcinomas. Nature 2007;445:656–660. 30. Wang Y, Suh YA, Fuller MY, et al. Restoring expression of wild-type p53 suppresses tumor growth but does not cause tumor regression in mice with a p53 missense mutation. J Clin Invest 2011;121:893–904. 31. D’Errico M, de Rinaldis E, Blasi MF, et al. Genomewide expression profile of sporadic gastric cancers with microsatellite instability. Eur J Cancer 2009;45: 461–469. 32. Wang Q, Wen YG, Li DP, et al. Upregulated INHBA expression is associated with poor survival in gastric cancer. Med Oncol 2012;29:77–83.
Author names in bold designate shared co-first authors. Received October 28, 2013. Accepted July 15, 2014. Reprint requests Address requests for reprints to: Dr Wei-Qiang Gao or Dr Helen He Zhu, State Key Laboratory of Oncogenes and Related Genes, Renji-Med X Clinical Stem Cell Research Center, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, 160 Pujian Rd, Shanghai, 200127 China. e-mail: [email protected] or [email protected]; fax: (86) 2168383916. Acknowledgments The authors thank Dr Jim W. Xuan for his helpful discussion and support, Connie New for her critical reading of the manuscript, and Yan Han for technical assistance of the statistical analysis. Conflicts of interest The authors disclose no conflicts. Funding Supported by funds from the Ministry of Science and Technology of the People’s Republic of China (2012CB966800 and 2013CB945600), the National Natural Science Foundation of China (81130038 and 81372189), Science and Technology Commission of Shanghai Municipality (Pujiang Program), Shanghai Health Bureau Key Disciplines and Specialties Foundation, Shanghai Education Committee Key Discipline and Specialties Foundation (J50208), and the KC Wong foundation (W.-Q.G.); and by the National Natural Science Foundation of China (81270627), Science and Technology Commission of Shanghai Municipality (Pujiang Program 12PJ1406100), and the Shanghai Education Committee (Chenguang program 12CG16, 13YZ030, and the young investigator program) (H.H.Z.).
BASIC AND TRANSLATIONAL—ALIMENTARY TRACT TRIM59 Is Up-regulated in Gastric Tumors, Promoting Ubiquitination and Degradation of p53 Zhicheng Zhou,1,2 Zhongzhong Ji,1 You Wang,1 Jian Li,3 Hui Cao,4 Helen He Zhu,1 and Wei-Qiang Gao1,2 1
State Key Laboratory of Oncogenes and Related Genes, Renji-Med X Clinical Stem Cell Research Center, Ren Ji Hospital, School of Medicine; 2School of Biomedical Engineering and Med-X Research Institute, Shanghai Jiao Tong University, Shanghai; 3Department of General Surgery, First Affiliated Hospital, Nanchang University, Nanchang; and 4Department of General Surgery, Renji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, China
G
astric cancer is the fourth most frequent type of cancer and the second most common cause of death from cancer worldwide.1 Strikingly, gastric cancer cases in China alone account for 42% of cases globally. This incidence increases steadily, likely owing to the dietary habits of, and the high prevalence of Helicobacter pylori infection in, the Chinese population.2 Therefore, the discovery of new diagnostic and prognostic markers and a better understanding of molecular mechanisms for gastric tumorigenesis remain urgent problems. P53, a key tumor suppressor, regulates multiple critical biological processes including apoptosis, cell-cycle arrest, DNA repair, and so forth.3 Genetic and epigenetic alterations causing inactivation of P53 are implicated in approximately 50% of gastric cancer patients.4–6 Notably, gastric cancer tissues from 50% of stomach cancer patients show positive immunostaining for the P53 protein. Nevertheless, it was later shown that the positive staining largely was attributable to mutant P53, whereas the expression of wild-type P53 protein became undetectable/lost in gastric tumors with the wild-type p53 allele.5,6 Re-activation of the P53 pathway is an attractive strategy for pharmaceutical interference in tumor initiation and progression. However, the underlying mechanisms for the P53 down-regulation in gastric cancer patients have not been understood fully to date. The tripartite motif (TRIM) family proteins are evolutionarily conserved proteins that share a common N-terminal really interesting new gene (RING) finger domain followed by 1 or 2 B-boxes and coiled-coil sequences.7 Because of the RING finger domain, many of the TRIM proteins act as E3 ubiquitin ligases.7–9 The importance of TRIM proteins in cancers was first shown by the discovery of the translocation of several TRIM genes to other genes (eg, TRIM19 encoding the pml gene and rara gene fusion, trim24/ braf translocation, and trim24/rets fusion).10–14 In addition, TRIM proteins including TRIM13, TRIM19, TRIM24, and TRIM25 were shown to be involved in leukemia, breast, and
Abbreviations used in this paper: MDM2, murine double minute 2; mRNA, messenger RNA; q-PCR, quantitative polymerase chain reaction; shRNA, short hairpin RNA; TRIM, tripartite motif.
Keywords: Oncogene; Stomach Cancer; Tumor Formation; Progression.
