1024
ANTIGEN TEST RESULTS IN 7 PATIENTS
HCV PCR RESULTS ON RIBA-2 POSITIVE OR INDETERMINATE
DONATIONS
7 patients (167 samples) had positive results on 12 occasions (table). 4 patients were positive on one occasion, 2 were positive twice, and 1 was positive four times. 10 of the 12 positive samples (from 5 of the 7 patients) were retested; all were negative, including 1 sample that was retested within 30 min of the original test. The other samples had been stored at - 30°C for between 72 h and 10 months. 2 of the positive samples were not available for
retesting. Patients 1-3 had no clinical, radiological, or microbiological of aspergillosis. 1 of these patients died from graft-versus-host disease 8 weeks after transplant; the other 2 are well. The positive sample from patient 4 was obtained 6 weeks before BAL and sputum specimens yielded A fumigatus. This patient was treated with liposomal amphotericin B. The 2 positive samples from patient 5 were obtained 1 and 2 weeks after a BAL specimen yielded Afumigatus. Both serum samples proved negative on retesting. This patient was not treated with antifungal drugs and died 35 weeks after transplant; necropsy was not done. Patient 6 died with aspergillosis 2 weeks after the second positive sample was obtained. This sample proved negative on retesting. Patient 7 remains well 18 weeks after his transplant; the only evidence of possible fungal infection was a nasal swab taken 6 weeks after transplant which yielded Afumigatus. In a previous investigation4 the pastorex aspergillus test detected circulating galactomannan in 14 of 15 patients with proven aspergillosis; 54 controls had negative results. Although the test could have detected fungal antigen in several of our patients, the fact that repeat testing gave negative results in all cases leads us to conclude that this test is of limited value in making decisions about the diagnosis of invasive aspergillosis in immunosuppressed
findings suggestive
patients.
Regional Mycology Laboratory and Bone Marrow Transplant Unit, Bristol Royal Infirmary and Bristol Royal Hospital for Sick Children, Bristol BS2 8HW, UK
D. W. WARNOCK A.B.M. FOOT E. M. JOHNSON S. B. MITCHELL J. M. CORNISH A. OAKHILL
1. Bodey GP, Vartivarian S. Aspergillosis. Eur J Clin Microbiol Infect Dis 1989; 8: 413-37
Rogers TR, Haynes KA, Barnes RA. Value of antigen detection m predicting invasive pulmonary aspergillosis. Lancet 1990; 336: 1210-13. 3. Andrews CP, Weiner MH. Aspergillus antigen detection in bronchoalveolar lavage fluid from patients with invasive aspergillosis and aspergillomas. Am J Med 1982; 2.
73: 372-80.
4. Dupont B, Improvisi L, Provost F. Detection de galactomannane dans les aspergilloses mvasives humaines et animales avec un test au latex Bull Soc Fr Mycol Med 1990; 19: 35-42.
HCV confirmatory testing of blood donors SiR,—The introduction of screening of all blood donations in the UK for hepatitis C virus (HCV) antibody has highlighted the problem of confirming results of second-generation ELISAs. As with the first-generation tests, the second-generation ELISA can yield false-positive reactions. The recombinant immunoblot assay (RIBA-2), incorporating four antigens from the HCV genome, provides a method for identifying genuine anti-HCV reactivity. However, it can be "indeterminate", and in our present state of knowledge of HCV infection, such a finding is uninterpretable, making it very difficult to advise a blood donor who has such a
result. We have used the polymerase chain reaction (PCR) to detect HCV RNA and have compared the PCR results from RIBA-2 indeterminate samples with those from RIBA-2 positive samples. 42 498 blood donations from the West of Scotland were screened for HCV antibodies by a second generation ELISA (Abbott). 177 donations (042%) were positive; 169 of these (0-40% of the total) were repeatedly ELISA reactive and were forwarded to the reference laboratory for confirmatory testing by RIBA-2 (Ortho). Of the 169 repeatedly reactive samples 82 (48-5%) were unreactive in the RIBA test so HCV antibody could not be confirmed; 49 (29-0%) were positive and 38 (22-5%) were indeterminate. Plasma from all 87 RIBA indeterminate or positive samples was tested for HCV RNA by PCR with nested primers for the NS3 and 5’-NCR
