Protein Expression and Purification 104 (2014) 71–84

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep

Trigger factor assisted folding of the recombinant epoxide hydrolases identified from C. pelagibacter and S. nassauensis Priya Saini a, Shadil Ibrahim Wani a, Ranjai Kumar a, Ravneet Chhabra a, Swapandeep Singh Chimni b, Dipti Sareen a,⇑ a b

Department of Biochemistry, Panjab University, Sector 14, Chandigarh 160 014, India Department of Chemistry, Guru Nanak Dev University, Amritsar 143 005, Punjab, India

a r t i c l e

i n f o

Article history: Received 1 July 2014 and in revised form 4 September 2014 Available online 16 September 2014 Keywords: Epoxide hydrolase Candidatus pelagibacter ubique Stackebrandtia nassauensis Chaperones Trigger factor Solubility

a b s t r a c t Epoxide hydrolases (EHs), are enantioselective enzymes as they catalyze the kinetic resolution of racemic epoxides into the corresponding enantiopure vicinal diols, which are useful precursors in the synthesis of chiral pharmaceutical compounds. Here, we have identified and cloned two putative epoxide hydrolase genes (cpeh and sneh) from marine bacteria, Candidatus pelagibacter ubique and terrestrial bacteria, Stackebrandtia nassauensis, respectively and overexpressed them in pET28a vector in Escherichia coli BL21(DE3). The CPEH protein (42 kDa) was found to be overexpressed as inactive inclusion bodies while SNEH protein (40 kDa) was found to form soluble aggregates. In this study, the recombinant CPEH was successfully transformed from insoluble aggregates to the soluble and functionally active form, using pCold TF vector, though with low EH activity. To prevent the soluble aggregate formation of SNEH, it was co-expressed with GroEL/ES chaperone and was also fused with trigger factor (TF) chaperone at its N-terminus. The TF chaperone-assisted correct folding of SNEH led to a purified active EH with a specific activity of 3.85 lmol/min/mg. The pure enzyme was further used to biocatalyze the hydrolysis of 10 mM benzyl glycidyl ether (BGE) and a-methyl styrene oxide (MSO) with an enantiomeric excess of the product (eep) of 86% and 73% in 30 and 15 min, respectively. In conclusion, this is the first report about the heterologous expression of epoxide hydrolases using TF as a molecular chaperone in pCold TF expression vector, resulting in remarkable increase in the solubility and activity of the otherwise improperly folded recombinant epoxide hydrolases. Ó 2014 Elsevier Inc. All rights reserved.

Introduction Epoxide hydrolases (EHs1: EC 3.3.2.x) belong to a/b hydrolase fold family [1] and catalyze the hydrolytic conversion of epoxides into corresponding enantiopure vicinal diols, which are useful in the synthesis of chiral pharmaceutical drugs [2–5]. Since, chemical methods are limited in their applications for the synthesis of chiral molecules, therefore biocatalyst like EH, being an

⇑ Corresponding author. Tel.: +91 172 2534131x4133, mobile: +91 9876425470; fax: +91 172 2541022. E-mail addresses: [email protected] (P. Saini), [email protected] (S.I. Wani), [email protected] (R. Kumar), [email protected] (R. Chhabra), [email protected] (S.S. Chimni), [email protected] (D. Sareen). 1 Abbreviations used: EH, epoxide hydrolase; TF, trigger factor; LB, Luria–Bertani; CFE, cell free extract; NBP, 4-(4-nitrobenzyl) pyridine; Ni–NTA, nickel nitrilotriacetic acid; MW, molecular weight; PPIase, peptidyl-prolyl isomerase; BGE, benzyl glycidyl ether; BPD, benzyloxy propane diol; MSO, a-methyl styrene oxide; MPED, a-methyl phenyl ethane diol; SO, styrene oxide; PED, phenyl ethane diol; eep, enantiomeric excess of the product. http://dx.doi.org/10.1016/j.pep.2014.09.004 1046-5928/Ó 2014 Elsevier Inc. All rights reserved.

enantio- and regio-selective enzyme, has drawn much attention in the past few years [6]. EHs are also co-factor independent and ubiquitously found enzymes [7,8]. Microbial EHs are increasingly recognized as highly versatile biocatalysts due to their abundance, high enantioselectivity, efficiency and easy scale up [9]. Therefore, the discovery and utilization of epoxide hydrolases from microorganisms is of great interest. In this study, we have identified epoxide hydrolase encoding genes from marine (Candidatus pelagibacter ubique HTCC 1062 {cpeh}) and terrestrial bacteria (Stackebrandtia nassauensis DSM 4478 {sneh}), using microbial genome database mining approach [10,11]. The open reading frames of both cpeh and sneh (locus tag SAR11_0803 and Snans_6199, respectively) were found to be annotated as a/b hydrolase fold proteins, but their biochemical function was unknown. Their phylogenetic analysis showed that cpeh belongs to microsomal EH class and sneh belongs to soluble EHs. In an earlier study, we have successfully overexpressed and characterized a soluble epoxide hydrolase from Cupriavidus metallidurans CH34 (cmeh), which was identified using the similar bioinformatic

72

P. Saini et al. / Protein Expression and Purification 104 (2014) 71–84

Table 1 The chaperone combinations used for co-expression. Combination

Vector name

Chaperone gene

Antibiotics

Molecular weight of chaperones (kDa)

3 4

pBB528 + pBB541 pBB540 + pBB542

C+S C+S

8

pBB540 + pBB550 + pBB572

–

pKY206

groESL dnaK, dnaJ, grpE, clpB, groEL/ES (high conc.) ibpAB, dnaK, dnaJ, grpE, clpB, groEL/ES groEL/GroES

GroES (10.4), GroEL (58.3) dnaK (69.1), dna J (40), grpE (21.8), clpB (100), GroES (10.4), GroEL (58.3) IbpAB (16), dnaK (69.1), dnaJ (40), grpE (21.8), clpB (100), GroES (10.4), GroEL (58.3) GroES (10.4) , GroEL (58.3)

C+S+A T

Antibiotics: Chloramphenicol (C), Spectinomycin (S), Ampicillin (A), Tetracycline (T) [24,38].

approach [12]. C. pelagibacter ubique grows in a low nutrient medium and is one of the most abundant organisms in the ocean. It is a Gram negative proteobacteria originally isolated from the Oregon coast and has an optimum growth temperature of 16 °C [13], while S. nassauensis is an aerobic, Gram positive, mesophilic actinomycete originally isolated from roadside soil sample in Nassau, Bahamas [14]. The putative EHs, cpeh and sneh were then cloned and overexpressed in the heterologous host, Escherichia coli. Both the overexpressed proteins either led to inclusion bodies (CPEH) or soluble aggregates (SNEH). Protein misfolding is the major problem encountered when overexpressing recombinant genes in E. coli [15], which is the most commonly used expression host [16]. The CPEH was found to be completely inactive as insoluble aggregates, while a low epoxide hydrolase activity was detected in the soluble aggregates of SNEH. In order to solubilize [17] the recombinant protein CPEH and to prevent soluble aggregate formation of SNEH in E. coli, we followed two approaches. First was to co-express folding modulators [18], such as, chaperone combinations 3, 4, 8 and pKY206 (Table 1) with CPEH and SNEH proteins. Using the chaperone combination 3 as the folding modulator, CPEH was still found to be incorporated within the GroEL/ES chaperone cage on Ni-affinity purification, indicating the inability of the chaperones to release the improperly folded and thus inactive protein. In case of SNEH protein, although the co-expressed pKY206 prevented the soluble aggregation to some extent, but with little improvement in the specific activity of the purified protein. In our second approach, both the recombinant proteins CPEH and SNEH, were expressed with trigger factor (TF) fused to their N-terminus in pCold TF vector, resulting in TF-CPEH and TF-SNEH fusion proteins. The TF fusion led to 35-fold improvement in the specific activity of purified TF-SNEH in comparison to the SNEH expressed in the soluble aggregate form without any chaperone.

Materials and methods Microbial strains, plasmids, enzymes and reagents Genomic DNA of C. pelagibacter ubique HTCC 1062 was procured from Dr. Stephen Giovannoni, Department of Microbiology, Oregon State University, Corvallis, OR 97331, USA. The mesophilic actinomycete S. nassauensis DSM 44728 was obtained from United States Department of Agriculture (USDA), Agricultural Research Service (ARS, NRRL) Culture Collection. The strains and plasmids used in this study are listed in Table 2. The E. coli strains DH10B and BL21(DE3) were grown in Luria–Bertani (LB) medium. The media and antibiotics were purchased from Himedia (India). Restriction enzymes were obtained from New England Biolabs (USA) and Fermentas Life Sciences (Thermo Fisher Scientific, USA). The chemicals used were of analytical grade purchased from Sigma–Aldrich (USA), Merck (USA) or Bio-Rad (USA). Epoxides and diols used in the study were from Sigma–Aldrich.