© 2014 by the AGA Institute 0016-5085/$36.00 http://dx.doi.org/10.1053/j.gastro.2014.07.021
BASIC AND TRANSLATIONAL AT
BACKGROUND & AIMS: Little is known about factors that promote gastric carcinogenesis. We analyzed multiple microarray data sets for messenger RNAs (mRNAs) that were increased significantly in human gastric tumor samples, compared with the adjacent normal gastric tissue. We found expression of tripartite motif 59 (TRIM59), which encodes a putative ubiquitin ligase, to be increased, and investigated its effects in gastric cancer cell lines. METHODS: We analyzed microarray data sets from the Oncomine database. We used quantitative polymerase chain reaction and immunoblotting to measure levels of TRIM59 mRNA and protein in 50 human gastric cancer and paired normal tissues, obtained from Renji Hospital and the First Affiliated Hospital of Nanchang University, in China. We also measured protein levels in the gastric epithelial cell line GES-1; the cancer cell lines MKN45, AGS, SGC7901, BGC823, Snu5, N87, and Snu1; and in tissue arrays of 108 human gastric tumors. TRIM59 was knocked down and overexpressed in gastric cancer cell lines, and the effects on proliferation, clone formation, migration, and growth of xenograft tumors in nude mice were assessed. TRIM59-related signaling pathways were examined by immunoblotting and quantitative polymerase chain reaction. We analyzed interactions among TRIM59, P53, and ubiquitin in immunoprecipitation studies. RESULTS: Levels of TRIM59 mRNA and protein were increased significantly in gastric tumors compared with nontumor tissues; increased levels were associated with advanced tumor stage and shorter patient survival times. TRIM59 knockdown reduced proliferation, clone formation, and migration of gastric cancer cell lines, as well as growth of xenograft tumors in nude mice; overexpression of TRIM59 had the opposite effects. TRIM59 interacted physically with P53, increasing its ubiquitination and degradation. Increased levels of TRIM59 in human gastric tumors correlated with reduced expression of P53 target genes. CONCLUSIONS: The putative ubiquitin ligase TRIM59 is up-regulated in human gastric tumors compared with nontumor tissues. Levels of TRIM59 correlate with tumor progression and patient survival times. TRIM59 interacts with P53, promoting its ubiquitination and degradation, and TRIM59 might promote gastric carcinogenesis via this mechanism.
1044 Zhou et al
Gastroenterology Vol. 147, No. 5
prostate cancers through the regulation of transcriptional factors or tumor suppressors, indicating crucial roles of the TRIM family in tumorigenesis.15 We performed searches and a meta-analysis on microarray data sets from the Oncomine database (www. oncomine.com) for possible targets in the TRIM family whose expressions are altered significantly in gastric cancer. Interestingly, TRIM59, with unidentified biological functions, was the top hit found in our searches. We report in this study that TRIM59 is up-regulated in gastric cancer and strongly associated with poor patient outcome. TRIM59 promotes gastric cancer cell proliferation, migration, and xenograft tumor growth. Mechanistically, TRIM59 interacts with the P53 tumor suppressor, and, as a result, facilitates the ubiquitination and degradation of P53. In addition, increased expression of TRIM59 in human gastric tumor samples correlates with down-regulation of P53 target genes.
HEK293T, MKN45, or MGC803 cells were co-transfected with the P53 expression plasmid and the TRIM59-Flag plasmid or the empty vector as described earlier. A total of 10 mg/mL of cycloheximide (purchased from Sigma) was added to the culture medium at 48 hours after the plasmid transfection to 293T cells or at 36 hours to MKN45 cells. Cells were lysed in RIPA buffer containing protease and phosphatase inhibitors as described earlier after cycloheximide treatment at indicated time points. For MG132 treatment, at indicated hours after transfection, cells were incubated with MG132 (10 mmol/L) for an additional 3, 6, or 9 hours. Cells then were collected for immunoblots to determine the P53 protein amount.
Materials and Methods
Cell Lines, Plasmids, Transfection, and Lentivirus Production
Patient Samples
BASIC AND TRANSLATIONAL AT
Fifty fresh samples of human gastric cancer and paired normal tissues were obtained during surgery at the Department of General Surgery from Renji Hospital and the First Affiliated Hospital of Nanchang University. All samples were collected with patients’ informed consent. A total of 178-spot, paraffin-embedded, tissue array chips (HStm-Ade178Sur-01) including 67 paired gastric tumor and normal tissues, 39 tumor tissues, and 5 normal tissues with 7 to 9 years of follow-up information, were purchased from Shanghai Outdo Biotech, Ltd (Shanghai, China).
(Sigma, Saint Louis, MO), anti-P53 (Cell Signaling Technology, Boston, MA), mouse immunoglobulin G (Santa Cruz, Santa Cruz, CA), glyceraldehyde-3-phosphate dehydrogenase (Epitomics, Burlingame, CA), and anti-ubiquitin (Santa Cruz) antibodies.
Protein Half-Life Detection
Detailed descriptions of the cell lines, plasmids, transfection, and lentivirus production are available in the Supplementary Materials and Methods.
Cell Proliferation, Clonogenic, Transwell Migration, and In Vivo Xenograft Assay Detailed descriptions of the cell proliferation, clonogenic, Transwell (Corning, NY) migration, and in vivo xenograft assay are available in the Supplementary Materials and Methods.
Statistical Analysis Immunoblotting, Immunofluorescence, and Immunohistochemistry Detailed descriptions are available in the Supplementary Materials and Methods. Quantitative analysis of the immunostaining images was performed after color segmentation based on the fixed threshold value of hue, saturation, and intensity. Each image was assigned a score calculated by multiplying the staining intensity by the area of positive stained cells. “Upregulation” denoted that the score of the cancer tissue was higher than that of the paired normal tissue, whereas “downregulation” meant that the score of the cancer tissue was lower compared with the matched normal tissue.
Immunoprecipitation and Ubiquitination Assays Cells were washed with ice-cold phosphate-buffered saline and lysed in a lysis buffer (50 mmol/L Tris-HCl, pH 8.0; 150 mmol/L NaCl; 1% NP-40) supplemented with protease and phosphatase inhibitors (Roche, Penzberg, Germany) at 36 hours after transfection. Cell lysates were incubated with primary antibodies overnight at 4 C. TrueBlot anti-Mouse IgG IP Beads (eBioscience, San Diego, CA) then were added and incubated for another 4 hours at 4 C. The immunoprecipitates were washed 4 times with the lysis buffer and boiled for 5 minutes at 98 C in protein loading buffer. Immunoprecipitated proteins were detected by following immunoblots. Antibodies used in the coimmunoprecipitation experiments were as follows: anti-Flag
Statistical evaluation was conducted using the Student t test. Multiple comparisons were analyzed first by 1-way analysis of variance. The log-rank (Mantel–Cox) test was used for patient survival analysis. The Pearson correlation was used to analyze the strength of the association between expression levels of TRIM59 and its related genes in patient samples. A significant difference was defined as P < .05.
