JOURNAL OF VIROLOGY, Dec. 1991, p. 6782-6789 0022-538X/91/126782-08$02.00/0 Copyright C) 1991, American Society for Microbiology
Vol. 65, No. 12
Translational Control of Human Cytomegalovirus gp48 Expression MARK R. SCHLEISS,t CATHERINE R. DEGNIN, AND ADAM P. GEBALLE* Department of Molecular Medicine, Fred Hutchinson Cancer Research Center, 1124 Columbia Street, Seattle, Washington 98104 Received 10 June 1991/Accepted 29 August 1991
Posttranscriptional controls modulate the expression of several human cytomegalovirus genes. Previous studies have shown that one cytomegalovirus gene transcript leader contains AUG codons which inhibit translation of a downstream reading frame. However, two other cytomegalovirus gene transcript leaders of similar structure do not inhibit translation. We have extended these studies to the analysis of the structural glycoprotein gp48, whose predominant transcript contains three upstream AUG codons. The 5' leader of this transcript strongly inhibits downstream translation in fibroblasts. Analyses of deletions and point mutations identify the second upstream AUG codon as an essential component of the inhibitory signal. Other leader sequences, but neither the first nor the third AUG codon, are also required. Intriguingly, the inhibitory signal appears also to depend on the amino acid coding information of the short reading frame associated with the second AUG codon. Insights derived from these studies are germane to understanding the translational regulation of other viral and cellular genes of similar structure.
Human cytomegalovirus (CMV) is a medically important herpesvirus responsible for severe infections in newborns and immunocompromised patients (reviewed in reference 1). The 230-kb CMV genome encodes approximately 200 genes (7) whose expression is temporally and coordinately regulated (9, 22, 35, 36) during infection of human fibroblasts (HF) in cell culture. Although much research has concentrated on the transcriptional events responsible for the differential expression of a (or immediate-early), C (or early), and -y (or late) genes, posttranscriptional events also influence the expression of CMV genes (reviewed in reference 24). The expression of the major ot genes (33, 34) and several 3 and y genes (12-15, 32, 38) is regulated in part posttranscriptionally, although the detailed mechanisms and significance of these controls during the viral life cycle have not been well characterized. Previous studies of CMV posttranscriptional controls focused on a I gene (2.7p) encoding a 2.7-kb transcript whose 5' leader contains cis-acting inhibitory signals (14). Either of two upstream AUG codons within this leader is required for inhibition of downstream translation (13). The presence of AUG codons in the 5' transcript leaders of several other CMV genes suggested that upstream AUG codons might be common signals mediating translational control of CMV gene expression. However, further studies demonstrated that the transcript leaders of two of these genes, the CMV DNA polymerase and pplS0, permitted efficient downstream expression (3). These studies demonstrated that the translational impact of upstream AUG codons is unpredictable and may depend on other sequences within the transcript leader
of these transcripts (El) contains three upstream AUG codons with associated short reading frames and inhibits downstream translation in cell extracts (6). Our studies demonstrate that the gp48 leader inhibits translation in intact cells. In contrast to the conclusions drawn from the studies using cell extracts (6), we demonstrate that the second of the three upstream AUG codons is an essential component of the inhibitory signal in cells. Surprisingly, downstream sequences including the authentic amino acid coding information of the short ORF associated with this second AUG codon are also required for translational inhibition. MATERIALS AND METHODS
Cells, virus, and plasmids. Human CMV(Towne) was grown in HF in Dulbecco's minimum essential medium supplemented with 10% Nu serum (Collaborative Research, Inc., Bedford, Mass.) as described previously (30). CMV genomic DNA was purified over NaI gradients (31). The transfection control plasmid pEQ134 has been previously described (3). pEQ3 (Fig. 1) is a promoterless P-galactosidase (P-gal) expression plasmid derived from pON1 (30) by first inserting a 514-bp RsaI fragment from pEMBL8 (10), containing the fl origin of replication, into a Pstl site (within simian virus 40-derived sequences) that had been blunted with T4 DNA polymerase. The fl origin in this plasmid directs packaging of single strands corresponding to the plus sense of p-gal. The pBR322 origin of replication, removed as a ScaI/SmaI digestion of this plasmid, was replaced with pUC19 sequences from position 805 to Scal containing the pUC19 plasmid origin of replication. Addition of a SmaI linker to the pUC19 fragment end at position 805 unexpectedly resulted in insertion of nine C's, including three C's which restored the SmaI site. The polylinker of pON1 between SmaI and Hindlll was replaced with a Small HindlIl pUC18 polylinker that had been digested with SphI, blunted with mung bean nuclease, and religated. The oligonucleotide AGCTTACGTAGATCTCGAGCCATGGTAC was used to replace the sequences from HindIII to KpnI, including part of the pON1 polylinker and 5' p-gal leader (including all three in-frame AUG codons [25]) with new
(3).