regions. There was a good correlation between PCR positivity and RIBA positivity (table), only 3 of 49 RIBA-positive donations being negative for HCV RNA. 29 (76%) of RIBA indeterminate donations did not react by PCR; of the 9 that did all but 1 had exhibited a single band to the core protein (c22) in the RIBA-2. The PCR results suggest that almost all RIBA-2 positive donors have chronic HCV infection. The 3 PCR-negative RIBA-2positive donations may reveal evidence of viral RNA on further analysis with different HCV primers-or the donors may have been in a non-viraemic phase of HCV infection, as suggested by previous PCR studies.1 Our results suggest it is important to subject RIBA-2 indeterminate samples routinely to PCR testing, since that might allow definitive identification of chronic HCV infection, permitting counselling of the donor with full assessment of his or her liver disease and treatment if necessary. Scottish National Blood Transfusion Service Microbiology Reference Unit, Regional Virus Laboratory, Ruchill Hospital, Glasgow G20 9NB, UK
Edinburgh and SE Scotland Blood Transfusion Service,
Edinburgh
Glasgow and West of Scotland
E. A. C. FOLLETT B. C. DOW
F. MCOMISH P. LEE YAP
Blood Transfusion Service, Law Hospital, Carluke
W. HUGHES R. MITCHELL
Department of Medical Microbiology, University of Edinburgh
P. SIMMONDS
JA, Tuke PW, Makris M, et al. Demonstration of viraemia patterns in haemophiliacs treated with heparitis-C-virus-contaminated factor VIII concentrates. Lancet 1990; 336: 1022-25.
1. Garson
Transmission of
hepatitis
B via human bite
SIR,-A man presented to this hospital seriously ill with acute hepatitis. He was hepatitis B surface antigen and e antigen positive. The route of infection was unknown. His habits were, according to friends and family, irreproachable. At first we suspected transmission from a member of his family but when we looked for hepatitis B virus (HBV) markers, including HBV-DNA, we found that no member of the family showed any sign of HBV infection. However, it emerged that about 8 weeks earlier the patient had
1025
taken part in a fight to defend a friend. Someone bit his left cheek so badly that when he arrived at hospital a piece of flesh was hanging off. The wound was promptly treated and stitched and it had healed well leaving an oval scar with slight cheloidal reaction around the stitches. We assumed that HBV had been transmitted during the stitching of the wound, because of non-sterile instruments or for some other reason. However, the casualty department register showed that the patient had been the first one to be medicated after all instruments, needle-case included, had been properly sterilised. That left only one possibility, the man who had bitten him. It was not an easy task to find out who that was, but we eventually succeeded and convinced him and his family to be tested for HBV infection. The man turned out to be a chronic carrier of HBV (e antigen positive) and all members of his family showed signs of HBV infection at different stages. All these findings point to HBV transmission in saliva when the patient was bitten by another man during a fight. Infectious Diseases Department,
Ospedale Maggiore, Modica, Ragusa, Italy
C. STORNELLO
lives
near a
small
town
throat, and an erythematous rash over his arms and legs. He had difficulty in eating and drinking and had severe abdominal discomfort with vomiting. He was jaundiced and had bile in the urine. Suspecting Lyme disease, his general practitioner prescribed doxycycline but the patient’s condition did not improve, and when his right knee and left ankle started to swell he was admitted to hospital. a
Musgrove
Park
J. V. S. PETHER N. JONES
Hospital
Viral Diagnosis Group, PHLS Centre for Applied and Research, Porton Down
Microbiology
G. LLOYD
1. Editorial. Hantavirus disease. Lancet 1990; 336: 407-08. 2 Bruno P, Hassell LH, Brown J, et al. The protean manifestations of with renal syndrome. Ann Intern Med 1990; 113: 385-91.