Results TRIM59 Is Up-Regulated in Human Gastric Cancer and Correlates With Disease Progression as Well as Shortened Patient Survival To determine the significance of TRIM59 in gastric cancer, we first analyzed multiple microarray data sets in the Oncomine database. As shown in Figure 1A, TRIM59 messenger RNA (mRNA) levels were increased significantly in human tumor samples as compared with the adjacent normal gastric tissue. Importantly, up-regulated TRIM59 was associated strongly with shortened patient survival (Figure 1B). These data indicated a positive correlation of TRIM59 expression with gastric cancer. To verify the microarray analysis results, we performed immunoblot and quantitative polymerase chain reaction (q-PCR) experiments on human gastric adenocarcinoma specimens and their matched normal tissues. Seven of 10
TRIM59 Is a Novel Proto-Oncogene 1045
BASIC AND TRANSLATIONAL AT
November 2014
Figure 1. TRIM59 expression is up-regulated in gastric cancer. (A) Analysis from the Oncomine database shows that mRNA expression levels of TRIM59 are significantly higher in gastric cancers compared with normal tissues. Data were pooled together from 2 published gastric cancer gene expression studies31,32 (P < .001), 46 normal tissues and 50 cancer tissues were analyzed. (B) Analysis of tumor TRIM59 DNA copy number in association with patient survival from the Oncomine database indicates a correlation of high TRIM59 copy number with shortened survival (the Cancer Genome Atlas, Gastric Statistics, P ¼ .0447, n ¼ 14, 28). (C) Immunoblot shows higher protein levels of TRIM59 in 7 of 10 tumor samples compared with the respective matched normal tissues (T, tumor; N, normal tissue). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is used as a loading control. (D) TRIM59 mRNA expression level in 10 paired tumor samples and normal tissues. (E) The mRNA level of TRIM59 in GES-1 and GES-7 gastric cancer cell lines with different differentiation status. Data were normalized against the TRIM59 expression level in GES-1 cells. (F) Immunoblot of TRIM59 confirms high expression level of TRIM59 in poor differentiated gastric cancer cell lines. Data are presented as means ± SEM. *P < .05, **P < .01, ***P < .001. (A and D) A t test was used for the statistical analysis. (B) The log-rank (Mantel–Cox) test was used. (E) One-way analysis of variance was used.
tumor samples showed increased protein levels of TRIM59 compared with their respective paired normal tissues (Figure 1C). In addition, q-PCR experiments showed that 5
tumors expressed significantly higher TRIM59 mRNA levels, whereas 4 tumor specimens showed comparable TRIM59 mRNA levels with normal tissues. Only 1 tumor showed
1046 Zhou et al
BASIC AND TRANSLATIONAL AT
decreased TRIM59 mRNA expression (Figure 1D). Therefore, the high expression of TRIM59 in gastric cancer may not originate solely from transcriptional up-regulation. We further assessed the expression of TRIM59 in multiple gastric cancer cell lines. As shown in Figure 1E and F, high mRNA and protein levels of TRIM59 correlated positively with poor differentiation status in gastric cancer cell lines because the highest expression of TRIM59 was found in the most aggressive cancer cell lines, AGS and Snu1, and the least expression was observed in the immortalized human gastric epithelial cell line GES-1, which is not tumorigenic. To further investigate the correlation of TRIM59 with gastric cancer progress, we performed an immunohistochemical staining for TRIM59 on primary human tumors from a large cohort of gastric cancer patients (n ¼ 111). Among the 111 patients, 67 biopsy specimens contained both tumors and matched normal tissues, whereas 39 biopsy specimens had only tumor tissues, and the other 5 specimens only contained normal tissues. Semiquantitative analysis showed a significantly increased intensity of TRIM59 staining in gastric tumors than normal tissues (Figure 2A and B). Notably, TRIM59 expression was correlated positively with the pathologic grade of gastric cancer (Figure 2C and Supplementary Table 1). A detailed description of the clinical features for the patient samples in this study is provided in Supplementary Table 2. As the disease state progresses, gastric tumor cells infiltrate across the mucous membrane into the muscular layer, serosa layer, and, ultimately, to metastatic sites. As shown in Figure 2D, deeper gastric wall infiltrations were detected more frequently in the tumor samples with up-regulated TRIM59. Moreover, increased expression of TRIM59 was linked significantly to shortened patient survival (P ¼ .045), because the 5-year overall survival rates for patients with high TRIM59 expression and low TRIM59 expression were 15.9% and 30.4%, respectively (Figure 2E).
TRIM59 Promotes Gastric Tumor Growth In Vitro and In Vivo We then examined the biological function of TRIM59 in gastric cancer using a lentivirus-mediated knockdown and overexpression system (Supplementary Figure 1A and B). As shown in Figure 3A, cell proliferation was suppressed significantly by TRIM59 RNA interference in AGS cells, and it was enhanced by ectopic expression of TRIM59 in MKN45 cells (Figure 3A and B). In addition, although TRIM59 knockdown attenuated the soft agar clone-forming capability of AGS cells, TRIM59 overexpression promoted clone formation in MKN45 cells because the number of soft agar clones was increased markedly (Figure 3C and D). We further assessed the impact of TRIM59 on cell migration using the Boyden Transwell chamber assays. As shown in Figure 3E and F, TRIM59–short hairpin RNA (shRNA) transfection hindered AGS cell migration, whereas forced expression of TRIM59 had the opposite effect on MKN45 cells. These data were consistent with our finding that increased TRIM59 is associated with a high degree of human gastric tumor infiltration (Figure 2D).
