Transgenic Res DOI 10.1007/s11248-015-9880-x

ORIGINAL PAPER

Transgenic plants over-expressing insect-specific microRNA acquire insecticidal activity against Helicoverpa armigera: an alternative to Bt-toxin technology Aditi Agrawal . Vijayalakshmi Rajamani . Vanga Siva Reddy . Sunil Kumar Mukherjee . Raj K. Bhatnagar

Received: 30 July 2014 / Accepted: 3 April 2015 Ó Springer International Publishing Switzerland 2015

Abstract The success of Bt transgenics in controlling predation of crops has been tempered by sporadic emergence of resistance in targeted insect larvae. Such emerging threats have prompted the search for novel insecticidal molecules that are specific and could be expressed through plants. We have resorted to small RNA-based technology for an investigative search and focused our attention to an insect-specific miRNA that interferes with the insect molting process resulting in the death of the larvae. In this study, we report the designing of a vector that produces artificial microRNA (amiR), namely amiR-24, which targets the chitinase gene of Helicoverpa armigera. This vector was used as transgene in tobacco. Northern blot and real-time analysis revealed the high level expression of amiR-24 in transgenic tobacco plants. Larvae feeding on the transgenic plants ceased to molt further and eventually died. Our results demonstrate that

Electronic supplementary material The online version of this article (doi:10.1007/s11248-015-9880-x) contains supplementary material, which is available to authorized users. A. Agrawal  V. Rajamani  V. S. Reddy  R. K. Bhatnagar (&) International Centre for Genetic Engineering and Biotechnology (ICGEB), Aruna Asaf Ali Marg, New Delhi 110067, India e-mail: [email protected] S. K. Mukherjee Department of Genetics, University of Delhi, New Delhi 110021, India

transgenic tobacco plants can express amiR-24 insectice specific to H. armigera. Keywords Artificial miRNA  Agrobacterium  Transgenic tobacco  Insecticidal  Insect bioassay

Introduction Helicoverpa armigera (H. armigera) is one of the most damaging polyphagous pests of agricultural crops. In India, it infests at least 30 agricultural crops and causes substantial losses to legume, fiber, cereal, oilseed and vegetable crops. Various chemical pesticides have been used for decades to control this pest, but the adverse effects towards an eco-friendly approach make using chemical pesticides of growing concern. Bacillus thuringiensis (Bt) bacteria are used as biological pesticides which are environmentally safe and have been deemed as acceptable insecticides for more than 30 years (Tabashnik et al. 2009). The recent evolution of resistance against Bt is raising concern again and forcing the scientific community to look for some alternative strategies for durable pest control. Transgenic plants expressing small RNAs, targeting vital host functions, have revealed potentials for their development as alternatives to Bt application (Rajagopal et al. 2009; Ali et al. 2013). Transgenic plants expressing siRNA targeting insect cytochrome p-450 and GST have also offered substantial pest control (Mao et al. 2007).

123

Transgenic Res

RNA interference (RNAi) is the most effective gene-silencing technique, used widely in many organisms. It was first discovered in plants and later well characterized in C. elegans (Napoli et al. 1990; Van der Krol et al. 1990; Fire et al. 1998). The mechanism of dsRNA-mediated RNAi is conserved in many eukaryotes and is widely used for gene function determination and gene knockdown analysis. This technique is now widely used to investigate genesilencing by dsRNA uptake in several insect species (Terenius et al. 2011), including Drosophila melanogaster (Roignant et al. 2003; Bischoff et al. 2006; Miller et al. 2008; Roignant et al. 2003), Bombyx mori (Quan et al. 2002; Ohnishi et al. 2006), Epiphyas postvittana (Turner et al. 2006), Blattella germanica (Martin et al. 2006) Tribolium castaneum ( Tomoyasu and Denell 2004), and Nasonia vitripennis (Zha et al. 2011). Feeding of the dsRNA of essential gene/s in insects has been reported to trigger cessation of molt, eventually leading to the mortality of larvae (Huvenne and Smagghe 2010). Recently, miRNAs have been identified as important regulators of gene expression in animals and plants (Bartel 2004). MicroRNAs are a class of small (approximately 19–24 nt long), single standard, endogenous, non-coding RNA molecules that regulate gene expression at the post-transcriptional level by repressing mRNAs in animals and by cleavage in plants (Carrington and Ambros 2003; Ambros 2004). MicroRNAs have been identified in various organisms including animals, plants, insects and viruses. These miRNAs control diverse biological processes like defense, cell development, differentiation and apoptosis (Carrington and Ambros 2003). So far, hundreds of microRNAs have been isolated and annotated from different eukaryotic organisms including insects. More than 3500 insect miRNAs have been identified from 22 insect species belonging to different insect orders, and including important insects such as Anopheles gambiae, Drosophila melanogaster, Apis mellifera, D. pseudoobscura, and Bombyx mori, and have been deposited in miRBase (Release 20.0). Most of these insect miRNAs have been identified by an in silico approach and await experimental validation (Ambros 2004; Bartel 2004; Behura 2007; Asgari 2012). Various parallel approaches are being applied to validate the existence and utility of these insectspecific miRNAs.