BLAST search of microbial genome database Using BLAST program, the putative epoxide hydrolase (EH) genes were searched from the genome database of the two respective microbes, at the website www.ncbi.nlm.nih.gov [12]. The selected sequence hits were manually screened for the presence of conserved motifs, HGXP and GXSmXS/T, catalytic triad residues (Asp-His-Asp) and two ring opening tyrosines. Multiple sequence alignment of the identified putative EHs with the reported epoxide hydrolases was performed using the CLUSTAL W program to find the bit score [19]. The resulting putative EHs having locus tag SAR11_0803 of C. pelagibacter ubique HTCC 1062 and Snans_6199 of S. nassauensis DSM 44728, were selected. The phylogenetic tree of both the gene sequences was constructed and analyzed using the MEGA 6 software [20]. PCR amplification of the genes The cpeh gene from the genomic DNA of C. pelagibacter ubique was PCR amplified using the forward primer 50 ATGGCTAGCATGAT TAAGCCTTTTAAATTAGATATTCCCG30 and reverse primer 50 GC GAAGCTTCTATCGTACAGATCTTGAAAAC30 , containing the restriction sites NheI and HindIII, respectively. Nucleotide sequences bold and underlined indicate the restriction sites. The PCR amplification of 1143 bp cpeh gene was done using the PCR program as follows: 3 min at 94 °C, 30 s at 94 °C, 30 s at 55 °C, 2 min at 68 °C and final extension step for 10 min at 72 °C. S. nassauensis was grown in 5 ml of N-Z-Amine-medium containing glucose (1% w/v), soluble starch (2% w/v), yeast extract (0.5% w/v), N-Z-Amine (0.5% w/v) and CaCO3 (0.1% w/v), pH 7.2 for 48 h at 28 °C. The genomic DNA of S. nassauensis was isolated using the standard protocol [12] and 891 bp of sneh gene was amplified by PCR using the forward primer 50 GGAAT TCGTGACGGGAACCGTCGTTTCCGC30 and reverse primer 50 G GCAAGCTTTCAGTGGGATTCCAGGTGAGCCTG30 containing restriction sites EcoRI and HindIII, respectively which are bold and underlined. PCR amplification of the sneh gene was done using the PCR program: 4 min at 94 °C, 45 s at 94 °C, 40 s at 59 °C, 1 min at 72 °C and final extension step of 10 min at 72 °C. DNA manipulation PCR amplified fragments were eluted from the agarose gel after electrophoresis by Fermentas gel extraction kit and plasmids were isolated using Fermentas plasmid isolation kit as recommended by the manufacturer’s protocol. Restriction digestion and ligation was done using standard procedures [21]. PCR amplified cpeh gene fragment could not be properly restriction digested, probably due to short overhangs. Therefore, cpeh (having ‘‘A’’ overhang with Taq polymerase activity) was first ligated with pTZ57R/T cloning vector (having ‘‘T’’ overhang) generating pTZcpeh and transformed into E. coli DH10B (cloning host) by following standard chemical transformation protocol [21]. The

P. Saini et al. / Protein Expression and Purification 104 (2014) 71–84

73

Table 2 The strains and plasmids used in this study. Description E. coli DH10B

E. coli BL21(DE3) Plasmids pTZ57R/T pET28a(+) pCold TF pBB528 pBB541 pBB540 pBB542 pBB550 pBB572 pKY206

Contents

Source



F endA 1 recA 1 galE15 galK16 nupG rpsL DlacX74 U80lacZDM15 araD139D (ara, leu)7697 mcrA D(mrr-hsdRMS-mcrBC)kFOmpT hsdSB (rBmB) gal dcm (DE3)

Invitrogen (USA)

Novagen (Germany)

Phage f1 origin, LacZa-peptide, Ampr marker, T7 promoter f1 origin of replication, kanr, T7 promoter, His tag ColE1 origin, Ampr, temperature controllable cspA promoter CmR, lacIQ, pSC101 ori SpecR, PA1/lacO-1, p15A ori, groESL CmR, PA1/lacO-1, pSC101 ori, clpB, grpE SpecR, p15A ori, PA1/lacO-1, groESL, dnaK, dnaJ SpecR, PA1/lacO-1, lac, lac IQ, p15A ori, groESL, dnaK, dnaJ AmpR/CmR, PA1/lacO-1, IbpA/B p15A ori, Tetr, groEL/ES expressed constitutively

recombinant clones were selected by blue/white screening on ampicillin (100 lg/ml) containing LB plates. The pTZcpeh as well as the pET28a expression vector were both digested with NheI/BamHI enzymes (HindIII site of reverse primer was not utilized because there is another site of HindIII in multiple cloning site of pTZ57R/T vector). The gel purified cpeh gene insert was ligated to pET28a to form pET28a-cpeh construct, which was transformed into E. coli DH10B. The recombinant clones were selected on kanamycin (40 lg/ml) plates and the presence of insert was checked by digestion of the recombinant clones with NheI/ BamHI restriction enzymes. After confirmation of the insert, the recombinant vector pET28a-cpeh was transformed into the expression host E. coli BL21(DE3). The presence of correct frame was verified by sequencing the coding region of His6-tagged cpeh using the Bigdye terminator cycle sequencing kit version 3.1 (Applied Biosystems, USA). Similarly, PCR amplified and gel purified sneh gene was ligated to pET28a after digesting both with EcoRI/HindIII to form pET28asneh construct and transformed in E. coli BL21(DE3). pET28a-sneh was also subjected to sequencing as described above. Expression of pET28a-cpeh and pET28a-sneh in E. coli For the gene expression analysis, an inoculum was prepared by transferring a single colony from a freshly streaked plate of each of the two recombinant clones into a 5 ml LB broth with kanamycin (40 lg/ml) at 37 °C. One percent inoculum of the overnight grown culture was transferred into 50 ml LB medium, supplemented with kanamycin (40 lg/ml). The cultures were grown at 37 °C at 200 rpm until OD600 was 0.4–0.6 and then induced with 0.005, 0.02 and 0.1 mM IPTG (to be optimized) at 20 °C for 18 h at 200 rpm. Cells were harvested at 8000 rpm for 10 min at 4 °C and washed with the binding buffer (50 mM Tris–HCl: CPEH; sodium-phosphate buffer: SNEH, pH 7.5 and 1 mM DTT). 20% (w/v) cell suspension (0.5 g in 3 ml binding buffer) was made and cells were disrupted by sonication, in an ice-bath with a Vibra-Cell sonicator (Sonics & Materials, Inc.), 3–4 cycles; 30 s On, 30 s Off. The sonicated cells were centrifuged at 13,000 rpm for 25 min at 4 °C to separate out the cell free extract (CFE) and the cell pellet, followed by analysis on 12.5% SDS–PAGE [22]. EH activity analysis was done on the CFE and pellet fractions by 4-(4-nitrobenzyl) pyridine (NBP) assay [12]. Purification of SNEH As CPEH was found to form inclusion bodies, therefore it was decided to purify the recombinant SNEH. Purification of SNEH

Fermentas Life Sciences (USA) Novagen (Germany) TaKaRa (Japan) From Professor Bukau, University of Heidelberg, Germany. ’’ ’’ ’’ ’’ ’’ From Professor Yasushi Kawata, Department of Biotechnology, Tottori University, Japan

was done from one liter culture (6.6 g cells) after inducing the cells at 18 °C using 0.1 mM IPTG for 18 h. The cells were then harvested, washed and resuspended in binding buffer to make 20% (w/v) suspension and sonicated. The CFE obtained from the sonicated cells, was applied to the nickel nitrilotriacetic acid (Ni–NTA) column preequilibrated with binding buffer. To eliminate the non-specifically bound proteins, resin was washed with wash buffer (binding buffer with 40 mM imidazole) and the protein of interest was eluted by linear gradient of 40–500 mM imidazole on an AKTA Prime Plus FPLC (GE Healthcare Life Sciences). Eluted SNEH protein fractions of 1 ml corresponding to the two peaks obtained were collected, run on SDS–PAGE and EH activity was analyzed. The active fractions of the two peaks were pooled separately (Pool I and Pool II) and then desalted using PD-10 column (GE Healthcare) according to instructions given in the user manual. The desalted SNEH protein was concentrated by Amicon Ultra-4 10 kDa MWCO filter (Millipore). Protein concentration was determined by Bradford method [23] using the Bio-Rad protein assay kit with BSA as standard. 10.8 mg of thus purified SNEH in pool I and 7.5 mg of pool II in 500 ll was then loaded onto the gel filtration column (HiPrep 16/60 Sephacryl S-300 HR) (GE Healthcare Life Sciences). To determine the native molecular weight (MW) of the proteins eluted in two separate peaks, the gel filtration column attached to AKTA prime plus FPLC system was equilibrated with 2 column volumes of 25 mM sodium phosphate buffer, 150 mM NaCl, pH 7.5. Void volume (Vo) of the column was first determined by calibrating the column with blue dextran (2000 kDa) at a flow rate of 0.5 ml/ min and then standard proteins of known MW (3–4 mg) were run at the same flow rate. The calibration proteins used were alcohol dehydrogenase (150 kDa), bovine serum albumin (66 kDa) and lysozyme (14.4 kDa). The eluted protein fractions in a single peak were subjected to activity analysis, followed by SDS–PAGE and native gradient PAGE analysis. Molecular mass of SNEH was determined from the semi-logarithmic plot of the MW of calibration proteins against their Kav [Kav = (Ve  Vo)/(Vt  Vo), where Kav = partition coefficient, Ve = elution volume, Vo = void volume and Vt = total volume].