Gastroenterology Vol. 147, No. 5
To verify the positive role of TRIM59 in gastric tumor progression in vivo, we performed xenograft tumor assays using AGS cells and MKN45 cells stably transfected by TRIM59-shRNA or TRIM59-overexpression lentiviruses, respectively. We found that TRIM59 knockdown significantly inhibited xenograft tumor growth in nude mice (Figure 4A). Immunofluorescent staining of Ki67 showed significantly fewer proliferative cells in TRIM59-shRNA xenograft tumors (Figure 4B and C). On the other hand, lentiviral expression of TRIM59 resulted in accelerated xenograft tumor growth (Figure 4D and E). These data collectively indicate that TRIM59 acted as a novel tumor-promoting molecule and positively regulates gastric tumor growth.
TRIM59 Negatively Regulates the P53 Tumor Suppressor and Represses the Expression of P53 Downstream Molecules To understand the molecular mechanism by which TRIM59 promotes gastric cancer, we tested several signaling transduction pathways that have been shown previously to be critical in gastric tumorigenesis and possibly regulated by TRIM59.16 We discovered that in the AGS gastric cancer cell line, phosphorylation of Ras signaling components p38, p44/p42, and PKC (protein kinase C) were suppressed upon TRIM59 knockdown (Supplementary Figure 2). Because previous reports showed that inactivation of P53 is one of the most common events in gastric cancers,17 we determined the P53 expression level after TRIM59 knockdown, and found that this procedure led to an increase in P53 protein level (Figure 5A). We further examined several P53 downstream molecules and found that 14-3-3s, p21, and p27 were up-regulated in TRIM59shRNA lentivirus-transfected AGS cells (Figure 5A and B). The expression of cyclin D1, a cyclin negatively regulated by p21, was decreased in TRIM59 knockdown AGS cells (Figure 5A). Those data suggest that TRIM59 exerted an inhibitory effect on the P53 signaling pathway. In addition, we observed no change in mRNA levels of p53 in TRIM59shRNA lentivirus-transfected cells, suggesting a posttranscriptional regulation of P53 by TRIM59 (Figure 5B). To determine if TRIM59 affected the P53 transcriptional activity, we co-transfected a luciferase reporter plasmid containing P53-responsive elements with the sh-TRIM59 lentivirus into AGS cells or with the TRIM59 expression plasmid into MKN45 cells. As shown in Figure 5C, TRIM59 knockdown significantly increased the luciferase activity, whereas overexpression of TRIM59 led to attenuated intensity of the P53 luciferase reporter. It should be noted that AGS cells and MKN45 cells do not contain any p53 mutation. We further examined the impact of TRIM59 on mutant P53 in the MGC803 cell line carrying the p53 mutation. As shown in Supplementary Figure 3A and B, overexpression of TRIM59 did not affect the protein amount of endogenous mutant P53. Besides proliferation inhibition, P53 can act as a tumor suppressor, largely through its role in apoptosis induction.18 We observed an increase of cell death after transient TRIM59 knockdown (Supplementary Figure 4). Consistently, we found significantly increased
TRIM59 Is a Novel Proto-Oncogene 1047
BASIC AND TRANSLATIONAL AT
November 2014
Figure 2. Increased expression of TRIM59 correlates with gastric cancer progression and poor survival in patients. (A) Immunohistochemical staining of normal and gastric cancer tissues with anti-TRIM59 antibody. Representative patient samples of clinical stages I, II, and III are shown. A total of 111 patient samples were stained and analyzed. (B) Quantitative analysis of TRIM59 staining shows significantly higher staining intensity in gastric tumor samples compared with normal tissues (72 normal tissues and 108 tumor samples). IOD, integral optical density. (C) Analysis of TRIM59 staining intensity in association with clinical stages of gastric tumor samples (n ¼ 108). (D) Up-regulated TRIM59 expression positively correlated with high degrees of gastric tumor infiltration. When the intensity of TRIM59 immunohistochemistry staining was higher in the tumor tissue than its paired normal tissue, the expression of TRIM59 was defined as “high expression.” When the intensity of TRIM59 IHC staining was lower in the tumor tissue than its paired normal tissue or no change was detected, its expression was defined as “low expression” (n ¼ 23 in the low-expression group, no change of TRIM59 expression levels was found in 3 of the 23 tumor samples; n ¼ 42 in the high-expression group). (E) High intensity of TRIM59 immunostaining strongly associates with poor patient survival (n ¼ 44 in the TRIM59 high-expression group, n ¼ 23 in the TRIM59 low-expression group). Data are presented as means ± SEM. *P < .05. (B and C) A t test was used for the statistical analysis. (E) The log-rank (Mantel–Cox) test was used.
1048 Zhou et al
Gastroenterology Vol. 147, No. 5
BASIC AND TRANSLATIONAL AT
Figure 3. TRIM59 promotes gastric cancer cell proliferation, clone formation, and migration. (A) TRIM59 knockdown reduces the proliferation rate of AGS cells. The first shTRIM59 sequence was ACATTACAGGCAACCATTAAA and the second shTRIM59 sequence was TTGCACTAAGGGCTATTATTG (means ± SD; n ¼ 8; blank, nontreated cells). (B) Overexpression of TRIM59 accelerantes the proliferation of MKN45 cells (means ± SD; n ¼ 8). (C) TRIM59 knockdown inhibits the capability of clone formation in soft agar of AGS cell. The first sh-TRIM59 sequence was used in this experiment (means ± SEM; n ¼ 4). (D) Overexpression of TRIM59 promotes MKN45 cell clone formation in soft agar (means ± SEM; n ¼ 3). (E and F) TRIM59 knockdown inhibits AGS cell migration, whereas TRIM59 overexpression exerts the opposite effect (means ± SEM; n ¼ 5). *P < .05; ***P < .001. One-way analysis of variance was used for the statistical analysis.
expression of P53 and more apoptotic cancer cells distinguished by the positive cleaved caspase-3 staining in shTRIM59 xenograft tumors (Figure 5D and E).