hemorrhagic fever
in north
Somerset felt increasingly weak for 2 weeks. His wife had just recovered from a sore throat with headache and neck stiffness but the three children had been well. In the second week of the patient’s illness he had a high temperature with arthralgia, headache, sore
On examination he had
Public Health Laboratory, Musgrove Park Hospital, Taunton TA1 5DB, UK
Genomic sequences of respiratory syncytial virus in otitis media with effusion
Acute hantavirus infection SIR,-A 42-year-old man who
of the father-in-law. Neither the father-in-law nor the children had been ill. The patient improved steadily and was discharged home. By mid-September he felt well apart from mild pain in one ankle. This may be the first identified case of acute human hantavirus disease in England. The clinical picture is unusua1.2 Viral and epidemiological studies, in conjunction with the Agricultural Development Advisory Service, are in progress to attempt to isolate hantavirus from the family’s neighbourhood. serum
temperature of 38 2°C with
some
lymphadenopathy in the neck. There was jaundice and severe enlargement of liver and spleen. The left hand and left knee were swollen and painful to the touch; his right ankle was very tender and swollen too. There was evidence of what was probably an insect bite on the left elbow. The patient had recently been on holiday in Blackpool but had not been abroad. Laboratory investigations revealed hepatic abnormalities suggestive of an obstructive or infective process. His blood urea rose to 7-5 mmol/1 (and it was still 74 mmol/1 when he was discharged from hospital); his serum creatinine was never higher than 91 [unol/I (normal 60-120); he was anaemic; his white cell count rose from 8-8 to 27.2 x 109/1 (an initial relative lymphocytosis became a neutrophilia); his platelet count was normal, as was a coagulation screen; his plasma viscosity was 224 cp (n = 152-172); C-reactive protein was 119 mg/1. By day 6 there was marked rouleaux formation on the blood film, possibly explained by the high level of IgG. Ultrasound and computed tomographic scans revealed no evidence of hepatic obstruction. (A focus of echogenicity remained unchanged while the patient improved, and may be a capillary haemangioma; this will be followed up.) The patient had many features of infection but no bacterial pathogens were isolated from urine, faeces, or blood; the antistreptolysin 0 titre was negative; there was no evidence of complement-fixing antibodies to influenza A and B viruses, chlamydial antigen, Q fever antigen, Mycoplasma pneumoniae, not
respiratory syncytial virus, or cytomegalovirus. Leptospira antibodies were negative and a serological test for Borrelia burgdorferi infection was also negative. There was no serological evidence of hydatid, liverfluke, or amoebic infection. However, blood taken on hospital day 2 had an immunofluorescence titre of 128 with an IgM titre of 64 to hantavirus strains.’ A later specimen of blood showed the antibody level to be rising, and samples from the rest of the household demonstrated antibody in two out of the three children and an IgG and IgM response to the virus in the
SIR,—Otitis media
with etiusion is the most common cause ot
acquired hearing loss in young children, and if it persists permanent sensorineural hearing impairment may ensue. However, the mechanism for the disease remains to be defined. Respiratory syncytial virus (RSV) is a common cause of respiratory tract disease in childhood, and it is the most common virus to be isolated from the nasopharynx in otitis media.’ However, isolation of RSV from otitis media with effusion has reverse
not
been very successful. We used the
transcriptase polymerase chain reaction (RT-PCR) and
nested PCR to detect RSV sequences in this condition. Effusion fluids were collected from 12 children, aged 3-7 years, with otitis media. This was done in the period February to April, 1991. RNA was isolated2 and 4 ng was used for RT-PCR and nested PCR. Details ofcDNA synthesis and of PCR reaction mixtures and conditions are obtainable from Y. O. For PCR specific primers were synthesised on a model 391 ’PCR-Mate’ (Applied Biosystems) using RNA sequences published by Collins et all Sequences expressing the F glycoprotein of RSV were chosen as the target. The primer sequences showed no significant homology with other genes, according to Genbank and the European Molecular Biology Laboratory. Inner primers for nested PCR were prepared similarly. Primer sequences were: RT-PCR (lst PCR, product size 391 bp) 5’: GGTGTTGGATCTGCAATCGCCA 3’:AACTTTTTCTGATCATTTGT
Nested PCR (2nd PCR, product size 207bp) 5’: AAGTGCTCTACTATCCACA 3’:CACTAAATTCCCTGGTAATC
A discrete band was detected after RT-PCR of RNA from RSV-infected Hep-2 cells but not from mumps-virus-infected Vero cells or parainfluenza-I-virus infected GM-K cells, used as
Fig 1-RT-PCR. Lane 1 = marker (X174/Haelll digest), lanes 2-5= RSV strains B1, A, B2, and long; lane 6 = paramfluenza virus type 1, lane 7= mumps virus.