Chaperone co-expression with CPEH and SNEH In order to prevent inclusion bodies formation and to solubilize CPEH, it was co-expressed with different chaperone combinations i.e., 3, 4 and 8 (Table 1), which encode for inducible chaperones and pKY206, which encodes for the constitutive GroEL/ES chaperone (Table 1). The pET28a-sneh was however, co-expressed only with pKY206, to see if it prevents soluble aggregate formation. pKY206 plasmid is 7.4 kb in size and its large size might be the reason for

74

P. Saini et al. / Protein Expression and Purification 104 (2014) 71–84

the difficulty in transforming it with usual chemical method of transformation. So, it was electroporated into the BL21(DE3) cells containing pET28a-cpeh and pET28a-sneh. For overexpression, the recombinant cells with different chaperone combinations were grown separately, at 37 °C in 50 ml LB broth with respective antibiotics and induced with IPTG at 20 °C in a shaker until OD600 was 0.4–0.6. Here an additional step was undertaken, for proper folding of overexpressed CPEH and disaggregation of the protein aggregates [24]. After 18 h of induction, grown cells were harvested, resuspended in the same amount of LB broth, supplemented with 200 lg/ml chloroamphenicol and kept at 20 °C for 2 more hours with shaking thereby inhibiting protein synthesis and to further improve the solubility of recombinant proteins. This allows chaperone-assisted folding in the absence of ongoing protein biosynthesis, and prevents the continuous generation of aggregationprone proteins [25]. The cells were then harvested, washed and resuspended in binding buffer to make a 20% (w/v) suspension, sonicated and overexpression of CPEH was analyzed on SDS–PAGE. The EH activity analysis was also carried out on all samples. Purification of chaperone co-expressed CPEH The CFE was mixed with 10 mM MgCl2 and 5 mM ATP and kept in ice for 30 min as binding of GroES is dependent on the presence of Mg-ATP or Mg-ADP. In the holochaperonin, either all or perhaps half of the GroEL subunits may be in the ADP-bound state. Upon binding a substrate protein, ADP-ATP exchange and subsequent ATP-hydrolysis would occur with conformational changes induced in GroEL, allowing a peptide to be released in a manner productive for folding [26]. Purification of His6-tagged CPEH (7.5 g cells/liter) was performed by step elution on Ni-Sepharose resin (GE Healthcare). The supernatant was applied to the Ni–NTA column (XK 16/20, GE Healthcare) pre-equilibrated with the binding buffer. After washing with 10 column volumes of binding buffer, the resin-bound enzyme was step eluted by applying 5 ml each of elution buffer having different concentrations of imidazole (binding buffer with 50, 100, 200, 300, 400 and 500 mM imidazole). Eluted fractions were analyzed by SDS–PAGE and the active and homogenously pure fractions were pooled. Construction of pCold TF-cpeh and pCold TF-sneh Agarose gel purified cpeh gene, excised from pET28a-cpeh by NdeI/EcoRI enzymes, was ligated to similarly digested pCold TF vector. The ligation mixture was transformed into DH10B and selected on LB plates containing ampicillin (100 lg/ml). After insert size confirmation, one of the recombinant plasmids (pCold TF-cpeh) was transformed into E. coli BL21(DE3) and recombinant clones were selected on LB ampicillin plates. A single isolated colony of pCold TF-cpeh/BL21(DE3) was inoculated in 5 ml LB broth supplemented with ampicillin, and grown overnight at 37 °C. One percent inoculum was transferred to 50 ml of the same medium and induced at 15 °C with 0.01 mM IPTG for 24 h. After cell lysis, the CFE was analyzed for gene expression by SDS–PAGE and activity analysis. The recombinant EH protein, expressed in BL21(DE3) from pCold TF-cpeh, was designated as TF-CPEH. Similarly, sneh was ligated to pCold TF vector to construct pCold TF-sneh in E. coli BL21(DE3) and the recombinant protein (TF-SNEH) was expressed at 0.1 mM IPTG. Purification of TF-CPEH and TF-SNEH The fusion proteins i.e., His6-tagged TF-CPEH (from 4 g cells/ liter culture) and TF-SNEH (from 5 g cells/liter culture) were similarly purified on Ni-Sepharose resin, as described earlier. The protein purity was analyzed by SDS–PAGE and the enzyme activity

was determined by NBP assay. The active fractions having higher purity were pooled and buffer exchange was done using PD-10 desalting columns. Characterization of CPEH and SNEH NBP assay The colorimetric NBP assay was done with different epoxide substrates to analyze the presence of EH activity [12]. The assay is based on the formation of blue dye between an epoxide and NBP [27]. EH activity analysis with the epoxides 1–6 (Fig. 9) was performed using the recombinant whole cells (20 mg) and purified enzyme (50 lg of each of CPEH and SNEH), separately. [28]. Epoxides (5 mM) dissolved in ethanol/dimethyl sulfoxide were reacted with whole cells and purified enzymes in buffer [50 mM Tris–HCl (CPEH)/25 mM sodium-phosphate buffer (SNEH), pH 7.5] in 250 ll final reaction volume (with 5% ethanol/dimethyl sulfoxide final concentration), made with double distilled water along with blanks (having no substrate) and controls (having no enzyme). The reaction vials were pre-incubated at 37 °C for 10 min, before the addition of the substrate. After incubation, substrate was added and the vials were kept at 37 °C for 1 h (whole cells) and 20 min (purified enzyme). Thereafter, the vials were centrifuged at 10,000 rpm for 5 min and 200 ll supernatant was transferred to fresh 1.5 ml vials containing 650 ll double distilled water. This was followed by the addition of 50 ll of 50 mM NBP (dissolved in 2-methoxyethanol) and sealed tightly with tape. These vials were then subjected to heating in a water-bath pre-set at 80 °C for 20 min, followed by chilling for 5 min. 100 ll triethylamine:acetone (1:1) was added in each of the vials and the substrate consumption was measured at 600 nm by UV–Visible spectrophotometer (Shimadzu, Japan) [12]. One unit (U) is the amount of enzyme that catalyzes the hydrolysis of 1 lmol of the substrate per minute. All the assays were carried out 3 times and each time in triplicates. Enantioselective analysis of TF-SNEH Enantiomeric excess (ee) of the purified and desalted TF-SNEH was determined with epoxides 1, 5 and 7 using chiral HPLC (Shimadzu) based assay. The EH reaction (250 ll) was initiated by the addition of purified TF-SNEH dissolved in 50 mM phosphate buffer, pH 7.5 (with 5 mM epoxide 1 and 10 mM epoxides 5 and 7) at 37 °C according to the conditions as described in Table 6. The reaction products were vortexed and extracted with diethyl ether (3  500 ll) by shaking for 5 min. The organic and aqueous phases were separated by centrifugation at 10,000 rpm for 5 min. The upper organic phase was transferred to fresh 1.5 ml vial and dried over sodium sulfate (anhydrous) and allowed to evaporate at room temperature to obtain the resulting residue [28]. The dried residues were reconstituted in 400 ll mobile phase and filtered through 0.22 lm filter (Millipore), before loading onto the Chiralcel OD-H column (Daicel) for enantioselective analysis. Retention time (tR) of R and S-benzyl glycidyl ether (BGE); 10.22 and 10.70 min, R and S-benzyloxy propane diol (BPD); 28.02 and 33.86 min, mobile phase 93:7 (hexane:isopropanol), flow rate 0.5 ml/min, k = 254 nm, R and S-a-methyl styrene oxide (MSO); 6.27 and 6.76 min, R and S-a-methyl phenyl ethane diol (MPED); 14.44 and 16.72 min, mobile phase 97:3 (hexane:isopropanol), flow rate 1 ml/min, k = 254 nm, R and S-styrene oxide (SO); 17.86 and 18.92 min; R and S-phenyl ethane diol (PED); 43.57 and 48.12 min, mobile phase 95:5 (hexane: isopropanol), flow rate 0.3 ml/min, k = 218 nm, respectively. Enantiomeric excess (ee) was calculated from the corresponding diols of the two enantiomers [eep(%) = (R  S)/(R + S)  100] [12].