TRIM59 Interacts With P53 and Enhances Ubiquitination and Degradation of P53 To further substantiate the negative role of TRIM59 in the regulation of P53, we investigated the impact of ectopic
TRIM59 expression in 293T cells on P53. In line with our hypothesis, protein levels of P53 reduced proportionally with progressively increasing amounts of TRIM59, suggesting that TRIM59 negatively regulates P53 abundance in a dose-dependent way (Figure 6A and B, left). Furthermore, as shown in Figure 6B (right), overexpression of TRIM59 resulted in a decreased endogenous P53 protein level in the gastric cancer cell line MKN45. The RING domain was proven to be essential for the protein degradation function
TRIM59 Is a Novel Proto-Oncogene 1049
Figure 4. TRIM59 enhances the tumorigenicity of gastric cancer cells in vivo. (A) TRIM59 gene silencing by shRNA resulted in suppressed tumorigenicity of AGS cells in vivo. Only 4 of 10 mice inoculated with TRIM59-shRNA lentivirus-infected AGS cells form a tumor. The first sh-TRIM59 sequence was used in this experiment. (B) Reduced tumor volumes and weights of xenografts generated by AGS cells transfected with TRIM59-shRNA (n ¼ 10; blank, nontreated AGS cells). (C) Xenograft tumors from TRIM59-shRNA AGS cells contain significantly less Ki67-positive proliferative cells (n ¼ 10, 5 fields were random picked, examined under a fluorescent microscope, captured and counted per xenograft sample). (D) Enhanced tumorigenicity of MKN45 cells in vivo by TRIM59 overexpression. (E) Increased tumor volumes and weights of xenografts generated by MKN45 cells stably expressing TRIM59 (n ¼ 10) (means ± SEM). *P < .05, ***P < .001. One-way analysis of variance was used for the statistical analysis.
of multiple TRIM family proteins. We constructed truncated TRIM59-expressing plasmid without the RING domain. As shown in Supplementary Figure 5, unlike the full-length TRIM59, ectopic expression of the DRING truncated form of TRIM59 did not affect the P53 protein amount, suggesting that the RING domain is required for the regulatory role of TRIM59 on P53. As shown in Figure 6C (left panel), the halflife of P53 protein was shortened significantly in 293T cells transfected with TRIM59, indicating that TRIM59 negatively affected P53 stability. Consistently, ectopic expression of TRIM59 significantly reduced the half-life of endogenous P53 in the gastric cancer cell line MKN45 (Figure 6C, right). In addition, we observed that treatment with MG132, a proteasome inhibitor, led to a significant increase of the P53 protein half-life, supporting the notion that TRIM59 regulates P53 stability by proteasome-mediated mechanisms. Consistent with our observation that the protein level of mutant P53 in the MGC803 cell line was not changed by TRIM59, overexpression of TRIM59 did not affect the protein half-life of endogenous mutant P53 in MGC803 cells (Supplementary Figure 3C). We next investigated the molecular mechanism through which TRIM59 promoted P53 degradation. Toward this
goal, we first explored whether TRIM59 interacts with P53. Co-immunoprecipitation results showed that TRIM59 bound to P53 in 293 T cells (Figure 6D, left). The physical association of endogenous TRIM59 and P53 also was observed in 293T and gastric cell line AGS and GES-1 (Figure 6D, right). In addition, the RING domain was not required for the interaction of TRIM59 and P53 because the DRING-truncated TRIM59 still formed a protein complex with P53 (Supplementary Figure 5B). Immunofluorescent staining showed that TRIM59 and P53 co-localized in MKN45 cells (Supplementary Figure 6). Given the fact that a large number of TRIM family proteins serve as E3 ligases, and in light of our findings that TRIM59 enhanced P53 degradation and formed a protein complex with P53, we hypothesized that TRIM59 promoted P53 protein ubiquitination. In agreement with our hypothesis, we observed by co-immunoprecipitation experiments that the ubiquitination of P53 was augmented by TRIM59 overexpression in MKN45 cells, whereas it was diminished by TRIM59 knockdown in AGS cells (Figure 6E). To test if murine double minute 2 (MDM2), a classic ubiquitin E3 ligase for P53, played a role in the regulatory process of the P53 protein stability by TRIM59, we examined the impact of
BASIC AND TRANSLATIONAL AT
November 2014
1050 Zhou et al
Gastroenterology Vol. 147, No. 5
BASIC AND TRANSLATIONAL AT
Figure 5. TRIM59 negatively regulates P53 tumor-suppressor stability and represses the expression of P53 downstream molecules. (A) Immunoblot results show that TRIM59 knockdown by shRNA leads to up-regulation of P53 tumor suppressor and its downstream targets 14-3-3s, p21, and the cell-cycle regulator cyclin D1, but does not affect the protein amount of p27 in the AGS cell line. Right: Quantification of 3 independent experiments is shown. The immunoblotting intensity of nontransfected cells was used for data normalization. (B) TRIM59 knockdown increases the mRNA expression of P53 downstream genes 14-3-3s, p21, and NOXA, although it does not change the p53 mRNA level in the AGS cell line (n ¼ 3). (C) TRIM59 inhibits the luciferase activities of P53 reporter containing multiple P53 DNA binding sites in the MKN45 cell line. The expression of the luciferase gene was driven by the P53-responsive target DNA sequence (responds to and can be activated by P53). Experiments were performed in triplicate. (D) The protein level of P53 is up-regulated in xenograft tumors generated from AGS cells stably transfected with TRIM-shRNA. (E) Knockdown of TRIM59 expression increases apoptosis in xenograft tumors of AGS cells. Representative pictures are shown. Means ± SEM. *P < .05, **P < .01. A t test was used for the statistical analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
MDM2 by shRNA-mediated knockdown. As shown in Supplementary Figure 7, MDM2 knockdown attenuated the promoting effect of TRIM59 on P53 degradation, suggesting that MDM2 contributed to the regulation of the P53 by TRIM59. Collectively, our data suggest that TRIM59 is a negative regulator of P53 signaling, which enhances P53 ubiquitination and its subsequent degradation.