ANTIGEN TEST RESULTS IN 7 PATIENTS
HCV PCR RESULTS ON RIBA-2 POSITIVE OR INDETERMINATE
DONATIONS
7 patients (167 samples) had positive results on 12 occasions (table). 4 patients were positive on one occasion, 2 were positive twice, and 1 was positive four times. 10 of the 12 positive samples (from 5 of the 7 patients) were retested; all were negative, including 1 sample that was retested within 30 min of the original test. The other samples had been stored at - 30°C for between 72 h and 10 months. 2 of the positive samples were not available for
retesting. Patients 1-3 had no clinical, radiological, or microbiological of aspergillosis. 1 of these patients died from graft-versus-host disease 8 weeks after transplant; the other 2 are well. The positive sample from patient 4 was obtained 6 weeks before BAL and sputum specimens yielded A fumigatus. This patient was treated with liposomal amphotericin B. The 2 positive samples from patient 5 were obtained 1 and 2 weeks after a BAL specimen yielded Afumigatus. Both serum samples proved negative on retesting. This patient was not treated with antifungal drugs and died 35 weeks after transplant; necropsy was not done. Patient 6 died with aspergillosis 2 weeks after the second positive sample was obtained. This sample proved negative on retesting. Patient 7 remains well 18 weeks after his transplant; the only evidence of possible fungal infection was a nasal swab taken 6 weeks after transplant which yielded Afumigatus. In a previous investigation4 the pastorex aspergillus test detected circulating galactomannan in 14 of 15 patients with proven aspergillosis; 54 controls had negative results. Although the test could have detected fungal antigen in several of our patients, the fact that repeat testing gave negative results in all cases leads us to conclude that this test is of limited value in making decisions about the diagnosis of invasive aspergillosis in immunosuppressed
findings suggestive
patients.
Regional Mycology Laboratory and Bone Marrow Transplant Unit, Bristol Royal Infirmary and Bristol Royal Hospital for Sick Children, Bristol BS2 8HW, UK
D. W. WARNOCK A.B.M. FOOT E. M. JOHNSON S. B. MITCHELL J. M. CORNISH A. OAKHILL
1. Bodey GP, Vartivarian S. Aspergillosis. Eur J Clin Microbiol Infect Dis 1989; 8: 413-37
Rogers TR, Haynes KA, Barnes RA. Value of antigen detection m predicting invasive pulmonary aspergillosis. Lancet 1990; 336: 1210-13. 3. Andrews CP, Weiner MH. Aspergillus antigen detection in bronchoalveolar lavage fluid from patients with invasive aspergillosis and aspergillomas. Am J Med 1982; 2.
73: 372-80.
4. Dupont B, Improvisi L, Provost F. Detection de galactomannane dans les aspergilloses mvasives humaines et animales avec un test au latex Bull Soc Fr Mycol Med 1990; 19: 35-42.
HCV confirmatory testing of blood donors SiR,—The introduction of screening of all blood donations in the UK for hepatitis C virus (HCV) antibody has highlighted the problem of confirming results of second-generation ELISAs. As with the first-generation tests, the second-generation ELISA can yield false-positive reactions. The recombinant immunoblot assay (RIBA-2), incorporating four antigens from the HCV genome, provides a method for identifying genuine anti-HCV reactivity. However, it can be "indeterminate", and in our present state of knowledge of HCV infection, such a finding is uninterpretable, making it very difficult to advise a blood donor who has such a
result. We have used the polymerase chain reaction (PCR) to detect HCV RNA and have compared the PCR results from RIBA-2 indeterminate samples with those from RIBA-2 positive samples. 42 498 blood donations from the West of Scotland were screened for HCV antibodies by a second generation ELISA (Abbott). 177 donations (042%) were positive; 169 of these (0-40% of the total) were repeatedly ELISA reactive and were forwarded to the reference laboratory for confirmatory testing by RIBA-2 (Ortho). Of the 169 repeatedly reactive samples 82 (48-5%) were unreactive in the RIBA test so HCV antibody could not be confirmed; 49 (29-0%) were positive and 38 (22-5%) were indeterminate. Plasma from all 87 RIBA indeterminate or positive samples was tested for HCV RNA by PCR with nested primers for the NS3 and 5’-NCR