P. Saini et al. / Protein Expression and Purification 104 (2014) 71–84

Results and discussion Bioinformatic analysis of putative EH genes Due to advancement in bioinformatics, a significant progress has been made in the discovery of novel biocatalysts. This became possible due to a massive amount of information on microbial whole genome sequences, deposited in the public databases such as NCBI (www.ncbi.nlm.nih.gov), TIGR (www.tigr.org) and Sanger (www.sanger.ac.uk). Most of the enzymes annotated in these genome databases are not functionally confirmed, so they represent new treasures of uncharacterized biocatalysts [11]. The genomes of C. pelagibacter ubique HTCC 1062 and S. nassauensis DSM 44278, were screened for the presence of putative epoxide hydrolases (SAR11_0803 and Snas_6199, respectively). The presence of conserved residues and motifs [10] such as two ring opening tyrosines [Y231, Y301 (cpeh) and Y168, Y222 (sneh)], HGXP motif, catalytic triad residues (nucleophile-histidine-acid) Asp176-His358-Glu331 (cpeh)/Asp121-His275-Asp246 (sneh) and Sm-X-Nu-Sm-Sm (Sm = small residue, X = any residue and Nu = nucleophile) (Fig. 1) indicated that the encoded enzymes might exhibit similar epoxide-opening biocatalytic mechanism, as that of the other functional EHs. Their CLUSTAL W alignment showed that cpeh had 35% identity with an active epoxide hydrolase, EEH1 of Erythobacter litoralis HTCC2594 [29] and sneh showed 31% identity with CMEH of C. metallidurans CH34 [12]. Phylogenetic analysis CPEH The cpeh gene has an open reading frame of 1143 bp (G + C content of 33.9%) that encodes a 380-amino acid CPEH protein (GenBank Accession No. YP_266224) with a theoretical MW of 43.8 kDa (ProtParam). To investigate the evolutionary relationship of the epoxide hydrolase identified in this work with other reported EHs, phylogenetic analysis was performed. The analysis suggested that CPEH belongs to microsomal epoxide hydrolases (Fig. 2) which contain an extra stretch of 58–60 amino acid sequence at the N-terminus and possess glutamate (E) as the acid residue in the catalytic triad, instead of aspartate. SNEH The sneh gene has an open reading frame of 891 bp, encoding a 296 amino acid residue protein (GenBank Accession No. YP_003514915.1), with a theoretical MW of 32.05 kDa (ProtParam). The phylogenetic analysis showed that SNEH protein belongs to soluble epoxide hydrolases with Asp (D) as the acidic residue with no extra stretch of N-terminal residues (Fig. 2). Cloning, heterologous expression and Purification of recombinant EH proteins DNA fragments encoding the putative epoxide hydrolase genes were PCR amplified from C. pelagibacter ubique and S. nassauensis, cloned in frame with an N-terminal His6-tag in the expression vector pET28a and heterologously expressed in E. coli BL21(DE3), under the control of T7 promoter. E. coli BL21(DE3) was used as the host for T7 vector encoded recombinant protein expression as it is deficient in the Lon and Omp T proteases. The recombinant plasmids used and generated in this work are listed in Table 3. CPEH The induction of CPEH protein was optimized for inducer concentration and the post-induction growth temperature. However, no enzymatic activity was detected in any of the tested conditions

75

with SO (data not shown). The SDS–PAGE analysis of the CFE of the recombinant cells revealed that overexpressed CPEH was associated with the insoluble cellular fraction as inclusion bodies, even at the low post-induction temperature of 20 °C (Fig. S1). Chaperone cocktail assisted folding of CPEH The overexpression of the recombinant protein sometimes lead to protein misfolding and aggregate formation. These problems can be due to limitations in the chaperone capacity of the host cells [24] and due to the metabolic burden in response to the overexpression by IPTG. Molecular chaperones prevent aggregation of the recombinant proteins by binding to the exposed hydrophobic moieties in unfolded, partially folded or misfolded polypeptides and traffic molecules to their sub-cellular destination. While there are numerous examples in literature, of the use of chaperone coexpression to improve recombinant protein production, there is no universal approach that can be applied to overcome all such folding problems. In the absence of an ability to predict the relevant bottleneck in correct folding of proteins in E. coli, an increasingly common approach followed is the use of chaperone ‘‘cocktails’’, which is facilitated by the availability of a number of plasmid systems that can be used to co-produce up to 6–7 folding modulators along with the heterologous protein [30,31]. The major molecular chaperones involved in protein folding in the E. coli cytoplasm are the peptidylprolyl cis–trans isomerase, molecular chaperone TF, members of the heat shock protein Hsp70 (Dna K, Dna J, Grp E) and Hsp60 families (GroEL and GroES), in addition to ClpB that disaggregates polypeptide aggregates and the small heat shock proteins, IbpA and IbpB. GroEL/ES co-production is used to properly fold the proteins while DnaK-DnaJ-GrpE leads to improved solubilization of the protein [32]. E. coli IbpA and IbpB have been demonstrated to protect misfolded proteins from irreversible aggregation and are thought to help in resolubilizing protein aggregates [33–35]. TF is a prokaryotic ribosome-associated chaperone protein, which facilitates co-translational folding of newly expressed polypeptides [36]. To promote native folding of the overexpressed protein, recombinant CPEH was co-expressed with various chaperone combinations. SDS–PAGE analysis of cellular proteins of the chaperone co-expressed supernatant and pellet fractions, revealed the presence of substantial amount of CPEH protein in the soluble fractions (Fig. 3). The CPEH, when expressed in the presence of pKY206 and the combination 4 and 8, was found to be more soluble (also in comparison with its pellet fraction) than CPEH with combination 3, as judged from the intensity of protein bands. However, the EH activity analysis with SO by NBP assay revealed that CPEH, when co-expressed with combination 3 only, showed some noticeable activity (Table 4) while CPEH with combination 4, 8 and pKY206 was present as an inactive enzyme and thus, we were motivated to further purify the CPEH protein co-expressed with chaperone combination 3 only. The CPEH was purified by Ni–NTA affinity chromatography, using step elution method. During various purification attempts, it was observed on SDS–PAGE that chaperone GroEL/ES was also being eluted with the target protein CPEH, during elution with imidazole (Fig. 4A). Thus, to separate the GroEL-CPEH complex so as to get only the pure CPEH, the lysis buffer and the washing buffer were supplemented with 5 mM ATP and 10 mM MgCl2. It is known that GroEL/ES require ATP and Mg2+ [37–40] that leads to the decrease in the affinity of GroEL/ES-CPEH polypeptide complex thus resulting in the release of CPEH. In this way, partially purified CPEH was obtained at 200 mM imidazole (Fig. 4B). However, enzyme activity analysis of this purified enzyme with different epoxides showed that it was active, but barely only with epichlorohydrin (Table 4). Therefore, a further improvement in CPEH folding was surely required, in

76

P. Saini et al. / Protein Expression and Purification 104 (2014) 71–84

Fig. 1. Multiple sequence alignment of genes encoding CPEH and SNEH. Conserved motifs HGXP, GXSmXS/T, both tyrosines and catalytic triad are shown in green color. Accession numbers from NCBI are given for the organisms. Npueh-Nostoc punctiforme (ZP_00108314; 29% identity with SNEH), EEH3–Erythrobacter litoralis HTCC2594 (YP_458350; 26% identity with SNEH), Bsueh-Bacillus subtilis [NP_388739; 29% identity with SNEH], Draeh-Deinococcus radiodurans [AAF12090; 30% identity with SNEH], CMEH-Cupriavidus metallidurans CH34 [YP_583993; 31% identity with SNEH], SNEH-Stackebrandtia nassauensis DSM 44728 [YP_003514915; this paper], CPEH-Candidatus pelagibacter ubique [YP_266224; this paper], Ephx1-Rattus norvegicus [P07687; 33% identity with CPEH], EEH1-Erythrobacter litoralis HTCC2594 [YP_457985; 35% identity with CPEH], EPH1-Rhodotorula glutinis [AAF64646; 30% identity with CPEH], MtuEph-Mycobacterium tuberculosis H37Rv [CAB07040; 21% identity with SNEH], AraEchAAgrobacterium radiobacter AD1 [CAA73331; 20% identity with SNEH]. (⁄) the residues in that column are identical in all sequences in the alignment, (:) conservative substitutions and (.) semi-conservative substitutions.

P. Saini et al. / Protein Expression and Purification 104 (2014) 71–84

77

Fig. 1 (continued)

Fig. 2. Phylogenetic analysis of CPEH and SNEH. Neighbor joining method using software MEGA 6. Bootstrap values (%) are indicated at the nodes. The scale bars represent 0.2 substitutions per site. The NCBI accession numbers used in the analysis are shown in parentheses after the species name.

78

P. Saini et al. / Protein Expression and Purification 104 (2014) 71–84

Table 3 Plasmid vectors and recombinant proteins (with molecular weight) used and generated in this work. Plasmid vector pET28a(+) pCold TF

RecCPEH a

CPEH (42 kDa) TF-CPEHb (90 kDa)

Table 4 EH activity analysis of whole cells bearing recombinant plasmids pET-cpeh and TFcpeh.