The Tumor-Promoting Activity of TRIM59 Is Overridden by P53 To explore the biological significance of P53 in the tumorpromoting function of TRIM59, we examined the influence of P53 knockdown on tumorigenicity of TRIM59-shRNA lentivirus-stable–transfected AGS cells (Figure 7A). As shown in Figure 7B and C, P53 knockdown significantly attenuated the hypoproliferative phenotype and clone-forming capacity of TRIM59 knockdown AGS cells. Furthermore, tumor xenograft experiments showed that additional P53 knockdown accelerated the impeded in vivo tumor growth of TRIM59
knockdown cancer cells (Figure 7D). In aggregate, these data suggest that TRIM59 promotes gastric tumor growth at least partially through P53.
Expression of TRIM59 Inversely Correlates With P53 Downstream Molecules in Human Gastric Tumor Samples Given our observations that TRIM59 was up-regulated in human gastric tumors and that TRIM59 negatively regulated P53 protein stability, we proposed that the expression of TRIM59 and P53 downstream factors would be correlated negatively in human gastric tumors. q-PCR experimental results showed a significant inverse correlation between the mRNA level of TRIM59 and the P53 downstream factor p21 (Figure 7E), as well as a positive correlation between TRIM59 and cyclin D1 (Figure 7F). We compared the TRIM59 and P53 protein levels from surgically removed human gastric tumor samples using immunoblotting. We found a strong inverse correlation between TRIM59 and wild-type P53 protein
TRIM59 Is a Novel Proto-Oncogene 1051
BASIC AND TRANSLATIONAL AT
November 2014
Figure 6. TRIM59 binds to P53, which in turn facilitates the ubiquitination and degradation of P53. (A) The protein level of P53 decreases correspondingly with progressively increasing amounts of TRIM59 in 293T cells. (B) The expression of TRIM59 reduces the protein abundance of co-transfected P53 in 293T cells (left) and endogenous P53 in the gastric cancer cell line MKN45 (right) (n ¼ 3). (C) The half-life of P53 in 293T cells (left) and MKN45 cells (right) transfected with TRIM59 is prolonged by MG132 treatment (n ¼ 3). (D) Trim59 co-immunoprecipitates with P53 in 293T cells transfected with P53 and flag-tagged TRIM59 (left). Endogenous P53 and TRIM59 form a protein complex in AGS, GES-1, and 293T cells (right). (E) Ubiquitination of P53 is enhanced by TRIM59 overexpression and is attenuated by TRIM59 knockdown. AGS cells transfected with scramble shRNA or sh-TRIM59, and MKN45 cells transfected with empty vector or TRIM59 vector, were lysed at 36 hours after transfection. Cells were incubated with the proteasome inhibitor MG132 (10 mmol/L) for 9 hours before harvest. The cell lysates then were subjected to immunoprecipitations using antibody against P53. Anti-ubiquitin or the anti-P53 antibody was used for immunoblotting to determine the ubiquitination status of P53. (1) AGS cells transfected with scramble shRNA; (2) AGS cells transfected with sh-TRIM59; (3) MKN45 cells transfected with empty vector; (4) MKN45 cells transfected with TRIM59 expression plasmid. Experiments were repeated 3 times. Immunoblotting results of TRIM59 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from 10% of the input are shown at the bottom panel. Means ± SEM. *P < .05, **P < .01. One-way analysis of variance was used for the statistical analysis. DMSO, dimethyl sulfoxide.
levels (P ¼ .0347) (Supplementary Figure 8A). In contrast, the TRIM59 protein level did not correlate well with that of P53 in tumor samples carrying p53 mutations (Supplementary Figure 8B), which provided a possible explanation for the intriguing question of why the P53 mutant protein accumulates in gastric cancer patient samples.
These findings together suggest that TRIM59 forms a protein complex with P53, an interaction that in turn facilitates the ubiquitination of P53 and promotes its degradation. Up-regulated TRIM59 in gastric cancer inhibits the P53 tumor-suppressor signaling, resulting in accelerated tumor growth and progression.