We now report results of similar investigations of another CMV gene, the glycoprotein gp48 (UL4), whose protein product is synthesized as a P protein that is present in virions (6). The gp48 open reading frame (ORF) is contained in two p (El and E2) and one -y (L) transcript with different 5' ends and identical 3' ends (5). The 5' leader of the most abundant * Corresponding author. t Present address: Department of Pediatrics, Childrens Hospital Research Foundation, Cincinnati, OH 45229.
6782
CMV TRANSLATIONAL CONTROL
VOL. 65, 1991
Eq
A
n
I
6783
gp48
,pE2 39 pEE2! 51 r
+1 +12
pEO296
+64
n
+86
+122 +198
1-.
pE0290
-_
pEO256
!-.
pEE258
B
3,000 Z r_
c 0
Smal Xbal Sall Pstl Hlndili SnaBI BgIllii
-.
Asp718
a) 0 U)
2,000
I.....
.
r
J pEQ1 76 FIG. 1. 1-Gal plasmids. The promoterless 13-gal plasmid pEQ3 was constructed as described in Materials and Methods. In addition to the indicated unique restriction sites, the AUG codon (boxed) that initiates translation of ,3-gal is contained in the multiple cloning site (MCS) at the 5' end of the E. coli lacZ gene. pEQ176 contains the CMV(Towne) major a enhancer/promoter (Enh-Pr) derived from pON249 (14), corresponding to bp 174873 through 173749 of the CMV(AD169) genome (GenBank accession number X17403) inserted into the PstIIHindIII sites of pEQ3. SV40, simian virus 40; ori, origin of replication.
LD 4) 0
.2
z:n
1,000
X
U)
pl.
N
c
-, .
f
Vol. 65, No. 12
Translational Control of Human Cytomegalovirus gp48 Expression MARK R. SCHLEISS,t CATHERINE R. DEGNIN, AND ADAM P. GEBALLE* Department of Molecular Medicine, Fred Hutchinson Cancer Research Center, 1124 Columbia Street, Seattle, Washington 98104 Received 10 June 1991/Accepted 29 August 1991
Posttranscriptional controls modulate the expression of several human cytomegalovirus genes. Previous studies have shown that one cytomegalovirus gene transcript leader contains AUG codons which inhibit translation of a downstream reading frame. However, two other cytomegalovirus gene transcript leaders of similar structure do not inhibit translation. We have extended these studies to the analysis of the structural glycoprotein gp48, whose predominant transcript contains three upstream AUG codons. The 5' leader of this transcript strongly inhibits downstream translation in fibroblasts. Analyses of deletions and point mutations identify the second upstream AUG codon as an essential component of the inhibitory signal. Other leader sequences, but neither the first nor the third AUG codon, are also required. Intriguingly, the inhibitory signal appears also to depend on the amino acid coding information of the short reading frame associated with the second AUG codon. Insights derived from these studies are germane to understanding the translational regulation of other viral and cellular genes of similar structure.