regions. There was a good correlation between PCR positivity and RIBA positivity (table), only 3 of 49 RIBA-positive donations being negative for HCV RNA. 29 (76%) of RIBA indeterminate donations did not react by PCR; of the 9 that did all but 1 had exhibited a single band to the core protein (c22) in the RIBA-2. The PCR results suggest that almost all RIBA-2 positive donors have chronic HCV infection. The 3 PCR-negative RIBA-2positive donations may reveal evidence of viral RNA on further analysis with different HCV primers-or the donors may have been in a non-viraemic phase of HCV infection, as suggested by previous PCR studies.1 Our results suggest it is important to subject RIBA-2 indeterminate samples routinely to PCR testing, since that might allow definitive identification of chronic HCV infection, permitting counselling of the donor with full assessment of his or her liver disease and treatment if necessary. Scottish National Blood Transfusion Service Microbiology Reference Unit, Regional Virus Laboratory, Ruchill Hospital, Glasgow G20 9NB, UK
Edinburgh and SE Scotland Blood Transfusion Service,
Edinburgh
Glasgow and West of Scotland
E. A. C. FOLLETT B. C. DOW
F. MCOMISH P. LEE YAP
Blood Transfusion Service, Law Hospital, Carluke
W. HUGHES R. MITCHELL
Department of Medical Microbiology, University of Edinburgh
P. SIMMONDS
JA, Tuke PW, Makris M, et al. Demonstration of viraemia patterns in haemophiliacs treated with heparitis-C-virus-contaminated factor VIII concentrates. Lancet 1990; 336: 1022-25.
1. Garson
Transmission of
hepatitis
B via human bite
SIR,-A man presented to this hospital seriously ill with acute hepatitis. He was hepatitis B surface antigen and e antigen positive. The route of infection was unknown. His habits were, according to friends and family, irreproachable. At first we suspected transmission from a member of his family but when we looked for hepatitis B virus (HBV) markers, including HBV-DNA, we found that no member of the family showed any sign of HBV infection. However, it emerged that about 8 weeks earlier the patient had
1025
taken part in a fight to defend a friend. Someone bit his left cheek so badly that when he arrived at hospital a piece of flesh was hanging off. The wound was promptly treated and stitched and it had healed well leaving an oval scar with slight cheloidal reaction around the stitches. We assumed that HBV had been transmitted during the stitching of the wound, because of non-sterile instruments or for some other reason. However, the casualty department register showed that the patient had been the first one to be medicated after all instruments, needle-case included, had been properly sterilised. That left only one possibility, the man who had bitten him. It was not an easy task to find out who that was, but we eventually succeeded and convinced him and his family to be tested for HBV infection. The man turned out to be a chronic carrier of HBV (e antigen positive) and all members of his family showed signs of HBV infection at different stages. All these findings point to HBV transmission in saliva when the patient was bitten by another man during a fight. Infectious Diseases Department,
Ospedale Maggiore, Modica, Ragusa, Italy
C. STORNELLO
lives
near a
small
town
throat, and an erythematous rash over his arms and legs. He had difficulty in eating and drinking and had severe abdominal discomfort with vomiting. He was jaundiced and had bile in the urine. Suspecting Lyme disease, his general practitioner prescribed doxycycline but the patient’s condition did not improve, and when his right knee and left ankle started to swell he was admitted to hospital. a
Musgrove
Park
J. V. S. PETHER N. JONES
Hospital
Viral Diagnosis Group, PHLS Centre for Applied and Research, Porton Down
Microbiology
G. LLOYD
1. Editorial. Hantavirus disease. Lancet 1990; 336: 407-08. 2 Bruno P, Hassell LH, Brown J, et al. The protean manifestations of with renal syndrome. Ann Intern Med 1990; 113: 385-91.