RecSNEH a

SNEH (40 kDa) TF-SNEHb (88 kDa)

a

pET28a vector contains linear sequence of (His)6-tag: RecCPEHMGSSHHHHHHSSGLVPRGSHMAS-2.47 kDa RecSNEH-MGSSHHHHHHSSGLVPRG SHMASMTGGQQMGRGSGF-3.77 kDa. b pCold TF vector possess trigger factor (48 kDa) as the N-terminal fusion protein.

order to get higher enzymatic activity. Keeping this in mind, we fused the cpeh gene with TF at its N-terminus, resulting in a fusion protein TF-CPEH.

a b

Co-expressed chaperone combinations with pET-cpeh

Substrates

Activity in whole cellsa (lmol/min)

Combination 3 Combination 4 Combination 8 pKY206 pCold TF-CPEHb

3 1 1 1 1 2 5 4 3 6

0.014 Nil Nil 0.002 0.023 0.030 0.003 0.014 0.015 0.008

20 mg of recombinant cells were used. Fused TF chaperone with CPEH.

Overexpression and purification CPEH pCold TF DNA vector is a fusion cold shock expression vector that expresses trigger factor chaperone as a soluble fusion tag. This vector provides cold shock technology for high yield protein expression, combined with TF to facilitate correct protein folding, thus enabling efficient soluble protein production for otherwise intractable target proteins, at lowered incubation temperatures. TF is a 48 kDa prokaryotic ribosome-associated chaperone protein which, because of its origin from E. coli, is highly expressed in E. coli expression systems like BL21(DE3), used in this study [36]. In the presence of TF and the cold shock promoter cspA, the expression of target protein CPEH with increased solubility was achieved at lowered incubation temperatures with an improvement in activity of TF-CPEH with epoxides– SO and p-chloro SO (Table 4). SDS– PAGE analysis of the recombinant cells showed that approximately 80% TF-CPEH (90 kDa) was in the soluble fraction (Fig. 5B). The fusion protein was further purified by His-tag mediated Niaffinity chromatography via linear gradient elution (Fig. 5A). Purified TF-CPEH peak fractions were run on SDS–PAGE which reflected that protein of earlier fractions showed an overexpressed protein band of 90 kDa along with few other host proteins (Fig. 5B). However, purity level of the protein was more in the later fractions (eluted with 305 mM imidazole; Fig. 5C). The presence of TF-CPEH protein in flow-through and wash-through fractions, as was visible in the gel, suggested weak binding of the protein to Ni–NTA resin. This might be due to some protein species of TFCPEH, present in the CFE in aggregate form, in which hexa-Histag has been masked or not properly exposed, to bind to the

Ni-Sepharose resin. The solubilized TF-CPEH was purified successfully, but the enzyme was found to have low EH activity (data not shown). SNEH Similarly, the cloned sneh was analyzed for its expression in pET28a/BL21(DE3). An enhanced expression of 40 kDa protein was observed in the CFE soluble fraction (Fig. 6B), with an EH activity of 0.083 lmol/min/mg with SO. The recombinant SNEH was further purified from the CFE and to our surprise, two peaks were observed in the protein elution profile: first peak eluted at 286 mM imidazole and the second peak at 363 mM imidazole (Fig. 6A). The SDS–PAGE analysis of the fractions from both the peaks showed an overexpressed protein of the same size (40 kDa SNEH; Fig. 6B). The active protein fractions of the first peak (peak I) and that of the second peak (peak II) were separately pooled and concentrated. A concentrated sample each from pooled peak I and II, was run through the gel filtration column. The chromatogram obtained showed the protein in peak I getting eluted at 86.6 ml (Fig. 7A), which suggests that peak I is that of the native monomeric form of SNEH with 51.4 kDa MW. The sample from peak II, however eluted at 40.7 ml (Fig. 7B) which is equal to void volume of blue dextran, indicating that it is a multimer. Hence, it was inferred that SNEH protein exists in two conformations: one is monomeric form and the second is its multimeric form. This result was further confirmed by native gradient PAGE (4–20%) analysis of the peak fractions of the two peaks (I and II) obtained from the Ni–NTA column. Peak II revealed variable size soluble aggregates (Fig. 7C; Lane 5) in the native gradient gel while Peak I had a single overexpressed

Fig. 3. SDS–PAGE of the cell lysates harboring recombinant pET28a-cpeh with chaperone combinations 3, 4 and 8. Lane 1: induced sup (IS) 3; Lane 2: uninduced sup (US) 3; Lane 3: induced sup 4; Lane 4: uninduced sup 4; Lane 5: induced sup 8; Lane 6: uninduced sup 8; lane 7: induced pellet (IP) 8; Lane 8: uninduced pellet (UP) 8; M- protein marker; Lane 9: induced pellet 4; Lane10: uninduced pellet 4; Lane11: induced Pellet 3; Lane 12: uninduced pellet 3. The protein band of 42 kDa CPEH protein is indicated by an arrow.

P. Saini et al. / Protein Expression and Purification 104 (2014) 71–84

79

Fig. 4. Purification analysis of CPEH with combination 3 chaperone. (A) M: protein marker; Lane 1: pellet; Lane 2: supernatant; Lane 3: flow-through; Lane 4–7: purified fractions with 50, 100, 200 and 300 mM imidazole. (B) Purification of CPEH (MgCl2-ATP treated) by step elution on Ni-NTA acid column. Lane 1: pellet; Lane 2: sup; Lane 3: flow-through; Lane 4: wash-through; Lane 5 and 6: 50 mM imidazole eluted fraction; Lane 7 and 8: 100 mM eluted fraction; Lane 9: 200 mM eluted fraction; M: protein marker. The protein band of 42 kDa CPEH protein is indicated by an arrow.

Fig. 5. Affinity purification profile and SDS–PAGE analysis of TF-CPEH. (A) The chromatogram showing single peak of purified TF-CPEH eluted from the Ni–NTA column (at 275–375 mM imidazole). (B) SDS–PAGE of purified TF-CPEH fractions. M: protein marker; Lane 1: pellet; Lane 2: supernatant; Lane 3: flow-through; Lane 4: wash-through; Lane 5–9: purified fractions from 38 to 42 ml. (C) M: protein marker; Lane 1–9: purified fractions 43–50 ml. The protein band of 90 kDa TF-CPEH protein is indicated by an arrow.

band (Fig. 7C; Lane 4) indicating the monomeric conformation of the SNEH. However, the specific EH activity of the enzyme in peak I was 0.11 lmol/min/mg and in peak II, it was 0.084 lmol/min/mg, which evidently could not be improved with Ni-affinity purification vis-a-vis the supernatant (0.083 lmol/min/mg). Hence, it was concluded that the low specific activity of SNEH obtained, even after affinity purification was due to the soluble aggregates formation, as the protein was probably not being folded properly on overexpression, which was also confirmed by native gradient PAGE.

Prevention of aggregation by GroEL/ES co-expression To prevent the soluble aggregates formation, SNEH was coexpressed with pKY206 (harboring E. coli chaperones GroEL/ES) and induced with 0.1 mM IPTG. When subjected to purification by immobilized metal affinity chromatography, SNEH was found to be eluted in a single peak only at 356 mM imidazole. The EH specific activity of the thus purified protein was 0.303 lmol/min/ mg, with only 2.75-fold improvement in the specific activity of SNEH, when compared to the purified SNEH without co-expressed

80

P. Saini et al. / Protein Expression and Purification 104 (2014) 71–84

Fig. 6. Purification profile of the SNEH and analysis of fractions on SDS–PAGE. (A) Protein elution profile of SNEH and (B) Analysis of purified fractions by SDS–PAGE. Lane 1: pellet; Lane 2: supernatant; Lane 3: flow-through; Lane 4: wash-through; M: protein marker; Lane 5 and 6: Ni-affinity fractions at 52 and 55 ml of peak I; Lane 7–9: fractions obtained at 66, 68 and 83 ml of peak II. The protein band of 40 kDa SNEH protein is indicated by an arrow.

GroEL/ES chaperone (i.e., 0.11 lmol/min/mg). Thus, it was inferred that GroEL/ES chaperone co-expression was an helpful aid to correctly fold the misfolded aggregates of SNEH, into the native active conformation.

TF mediated enhancement in enzyme activity To see whether the trigger factor chaperone can improve protein folding and enzyme activity, the sneh gene was further subcloned in pCold TF vector and was expressed as TF-SNEH fusion protein in E. coli BL21(DE3). The CFE of the recombinant cells had a specific EH activity of 0.25 lmol/min/mg. When subjected to Ni-affinity purification, the protein eluted in a single peak at 170 mM imidazole (Fig. 8A) and had a subunit MW of 88 kDa (Fig. 8B and C). With an EH specific activity of 2.09 lmol/min/ mg, the His6-tagged TF-SNEH was purified to 8.4-fold in a single step. After desalting, a purification fold of 15.4 was achieved, thus yielding 5.6 mg of the purified protein per liter of the culture, with an EH activity of 3.85 lmol/min/mg (Table 5). In comparison to the purified EH in the soluble aggregate form (0.11 lmol/min/mg) without any chaperone, we could achieve an enhancement of 35fold in the specific activity of the purified SNEH fused to TF chaperone. The low level of enzyme expression on TF-fusion can be attributed to the overall low protein expression at a lower growth temperature of 15 °C, which was used for the induction of cold shock promoter in the pCold TF vector.