1052 Zhou et al
Gastroenterology Vol. 147, No. 5
BASIC AND TRANSLATIONAL AT
Figure 7. TRIM59 exerts the tumor-promoting activities through the P53 tumor suppressor. (A) sh-TRIM59 and sh-P53 were used to knock down TRIM59 and P53, respectively, in AGS cells. The first sh-TRIM59 sequence was used in this experiment. The shRNA for P53 knockdown was AGTAGATTACCACTGGAGTCTT. (B) P53 knockdown attenuates the inhibitory effect on the AGS cell proliferation by TRIM59 knockdown. Cells were incubated with the CellTiter 96 Aqueous One Solution reagent (Promega, Madison, WI) for 3 hours. The absorbance at 490 nm then was measured on a microplate reader for quantification of viable cells (n ¼ 3). (C) Knockdown of P53 expression significantly increased the impaired clone formation of TRIM59shRNA–transfected AGS cancer cells (n ¼ 4). (D) P53 knockdown accelerated the impeded in vivo tumorigenicity of AGS cancer cells stably expressing sh-TRIM59 (n ¼ 10). (E and F) mRNA expression levels of TRIM59 negatively correlated with (E) the P53 downstream gene p21 (n ¼ 40) and positively correlated with (F) cyclin D1 (n ¼ 36) in human gastric cancer samples. Means ± SEM. *P < .05, **P < .01, ***P < .001. (A–D) One-way analysis of variance was used for the statistical analysis. (E and F) The Pearson correlation was used for the analysis. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Discussion The present study provides experimental evidence that TRIM59 is overexpressed significantly in gastric tumors and the immunostaining intensity of TRIM59 correlates
positively with the tumor clinical stage. Significantly shortened overall survival is seen in patients with high TRIM59 expression compared with those with low TRIM59 expression. We propose that RNA or protein
November 2014
Supplementary Material Note: To access the supplementary material accompanying this article, visit the online version of Gastroenterology at www.gastrojournal.org, and at http://dx.doi.org/10.1053/ j.gastro.2014.07.021.
References 1. Jemal A, Bray F, Center MM, et al. Global cancer statistics. CA Cancer J Clin 2011;61:69–90. 2. Lin Y, Ueda J, Kikuchi S, et al. Comparative epidemiology of gastric cancer between Japan and China. World J Gastroenterol 2011;17:4421–4428. 3. Vogelstein B, Lane D, Levine AJ. Surfing the p53 network. Nature 2000;408:307–310. 4. Imazeki F, Omata M, Nose H, et al. p53 gene mutations in gastric and esophageal cancers. Gastroenterology 1992;103:892–896. 5. Bellini MF, Cadamuro AC, Succi M, et al. Alterations of the TP53 gene in gastric and esophageal carcinogenesis. J Biomed Biotechnol 2012;2012:891961. 6. Gabbert HE, Muller W, Schneiders A, et al. The relationship of p53 expression to the prognosis of 418 patients with gastric carcinoma. Cancer 1995;76:720–726. 7. Ozato K, Shin DM, Chang TH, et al. TRIM family proteins and their emerging roles in innate immunity. Nat Rev Immunol 2008;8:849–860. 8. Versteeg GA, Rajsbaum R, Sanchez-Aparicio MT, et al. The E3-ligase TRIM family of proteins regulates signaling pathways triggered by innate immune pattern-recognition receptors. Immunity 2013;38:384–398. 9. Nisole S, Stoye JP, Saib A. TRIM family proteins: retroviral restriction and antiviral defence. Nat Rev Microbiol 2005;3:799–808. 10. Klugbauer S, Rabes HM. The transcription coactivator HTIF1 and a related protein are fused to the RET receptor tyrosine kinase in childhood papillary thyroid carcinomas. Oncogene 1999;18:4388–4393. 11. Le Douarin B, Zechel C, Garnier JM, et al. The N-terminal part of TIF1, a putative mediator of the ligand-dependent activation function (AF-2) of nuclear receptors, is fused to B-raf in the oncogenic protein T18. EMBO J 1995;14: 2020–2033. 12. Goddard AD, Borrow J, Freemont PS, et al. Characterization of a zinc finger gene disrupted by the t(15;17) in acute promyelocytic leukemia. Science 1991;254: 1371–1374. 13. de The H, Lavau C, Marchio A, et al. The PML-RAR alpha fusion mRNA generated by the t(15;17) translocation in acute promyelocytic leukemia encodes a functionally altered RAR. Cell 1991;66:675–684. 14. Kakizuka A, Miller WH Jr, Umesono K, et al. Chromosomal translocation t(15;17) in human acute promyelocytic leukemia fuses RAR alpha with a novel putative transcription factor, PML. Cell 1991;66:663–674. 15. Hatakeyama S. TRIM proteins and cancer. Nat Rev Cancer 2011;11:792–804. 16. Valiyeva F, Jiang F, Elmaadawi A, et al. Characterization of the oncogenic activity of the novel TRIM59 gene
BASIC AND TRANSLATIONAL AT
quantification of TRIM59 in gastric biopsy by q-PCR, immunoblot, or immunostaining could be used in combination with pathologic examination to predict biological behaviors of the gastric cancer. The molecular–pathologic diagnosis will be useful in personalized treatment optimization. It is important to note that we have shown that TRIM59 promotes gastric tumorigenesis through down-regulation of P53 protein abundance and suppression of P53 downstream signals. It was predicted that TRIM59 might function in the SV40/Tag/pRB/P53 pathway based on differential microarray analysis.16 However, the hypothesis and the underlying molecular mechanisms have never been investigated before. We show evidence in this study that although a full rescue is not observed, P53 significantly attenuates the tumor-promoting effect of TRIM59. We believe that P53 is at least partially responsible for the function of TRIM59 in gastric tumorigenesis, but we do not exclude other targets of TRIM59 in this intricate biological process. We show in this study that TRIM59 physically binds to P53 and enhances the ubiquitination of P53. TRIM59 overexpression leads to a significant decrease of P53 protein half-life whereas TRIM59 gene silencing by shRNA results in prolonged stability of P53. Human homolog of MDM2 is a well-known E3 ubiquitin ligase that promotes P53 degradation.19,20 Our data suggest that MDM2 contributes to the regulatory role of TRIM59 on P53 ubiquitination. Whether TRIM59 possesses E3 ligase activity for P53 in vivo and works synergistically with MDM2 will be interesting to explore in the future. Besides TRIM59, several other proteins from the TRIM family including TRIM28, TRIM29, and TRIM31 were identified as overexpressed in gastric cancers.21–24 Interestingly, TRIM29 promotes cancer cell proliferation through its inhibitory effect on nuclear activities of P53. Unlike TRIM59, TRIM29 lacks the RING finger domain and represses P53 activity by preventing the nuclear import of P53.25 It also has been shown that the binding and deacetylation of TRIM29 by HDAC9 impairs the association between TRIM29 and P53.26 In contrast, the mechanisms by which TRIM28 and TRIM31 influence gastric tumorigenesis have not been explored to date. Therefore, multiple TRIM family proteins may be involved in the regulation of P53 signals but function through distinct mechanisms. In conclusion, our study has shown the biological and clinical significance of TRIM59 in gastric cancer. TRIM59 exerts an inhibitory effect on P53 and its downstream signals, thereby promoting tumor growth and progression. It has been proven by different research groups that restoration of P53 function leads to marked regression of established lymphomas, sarcomas, and liver carcinomas in vivo.27–29 Re-expression of wild-type P53 attenuates tumor growth in mice carrying the p53R172H mutation, although it does not accomplish full tumor regression.30 Pharmaceutical intervention in the interaction between Trim59 and P53 may provide a promising strategy to reactivate P53 signaling in gastric cancer patients with wildtype P53.