Human cytomegalovirus (CMV) is a medically important herpesvirus responsible for severe infections in newborns and immunocompromised patients (reviewed in reference 1). The 230-kb CMV genome encodes approximately 200 genes (7) whose expression is temporally and coordinately regulated (9, 22, 35, 36) during infection of human fibroblasts (HF) in cell culture. Although much research has concentrated on the transcriptional events responsible for the differential expression of a (or immediate-early), C (or early), and -y (or late) genes, posttranscriptional events also influence the expression of CMV genes (reviewed in reference 24). The expression of the major ot genes (33, 34) and several 3 and y genes (12-15, 32, 38) is regulated in part posttranscriptionally, although the detailed mechanisms and significance of these controls during the viral life cycle have not been well characterized. Previous studies of CMV posttranscriptional controls focused on a I gene (2.7p) encoding a 2.7-kb transcript whose 5' leader contains cis-acting inhibitory signals (14). Either of two upstream AUG codons within this leader is required for inhibition of downstream translation (13). The presence of AUG codons in the 5' transcript leaders of several other CMV genes suggested that upstream AUG codons might be common signals mediating translational control of CMV gene expression. However, further studies demonstrated that the transcript leaders of two of these genes, the CMV DNA polymerase and pplS0, permitted efficient downstream expression (3). These studies demonstrated that the translational impact of upstream AUG codons is unpredictable and may depend on other sequences within the transcript leader
of these transcripts (El) contains three upstream AUG codons with associated short reading frames and inhibits downstream translation in cell extracts (6). Our studies demonstrate that the gp48 leader inhibits translation in intact cells. In contrast to the conclusions drawn from the studies using cell extracts (6), we demonstrate that the second of the three upstream AUG codons is an essential component of the inhibitory signal in cells. Surprisingly, downstream sequences including the authentic amino acid coding information of the short ORF associated with this second AUG codon are also required for translational inhibition. MATERIALS AND METHODS
Cells, virus, and plasmids. Human CMV(Towne) was grown in HF in Dulbecco's minimum essential medium supplemented with 10% Nu serum (Collaborative Research, Inc., Bedford, Mass.) as described previously (30). CMV genomic DNA was purified over NaI gradients (31). The transfection control plasmid pEQ134 has been previously described (3). pEQ3 (Fig. 1) is a promoterless P-galactosidase (P-gal) expression plasmid derived from pON1 (30) by first inserting a 514-bp RsaI fragment from pEMBL8 (10), containing the fl origin of replication, into a Pstl site (within simian virus 40-derived sequences) that had been blunted with T4 DNA polymerase. The fl origin in this plasmid directs packaging of single strands corresponding to the plus sense of p-gal. The pBR322 origin of replication, removed as a ScaI/SmaI digestion of this plasmid, was replaced with pUC19 sequences from position 805 to Scal containing the pUC19 plasmid origin of replication. Addition of a SmaI linker to the pUC19 fragment end at position 805 unexpectedly resulted in insertion of nine C's, including three C's which restored the SmaI site. The polylinker of pON1 between SmaI and Hindlll was replaced with a Small HindlIl pUC18 polylinker that had been digested with SphI, blunted with mung bean nuclease, and religated. The oligonucleotide AGCTTACGTAGATCTCGAGCCATGGTAC was used to replace the sequences from HindIII to KpnI, including part of the pON1 polylinker and 5' p-gal leader (including all three in-frame AUG codons [25]) with new
(3).
We now report results of similar investigations of another CMV gene, the glycoprotein gp48 (UL4), whose protein product is synthesized as a P protein that is present in virions (6). The gp48 open reading frame (ORF) is contained in two p (El and E2) and one -y (L) transcript with different 5' ends and identical 3' ends (5). The 5' leader of the most abundant * Corresponding author. t Present address: Department of Pediatrics, Childrens Hospital Research Foundation, Cincinnati, OH 45229.
6782
CMV TRANSLATIONAL CONTROL
VOL. 65, 1991
Eq
A
n
I
6783
gp48
,pE2 39 pEE2! 51 r
+1 +12
pEO296
+64
n
+86
+122 +198
1-.
pE0290
-_
pEO256
!-.
pEE258
B
3,000 Z r_
c 0
Smal Xbal Sall Pstl Hlndili SnaBI BgIllii
-.
Asp718
a) 0 U)
2,000
I.....
.
r
J pEQ1 76 FIG. 1. 1-Gal plasmids. The promoterless 13-gal plasmid pEQ3 was constructed as described in Materials and Methods. In addition to the indicated unique restriction sites, the AUG codon (boxed) that initiates translation of ,3-gal is contained in the multiple cloning site (MCS) at the 5' end of the E. coli lacZ gene. pEQ176 contains the CMV(Towne) major a enhancer/promoter (Enh-Pr) derived from pON249 (14), corresponding to bp 174873 through 173749 of the CMV(AD169) genome (GenBank accession number X17403) inserted into the PstIIHindIII sites of pEQ3. SV40, simian virus 40; ori, origin of replication.
LD 4) 0
.2
z:n
1,000
X
U)
pl.
N
c
-, .
f