hemorrhagic fever
in north
Somerset felt increasingly weak for 2 weeks. His wife had just recovered from a sore throat with headache and neck stiffness but the three children had been well. In the second week of the patient’s illness he had a high temperature with arthralgia, headache, sore
On examination he had
Public Health Laboratory, Musgrove Park Hospital, Taunton TA1 5DB, UK
Genomic sequences of respiratory syncytial virus in otitis media with effusion
Acute hantavirus infection SIR,-A 42-year-old man who
of the father-in-law. Neither the father-in-law nor the children had been ill. The patient improved steadily and was discharged home. By mid-September he felt well apart from mild pain in one ankle. This may be the first identified case of acute human hantavirus disease in England. The clinical picture is unusua1.2 Viral and epidemiological studies, in conjunction with the Agricultural Development Advisory Service, are in progress to attempt to isolate hantavirus from the family’s neighbourhood. serum
temperature of 38 2°C with
some
lymphadenopathy in the neck. There was jaundice and severe enlargement of liver and spleen. The left hand and left knee were swollen and painful to the touch; his right ankle was very tender and swollen too. There was evidence of what was probably an insect bite on the left elbow. The patient had recently been on holiday in Blackpool but had not been abroad. Laboratory investigations revealed hepatic abnormalities suggestive of an obstructive or infective process. His blood urea rose to 7-5 mmol/1 (and it was still 74 mmol/1 when he was discharged from hospital); his serum creatinine was never higher than 91 [unol/I (normal 60-120); he was anaemic; his white cell count rose from 8-8 to 27.2 x 109/1 (an initial relative lymphocytosis became a neutrophilia); his platelet count was normal, as was a coagulation screen; his plasma viscosity was 224 cp (n = 152-172); C-reactive protein was 119 mg/1. By day 6 there was marked rouleaux formation on the blood film, possibly explained by the high level of IgG. Ultrasound and computed tomographic scans revealed no evidence of hepatic obstruction. (A focus of echogenicity remained unchanged while the patient improved, and may be a capillary haemangioma; this will be followed up.) The patient had many features of infection but no bacterial pathogens were isolated from urine, faeces, or blood; the antistreptolysin 0 titre was negative; there was no evidence of complement-fixing antibodies to influenza A and B viruses, chlamydial antigen, Q fever antigen, Mycoplasma pneumoniae, not
respiratory syncytial virus, or cytomegalovirus. Leptospira antibodies were negative and a serological test for Borrelia burgdorferi infection was also negative. There was no serological evidence of hydatid, liverfluke, or amoebic infection. However, blood taken on hospital day 2 had an immunofluorescence titre of 128 with an IgM titre of 64 to hantavirus strains.’ A later specimen of blood showed the antibody level to be rising, and samples from the rest of the household demonstrated antibody in two out of the three children and an IgG and IgM response to the virus in the
SIR,—Otitis media
with etiusion is the most common cause ot
acquired hearing loss in young children, and if it persists permanent sensorineural hearing impairment may ensue. However, the mechanism for the disease remains to be defined. Respiratory syncytial virus (RSV) is a common cause of respiratory tract disease in childhood, and it is the most common virus to be isolated from the nasopharynx in otitis media.’ However, isolation of RSV from otitis media with effusion has reverse
not
been very successful. We used the
transcriptase polymerase chain reaction (RT-PCR) and
nested PCR to detect RSV sequences in this condition. Effusion fluids were collected from 12 children, aged 3-7 years, with otitis media. This was done in the period February to April, 1991. RNA was isolated2 and 4 ng was used for RT-PCR and nested PCR. Details ofcDNA synthesis and of PCR reaction mixtures and conditions are obtainable from Y. O. For PCR specific primers were synthesised on a model 391 ’PCR-Mate’ (Applied Biosystems) using RNA sequences published by Collins et all Sequences expressing the F glycoprotein of RSV were chosen as the target. The primer sequences showed no significant homology with other genes, according to Genbank and the European Molecular Biology Laboratory. Inner primers for nested PCR were prepared similarly. Primer sequences were: RT-PCR (lst PCR, product size 391 bp) 5’: GGTGTTGGATCTGCAATCGCCA 3’:AACTTTTTCTGATCATTTGT
Nested PCR (2nd PCR, product size 207bp) 5’: AAGTGCTCTACTATCCACA 3’:CACTAAATTCCCTGGTAATC
A discrete band was detected after RT-PCR of RNA from RSV-infected Hep-2 cells but not from mumps-virus-infected Vero cells or parainfluenza-I-virus infected GM-K cells, used as
Fig 1-RT-PCR. Lane 1 = marker (X174/Haelll digest), lanes 2-5= RSV strains B1, A, B2, and long; lane 6 = paramfluenza virus type 1, lane 7= mumps virus.