In fact, trigger factor is the first chaperone that the newly synthesized polypeptides encounter when they emerge from the ribosomal exit tunnel [41]. The bacterial ribosome-associated chaperone TF, binds to the nascent chains and associates with ribosomes in a 1:1 stoichiometry [42]. Structurally, TF is comprised of three domains: the N-terminal domain, which binds to the ribosome; the P domain, responsible for its peptidyl-prolyl isomerase (PPIase) activity; and the C-terminal domain, required and sufficient for its chaperone activity. It has been shown to assist folding in two ways: by protecting nascent chains with long hydrophobic stretches during synthesis and initial folding stages, and by accelerating peptidyl-prolyl cis–trans isomerization [41]. A specific binding site is used for binding of TF to the large ribosomal subunit, consisting of a highly conserved ‘‘Gly-Phe-Arg-x-Gly-x-x-Pro’’ motif present near the N-terminus of numerous homologues [42] and these 8 residues form a ‘‘trigger signature’’ or ‘‘signature motif’’ that is involved in ribosomal binding. TF having PPIase activity binds the ribosome at proteins L23/L29 near the polypeptide exit site [43,44] and it covers the exit of the tunnel to protect nascent chains from degradation and a hydrophobic cradle is also created so that the translated protein can partially or entirely fold [45,46]. As the nascent polypeptide grows, TF molecules remain temporarily attached to its hydrophobic patches and as one TF molecule leaves from the ribosome, another TF is recruited in its place and thus, it supports productive de novo folding by shielding nascent polypeptides on the ribosome thereby preventing untimely degradation or aggregation processes. Thus, it operates at

P. Saini et al. / Protein Expression and Purification 104 (2014) 71–84

81

Fig. 7. Gel-filtration profiles and native gradient PAGE analysis of purified SNEH. (A) and (B) Sephacryl S-300 HR gel filtration profiles of separately pooled peak I and peak II fractions, respectively that had eluted from Ni-affinity column. The estimated MW of the Peak I protein was found to be 51.4 kDa. (C) Native gradient PAGE analysis of SNEH purified fractions. M: native protein marker: apoferritin band I-720 kDa, apoferritin band II-480 kDa, B-phycoerythin-242 kDa, lactate dehydrogenase-146 kDa, bovine serum albumin-66 kDa, soybean trypsin inhibitor-20 kDa; Lane 1: pooled and concentrated gel-filtration fractions 37–48 ml of peak II shown in Fig. 7(B); Lane 2 and 3: gel-filtration fractions at 41 and 42 ml of peak II (without concentrating); Lane 4: fraction at 52 ml of the peak I eluted from Ni-affinity column and Lane 5: fraction at 66 ml of the peak II eluted from Ni-affinity column (shown in Fig. 6A). In (C) Lane 1, a light protein band was observed near 66 kDa marker and in Lane 2 and 3, no protein band was visible at all, as large aggregates could not enter the gradient gel, and are thus visible just next to the wells.

several levels: it protects the nascent chains from digestion by proteases [47], prevents misfolding by reducing the speed of folding until translation completes [48], cooperates with other chaperones like DnaK-DnaJ-GrpE (referred to as KJE) and GroEL/ES which assist in further folding steps to the native state [49,50], facilitates proteolysis of aggregate-prone conformations, and efficiently catalyzes peptidyl-prolyl cis–trans isomerization. Unlike the other bacterial chaperone systems, TF functions independently of ATP, and its expression is not modulated by the heat shock response system, but instead it is amplified upon cold shock. Chaperones like DnaK/J and GroEL/ES protect against folding defects, at higher temperatures and are therefore, upregulated as a part of heat shock response. TF expression shows temperature dependence which is inverse from that of most other chaperones.

Its expression at low temperature enhances the protein stability and solubility. pCold TF DNA vectors [36] are derived from the pUC18 vector that employ the cspA promoter, cspA5 and cspA3 UTR to facilitate high level expression at 15 °C. It also expresses the ribosome-associated chaperone TF as a soluble tag. CspA is the major E. coli cold-shock protein, whose activity is essential for acclimatization of E. coli to cold temperatures [51,52]. CspA acts as a RNA chaperone that unfolds secondary structures. When an E. coli culture is transferred from normal growth temperature (37 °C) to cold shock conditions (15 °C), mRNA translation of most proteins is blocked because the cells lack cold-inducible ribosomal factors that they need for formation of the translation initiation complex [53,54] . But, CspA mRNA does not need these factors and is readily translated at cold temperatures. Cold shock

82

P. Saini et al. / Protein Expression and Purification 104 (2014) 71–84

Fig. 8. TF-SNEH purification profile. (A) Chromatogram of Ni-NTA affinity purification of TF-SNEH fusion protein. (B) Analysis of purified fractions by SDS–PAGE. M: protein marker; Sup: supernatant; FT: flow-through; WT 1: wash-through 1; WT 2: wash-through 2; Lane 1–4: pooled fractions from 38 to 41 ml; (C) M: protein marker; Lane 1–6: pooled fractions from 42 to 47 ml. The protein band of 88 kDa TF-SNEH protein is indicated by an arrow.

Table 5 Purification table of overexpressed TF-SNEH by Ni-affinity chromatography. Protein

Total Total activity U protein (mg) (lmol/ min)

Specific activity (lmol/min/ mg)

Yield Purification (%) fold

Supernatant Ni–NTA fractions Pool Buffer exchange (desalting)

32.8 24.5

131 11.7

0.25 2.09

100 75

1 8.5

21.6

5.6

3.85

66

15.4

a cold shock promoter. The fusion protein was overly expressed as a dominant soluble protein at 16 °C in the oxidative cytoplasm of Origami B cells, where formation of the disulfide bonds is favored. Through a series of chromatography steps, the ANTXR2 ectodomain was purified to homogeneity [57]. Thus, trigger factor fusion led to the correct folding and hence production of soluble and functional eukaryotic ANTXR2 protein in the prokaryotic host E. coli, that too with multiple disulphide bonds.

EH activity analysis of TF-SNEH expression allows selective induction of protein synthesis at 15 °C, where protease activity is decreased and synthesis of cellular proteins is suppressed [55]. There are some examples in literature where pcold TF has been used for the soluble expression of recombinant proteins. Inclusion bodies of the membrane proteins, such as the HA protein of the 2009 influenza H1N1 virus was found to be produced with incorrect folding, using the bacterial system and required denaturation and renaturation before further use. On using pCold TF vector, when the HA protein was expressed at low temperature (18 °C), it led to correct folding of the recombinant protein. The recombinant TF-HA1 and TF-HA2 fusion proteins were thus expressed in soluble form successfully in E. coli BL21(DE3) for further use [56]. Also, in a very recent study, the ectodomain of anthrax toxin receptor 2 (ANTXR2), required for toxin pore formation and membrane translocation, was fused to the trigger factor under the control of

The activity analysis of purified TF-SNEH was done with various epoxides 1, 5 and 7 (Fig. 9). It was found that the diols of 5, 7 and 1 were formed in significant amounts with 70%, 36% and 80% conver-

Fig. 9. Epoxide substrates used in this study. (1) Styrene oxide; (2) p-Chlorostyrene oxide; (3) Epichlorohydrin; (4) Phenyl glycidyl ether; (5) Benzyl glycidyl ether; (6) Butyl glycidyl ether and (7) a-Methyl styrene oxide.

P. Saini et al. / Protein Expression and Purification 104 (2014) 71–84 Table 6 Enantioselective analysis of TF-SNEH.

83

Contributions

Substrates

Reaction Conversion eep Absolute Enzyme (%) Concentration time (%) configuration (min) (lg) (R/S)

Benzyl glycidyl ether (5) a-Methyl styrene oxide (7) Styrene oxide (1)

30

30

70

86

S

30

15

36

73

R

15

10

80

15

S

sion, respectively, that resulted in the production of enantiopure diols (S-benzyloxy propane diol, R-a-phenyl ethane diol and S-phenyl ethane diol) with 86%, 73% and 15% eep, respectively (Figs. S2– S4; Table 6). Vicinal diols, derived from glycidyl ethers, are also key building blocks for the synthesis of pharmaceuticals; e.g., (S)-aryl oxy diols are the intermediates for the synthesis of an expectorant, guaifenesin; for a muscle relaxant, mephenesin and an antifungal agent, such as clorphene [58,59]. There are only a few studies found in literature, where BGE has been resolved either by the EH possessing bacterial whole cells [28] or by the purified recombinant enzyme [60]. After media optimization of the Bacillus alcalophilus whole cells, the maximum ee for BGE obtained was 30% and that of its diol (R-BPD) was 40%, in a reaction time of 24 h. We have been able to achieve 86% eep for BPD in only 30 min reaction time by employing 30 lg of TF-SNEH. This result clearly shows the potential of the recombinant enzyme for the production of enantiopure S-BPD. A recent report of recombinant purified EH from Agromyces mediolanus describes 99% ee obtained for BGE which is the only other example found wherein a bulky aromatic ring of BGE has been enantioselectively hydrolyzed by the cloned, overexpressed and purified enzyme 0. Another substrate MSO, that was hydrolyzed by this enzyme with 73% eep bears a strong potential as a chiral building block in the synthesis of a-aryl propionic acid derivatives, which constitute the major class of non-steroidal antiinflammatory drugs i.e., ibuprofen and naproxen [61]. The remarkable improvement in EH activity and enantioselectivity clearly demonstrated the correct folding of the SNEH achieved only through trigger factor chaperone fusion, proving this putative a/b hydrolase to be a functional epoxide hydrolase. The current results are being used as a ‘proof of principle’ and the preparative scale purification of TF-SNEH is being taken up further to have a higher yield so as to carry out the biotransformation experiments with the above two epoxides, after the removal of TF from its N-terminus.