TRIM59 Is a Novel Proto-Oncogene 1053
1054 Zhou et al
17.
18. 19. 20.
21.
22.
23.
24.
25. BASIC AND TRANSLATIONAL AT
26.
27.
28.
in mouse cancer models. Mol Cancer Ther 2011;10: 1229–1240. Matozaki T, Sakamoto C, Suzuki T, et al. p53 gene mutations in human gastric cancer: wild-type p53 but not mutant p53 suppresses growth of human gastric cancer cells. Cancer Res 1992;52:4335–4341. Polyak K, Xia Y, Zweier JL, et al. A model for p53induced apoptosis. Nature 1997;389:300–305. Haupt Y, Maya R, Kazaz A, et al. Mdm2 promotes the rapid degradation of p53. Nature 1997;387:296–299. Honda R, Tanaka H, Yasuda H. Oncoprotein MDM2 is a ubiquitin ligase E3 for tumor suppressor p53. FEBS Lett 1997;420:25–27. Sugiura T. The cellular level of TRIM31, an RBCC protein overexpressed in gastric cancer, is regulated by multiple mechanisms including the ubiquitin-proteasome system. Cell Biol Int 2011;35:657–661. Kosaka Y, Inoue H, Ohmachi T, et al. Tripartite motifcontaining 29 (TRIM29) is a novel marker for lymph node metastasis in gastric cancer. Ann Surg Oncol 2007; 14:2543–2549. Yokoe T, Toiyama Y, Okugawa Y, et al. KAP1 is associated with peritoneal carcinomatosis in gastric cancer. Ann Surg Oncol 2010;17:821–828. Sugiura T, Miyamoto K. Characterization of TRIM31, upregulated in gastric adenocarcinoma, as a novel RBCC protein. J Cell Biochem 2008;105:1081–1091. Yuan Z, Villagra A, Peng L, et al. The ATDC (TRIM29) protein binds p53 and antagonizes p53-mediated functions. Mol Cell Biol 2010;30:3004–3015. Yuan Z, Peng L, Radhakrishnan R, et al. Histone deacetylase 9 (HDAC9) regulates the functions of the ATDC (TRIM29) protein. J Biol Chem 2010;285:39329–39338. Ventura A, Kirsch DG, McLaughlin ME, et al. Restoration of p53 function leads to tumour regression in vivo. Nature 2007;445:661–665. Christophorou MA, Ringshausen I, Finch AJ, et al. The pathological response to DNA damage does not contribute to p53-mediated tumour suppression. Nature 2006;443:214–217.
Gastroenterology Vol. 147, No. 5 29. Xue W, Zender L, Miething C, et al. Senescence and tumour clearance is triggered by p53 restoration in murine liver carcinomas. Nature 2007;445:656–660. 30. Wang Y, Suh YA, Fuller MY, et al. Restoring expression of wild-type p53 suppresses tumor growth but does not cause tumor regression in mice with a p53 missense mutation. J Clin Invest 2011;121:893–904. 31. D’Errico M, de Rinaldis E, Blasi MF, et al. Genomewide expression profile of sporadic gastric cancers with microsatellite instability. Eur J Cancer 2009;45: 461–469. 32. Wang Q, Wen YG, Li DP, et al. Upregulated INHBA expression is associated with poor survival in gastric cancer. Med Oncol 2012;29:77–83.
Author names in bold designate shared co-first authors. Received October 28, 2013. Accepted July 15, 2014. Reprint requests Address requests for reprints to: Dr Wei-Qiang Gao or Dr Helen He Zhu, State Key Laboratory of Oncogenes and Related Genes, Renji-Med X Clinical Stem Cell Research Center, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, 160 Pujian Rd, Shanghai, 200127 China. e-mail: [email protected] or [email protected]; fax: (86) 2168383916. Acknowledgments The authors thank Dr Jim W. Xuan for his helpful discussion and support, Connie New for her critical reading of the manuscript, and Yan Han for technical assistance of the statistical analysis. Conflicts of interest The authors disclose no conflicts. Funding Supported by funds from the Ministry of Science and Technology of the People’s Republic of China (2012CB966800 and 2013CB945600), the National Natural Science Foundation of China (81130038 and 81372189), Science and Technology Commission of Shanghai Municipality (Pujiang Program), Shanghai Health Bureau Key Disciplines and Specialties Foundation, Shanghai Education Committee Key Discipline and Specialties Foundation (J50208), and the KC Wong foundation (W.-Q.G.); and by the National Natural Science Foundation of China (81270627), Science and Technology Commission of Shanghai Municipality (Pujiang Program 12PJ1406100), and the Shanghai Education Committee (Chenguang program 12CG16, 13YZ030, and the young investigator program) (H.H.Z.).