Conclusions This is the first report about the heterologous expression of two novel epoxide hydrolases using trigger factor as a molecular chaperone in pCold TF expression vector, resulting in remarkable increase in the solubility of the recombinant enzymes. TF was used as a fusion tag and aided in the protein folding, leading to the correct native and functional conformation of the recombinant EH proteins as TF-CPEH and TF-SNEH. The fusion protein TF-SNEH showed 35-fold specific activity enhancement on purification in comparison to that purified without any chaperone, with a yield of 66%. The enantioselectivity analysis of this purified enzyme revealed that it had an eep of 86% and 73% with the epoxides, BGE and MSO, respectively.

Competing interests The authors declare that they have no competing interests.

S.I.W. carried out the molecular genetic experiments and enzymatic analysis and R.C. assisted in the enzymatic analysis. R.K. made substantial contributions to conception and design and acquisition of data and analysis and interpretation of data. P.S. participated in the data analysis, interpretation and drafted the manuscript. D.S. conceived the study, revised the manuscript critically for important intellectual content and has given the final approval of the version to be published. S.S.C. participated and coordinated in certain experimental designs and HPLC sample analysis. All authors read and approved the final manuscript. Acknowledgments The authors thank Dr. Stephen Giovannoni for the genomic DNA of C. pelagibacter ubique HTCC 1062. We are thankful to United States Department of Agriculture (USDA) for sending the culture S. nassauensis DSM 44728. We would like to thank Professor Bukau for providing the chaperone combinations and Professor Yasushi Kawata for giving us pKY206. We also acknowledge Dr. Abhay Pandey for letting us use the native gradient PAGE facility at NIPER. The present work was financially supported by Department of Biotechnology (DBT) via Grant No. BT/PR/4694/PID/6/633/2012, Government of India, New Delhi. One of the authors (P.S.) gratefully acknowledges DBT for the Senior Research Fellowship (SRF). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.pep.2014.09.004. References [1] D.L. Ollis, E. Cheah, M. Cygler, B. Dijkstra, F. Frolow, S.M. Franken, M. Harel, S.J. Remington, I. Silman, J. Schrag, J.L. Sussman, K.H.G. Verscchueren, The a/b hydrolase fold, Protein Eng. 5 (1992) 197–211. [2] R. Rink, M. Fennema, M. Smids, U. Dehmel, D.B. Janssen, Primary structure and catalytic mechanism of the epoxide hydrolase from primary structure and catalytic mechanism of the epoxide hydrolase from Agrobacterium radiobacter AD1, J. Biol. Chem. 272 (1997) 14650–14657. [3] A.J. Fretland, C.J. Omiecinski, Epoxide hydrolases: biochemistry and molecular biology, Chem. Biol. Interact. 129 (2000) 41–59. [4] M. Widersten, A. Gurell, D. Lindberg, Structure–function relationships of epoxide hydrolases and their potential use in biocatalysis, Biochim. Biophys. Acta 2010 (1800) 316–326. [5] C. Morisseau, B.D. Hammock, Epoxide hydrolases: mechanisms, inhibitor designs, and biological roles, Annu. Rev. Pharmacol. Toxicol. 45 (2005) 311– 333. [6] W.J. Choi, C.Y. Choi, Production of chiral epoxides: epoxide hydrolasecatalyzed enantioselective hydrolysis, Biotechnol. Bioprocess Eng. 10 (2005) 167–179. [7] M. Arand, D.F. Grant, J.K. Beetham, T. Friedberg, F. Oesch, B.D. Hammock, Sequence similarity of mammalian epoxide hydrolases to the bacterial haloalkane dehalogenase and other related proteins. Implication for the potential catalytic mechanism of enzymatic epoxide hydrolysis, FEBS Lett. 338 (1994) 251–256. [8] A. Archelas, R. Furstoss, Synthetic applications of epoxide hydrolases, Curr. Opin. Chem. Biol. 5 (2001) 112–119. [9] C.M. Clouthier, J.N. Pelletier, Expanding the organic toolbox: a guide to integrating biocatalysis in synthesis, Chem. Soc. Rev. 41 (2012) 1585–1605. [10] V.B. Loo, J. Kingma, M. Arand, M.G. Wubbolts, D.B. Janssen, Diversity and biocatalytic potential of epoxide hydrolases identified by genome analysis, Appl. Environ. Microbiol. 72 (2006) 2905–2917. [11] M. Singh, D. Sareen, Novel LanT associated lantibiotic clusters identified by genome database mining, PLoS One 9 (2014) e91352. [12] R. Kumar, S.I. Wani, N.S. Chauhan, R. Sharma, D. Sareen, Cloning and characterization of an epoxide hydrolase from Cupriavidus metalliduransCH34, Protein Expr. Purif. 79 (2011) 49–59. [13] S.J. Giovannoni, H.J. Tripp, S. Givan, M. Podar, K.L. Vergin, D. Baptista, L. Bibbs, J. Eads, T.H. Richardson, M. Noordewier, M.S. Rappé, J.M. Short, J.C. Carrington, E.J. Mathur, Genome streamlining in a cosmopolitan oceanic bacterium, Science 309 (2005) 1242–1245. [14] C. Munk, A. Lapidus, A. Copeland, M. Jando, S. Mayilraj, T.G.D. Rio, M. Nolan, F. Chen, S. Lucas, H. Tice, J.-F. Chang, C. Han, J.C. Detter, D. Bruce, L. Goodwin, P.

84

[15]

[16]

[17] [18]

[19]

[20]

[21] [22] [23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

P. Saini et al. / Protein Expression and Purification 104 (2014) 71–84 Chain, S. Pitluck, M. Goker, G. Ovchinikova, A. Pati, N. Ivanova, K. Mavromatis, A. Chen, K. Palaniappan, M. Land, L. Hauser, Y.-J. Chang, C.D. Jeffries, J. Bristow, J.A. Eisen, V. Markowitz, P. Hugenholtz, N.C. Kyrpides, H.P. Klenk, Complete genome sequence of Stackebrandtia nassauensis type strain (LLR-40K-21T), Stand. Genomic Sci. 1 (2009) 292–299. E. García-fruitós, N. González-montalbán, M. Morell, A. Vera, R.M. Ferraz, A. Arís, S. Ventura, A. Villaverde, Aggregation as bacterial inclusion bodies does not imply inactivation of enzymes and fluorescent proteins, Microb. Cell Fact. 4 (2005) 27. Y. Wang, Y.-H.P. Zhang, Overexpression and simple purification of the Thermotoga maritima 6-phosphogluconate dehydrogenase in Escherichia coli and its application for NADPH regeneration, Microb. Cell Fact. 8 (2009) 30. H.P. Sørensen, K.K. Mortensen, Soluble expression of recombinant proteins in the cytoplasm of Escherichia coli, Microb. Cell Fact. 4 (2005) 1. F. Baneyx, J.L. Palumbo, Improving heterologous protein folding via molecular chaperone and foldase co-expression, Methods Mol. Biol. 205 (2003) 171–197. J.D. Thompson, D.G. Higgins, T.J. Gibson, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice, Nucleic Acids Res. 22 (1994) 4673–4680. K. Tamura, G. Stecher, D. Peterson, A. Filipski, S. Kumar, MEGA6: molecular evolutionary genetics analysis version 6.0, Mol. Biol. Evol. 30 (2013) 2725– 2729. J. Sambrook, D.W. Russell, Molecular Cloning: A Laboratory Manual, fourth ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2012. U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. A. de Marco, Protocol for preparing proteins with improved solubility by coexpressing with molecular chaperones in Escherichia coli, Nat. Protoc. 2 (2007) 2632–2639. A. de Marco, E. Deuerling, A. Mogk, T. Tomoyasu, B. Bukau, Chaperone-based procedure to increase yields of soluble recombinant proteins produced in E. coli, BMC Biotechnol. 7 (2007) 32. T. Langer, G. Pfeifer, J. Martin, W. Baumeister, F.-U. Hartl, Chaperoninmediated protein folding: GroES binds to one end of the GroEL cylinder, which accommodates the protein substrate within its central cavity, EMBO J. 11 (1992) 4757–4765. F. Zocher, M.M. Enzelberger, U.T. Bornscheuer, B. Hauer, R.D. Schmid, A colorimetric assay suitable for screening epoxide hydrolase activity, Anal. Chim. Acta 391 (1999) 345–351. N. Bala, K. Kaur, S.S. Chimni, H.S. Saini, S.S. Kanwar, Bioresolution of benzyl glycidyl ether using whole cells of Bacillus alcalophilus, J. Basic Microbiol. 52 (2012) 383–389. J.-H. Woo, Y.-O. Hwang, S.G. Kang, H.S. Lee, J.-C. Cho, S.-J. Kim, Cloning and characterization of three epoxide hydrolases from a marine bacterium, Erythobacter litoralis HTCC2594, Appl. Microbiol. Biotechnol. 76 (2007) 365– 375. A. De Marco, V. De Marco, Bacteria co-transformed with recombinant proteins and chaperones cloned in independent plasmids are suitable for expression tuning, J. Biotechnol. 109 (2004) 45–52. M. Schlapschy, S. Grimm, A. Skerra, A system for concomitant overexpression of four periplasmic folding catalysts to improve secretory protein production in Escherichia coli, Protein Eng. Des. Sel. 19 (2006) 385–390. Y. Xu, C. Weng, N. Narayanan, M.-Y. Hsieh, W.A. Anderson, J.M. Scharer, M. Moo-Young, C.P. Chou, Chaperone-mediated folding and maturation of the penicillin acylase precursor in the cytoplasm of Escherichia coli, Appl. Environ. Microbiol. 71 (2005) 6247–6253. A. Mogk, E. Deuerling, S. Vorderwülbecke, E. Vierling, B. Bukau, Small heat shock proteins, ClpB and the DnaK system form a functional triade in reversing protein aggregation, Mol. Microbiol. 50 (2003) 585–595. _ J. Narkiewicz, J. Kwiatkowska, B. D. Kuczyn´ska-wis´nik, D. Zurawa-janicka, Lipin´ska, E. Laskowska, Escherichia coli small heat shock proteins IbpA/B enhance activity of enzymes sequestered in inclusion bodies, Acta Biochim. Pol. 51 (2004) 925–931. W. Jiao, M. Qian, P. Li, L. Zhao, Z. Chang, The essential role of the flexible termini in the temperature-responsiveness of the oligomeric state and chaperone-like activity for the polydisperse small heat shock protein IbpB from Escherichia coli, J. Mol. Biol. 347 (2005) 871–884. Bioview Takara Bioeurope edition (http://www.takarabioeurope.com/pdf/hd/ BV28.pdf).

[37] R.E. Joseph, A.H. Andreotti, Bacterial expression and purification of interleukin2 tyrosine kinase: single step separation of the chaperonin impurity, Protein Expr. Purif. 60 (2008) 194–197. [38] A. Thain, K. Gatson, O. Jenkins, A.R. Clarke, A method for the separation of GST fusion proteins from co-purifying GroEL, Trends Genet. 12 (1996) 209–210. [39] S. Vorderwu, G. Kramer, F. Merz, T.A. Kurz, T. Rauch, B. Zachmann-brand, B. Bukau, E. Deurling, Low temperature or GroEL/ES overproduction permits growth of Escherichia coli cells lacking trigger factor and DnaK, FEBS Lett. 559 (2004) 181–187. [40] B.-W. Ying, H. Taguchi, M. Kondo, T. Ueda, Co-translational involvement of the chaperonin GroEL in the folding of newly translated polypeptides, J. Biol. Chem. 280 (2005) 12035–12040. [41] C.W.O. Donnell, M. Lis, The Trigger Factor Chaperone, MIT 7.88 Research Paper (2006). [42] L. Ferbitz, T. Maier, H. Patzelt, B. Bukau, E. Deuerling, N. Ban, Trigger factor in complex with the ribosome forms a molecular cradle for nascent proteins, Nature 431 (2004) 590–596. [43] G. Kramer, T. Rauch, W. Rist, S. Vorderwülbecke, H. Patzelt, A. SchulzeSpecking, N. Ban, E. Deuereling, B. Bukau, L23 protein functions as a chaperone docking site on the ribosome, Nature 419 (2002) 171–174. [44] R. Lill, E. Crooke, B. Guthie, W. Wickner, The ‘‘trigger factor cycle’’ includes ribosomes, presecretory proteins, and the plasma membrane, Cell 54 (1988) 1013–1018. [45] Q.A. Valent, D.A. Kendall, S. High, R. Kusters, B. Oudega, J. Luirink, Early events in preprotein recognition in E. coli: interaction of SRP and trigger factor with nascent polypeptides, EMBO J. 14 (1995) 5494–5505. [46] T. Hesterkamp, S. Hauser, H. Lutcke, B. Bukau, Escherichia coli trigger factor is a prolyl isomerase that associates with nascent polypeptide chains, Proc. Natl. Acad. Sci. U.S.A. 93 (1996) 4437–4441. [47] A. Hoffmann, M. Frieder, A. Rutkowska, B. Zachmann-brand, E. Deuerling, B. Bukau, Trigger factor forms a protective shield for nascent polypeptides at the ribosome, J. Biol. Chem. 281 (2006) 6539–6545. [48] V.R. Agashe, S. Guha, H. Chang, P. Genevaux, M. Hayer-hartl, M. Stemp, C. Georgopoulos, F.U. Hartl, J.M. Barral, Function of trigger factor and DnaK in multidomain protein folding: increase in yield at the expense of folding speed, Cell 117 (2004) 199–209. [49] B. Bukau, E. Deuerling, C. Pfund, E.A. Craig, Getting newly synthesized proteins into shape, Cell 101 (2000) 119–122. [50] F.U. Hartl, M. Hayer-Hartl, Molecular chaperones in the cytosol: from nascent chain to folded protein, Science 295 (2002) 1852–1858. [51] W. Jiang, Y. Hou, M. Inouye, CspA, the major cold-shock protein of Escherichia coli, is an RNA chaperone, J. Biol. Chem. 272 (1997) 196–202. [52] S. Phadtare, M. Inouye, Genome-wide transcriptional analysis of the cold shock response in wild-type and cold-sensitive, quadruple-csp-deletion strains of Escherichia coli, J. Bacteriol. 186 (2004) 7007–7014. [53] M. Mitta, L. Fang, M. Inouye, Deletion analysis of cspA of Escherichia coli: requirement of the AT-rich UP element for cspA transcription and the downstream box in the coding region for its cold shock induction, Mol. Microbiol. 26 (1997) 321–335. [54] S. Phadtare, M. Inouye, K. Severinov, The nucleic acid melting activity of Escherichia coli CspE is critical for transcription antitermination and cold acclimation of cells, J. Biol. Chem. 277 (2002) 7239–7245. [55] S. Graslund, P. Nordlund, J. Weigelt, B.M. Halberg, J. Bray, O. Gileadi, et al., Protein production and purification, Nat. Methods 5 (2008) 135–146. [56] D. Liu, B. Si, C. Li, Z. Mi, X. An, C. Qin, W. Liu, Y. Tong, Prokaryotic expression and purification of HA1 and HA2 polypeptides for serological analysis of the 2009 pandemic H1N1 influenza virus, J. Virol. Methods 172 (2011) 16–21. [57] P. Jacquez, N. Lei, D. Weigt, C. Xiao, J. Sun, Expression and purification of the functional ectodomain of human anthrax toxin receptor 2 in Escherichia coli Origami B cells with assistance of bacterial trigger factor, Protein Expr. Purif. 95 (2014) 149–155. [58] D. Sareen, R. Kumar, Prospecting for efficient enantioselective epoxide hydrolases, Indian J. Biotechnol. 10 (2011) 161–177. [59] Botes, A. Leonora, L. Michel, L. Jeanette, M.K. Kumar, Methods for obtaining optically active glycidyl ethers and optically active vicinal diols from racemic substrates, Patent Publication No. WO2006109198 (to Oxyrane UK, Ltd). 19 Oct, 2006. [60] F. Xue, Z.-Q. Liu, S.-P. Zou, N.-W. Wan, W.-Y. Zhu, Q. Zhu, Y.-G. Zheng, A novel enantioselective epoxide hydrolase from Agromyces mediolanus ZJB120203: Cloning, characterization and application, Process Biochem. 49 (2014) 409– 417. [61] M. Cleij, A. Archelas, R. Furstoss, Microbiological transformations 43. Epoxide hydrolases as tools for the synthesis of enantiopure a-methylstyrene oxides: a new and efficient synthesis of (S)-ibuprofen, J. Org. Chem. 64 (1999) 5029– 5035.