123

While identification and functional validation of miRNA goes on, a few that have been identified are being explored for different applications to disrupt specific pathways targeted by these miRNAs. The artificial miRNA technology exploits endogenous miRNA precursors as a backbone to generate small RNAs that direct gene silencing in either animals or plants. MicroRNA precursors preferentially produce the miRNA–miRNA* duplex. When the sequences of both of these are altered without altering structural features such as bulges or mismatches, the miRNAs with the altered sequences are processed and are accumulated at high levels. The miRNAs with the desired altered sequences are known as artificial miRNAs (amiR) (Miska 2005). AmiRs were first generated and used in human cell lines and later in Arabidopsis, tomato, etc. (Niu et al. 2006; Vu et al. 2012). Subsequently, it was demonstrated that, along with reporter genes, endogenous genes can also be targeted by amiRNAs. The amiRNAs, when expressed in plants, can target and degrade an invading insect’s genes, consequently conferring insect resistance (Ossowski et al. 2008). The possibility of using amiRNAs to protect plants against insect predation depends on the identification of a few essential insect specific gene(s) whose dysfunction may lead to the death of the insect (Daborn et al. 2012). In our previous study, we identified miR-24, which effectively targets the expression of the chitinase gene of H. armigera, resulting in interference in the insect’s molting process (Agrawal et al. 2013). Our preliminary data also revealed that feeding neonates of Spodoptera litura on an artificial diet containing miR24 was not larvicidal, showing the specificity of miR24 for H. armigera (data not shown). In this report, we examined the possibility of using this miRNA as an effective insecticidal molecule against the insect H. armigera. To accomplish this, we generated transgenic tobacco plants that constitutively over-expressed the miR-24 and examined the insecticidal characteristics of the transgenics.

Materials and methods Design and synthesis of artificial miR-24 The natural pre-miRNA (Sly-miR-159) backbone was used as reference to generate the artificial pre-miR-24.

Transgenic Res

In the process, a mature miRNA sequence of Sly-miR59 was replaced by miR-24 and a corresponding miRNA star sequence was generated. A control miRNA construct with six different bases (GAGGAU) from the mature miR-24 starting from 6th position of the seed region was also constructed to demonstrate the specificity of activity of amiR-24. Mature sequences for amiR-24C and amiR-24 are UGAACU GAGGAUCAACCCGGC and UGAACUCGCCGCC AACCCGGC, respectively. Secondary structures of the artificial precursor miRNAs (pre-amiRs) of SlymiR-159, amiR-24, and amiR-24C were predicted by the Mfold web server (Zuker 2003), with the -DG value\-20 kcal/mol. The structures of pre-amiRNAs showed the same conformation and nucleotide order with natural pre-miRNAs. MiRNA and miRNA* of all three (miR-159, amiR-24 and amiR-24C) are highlighted in the pre-miRNA structure (Fig. 1). Both preamiR-24 and pre-amiR-24C (229 bp) were synthesized commercially (Genscript, USA) and cloned individually into a pUC57 vector as an expression cassette at XbaI/SacI restriction sites. Plasmid construction and plant transformation The 229-bp-long pre-amiR-24 and pre-amiR-24C were amplified using oligonucleotide primers (forward: 50 -TGACGGTACCTATTTTATGTGTTATGA CAGGTCG-30 reverse: 50 -ACTGGGATCCCTAGTA AGAAGAAACTAATTGC-30 ) having recognition sites for KpnI and BamHI restriction endonucleases, respectively. The PCR product has been cloned in the binary vector pCAMBIA 2300 under the control of the CaMV 35S promoter and enhancer. Binary vectors pCAMBIA2300 amiR-24 and pCAMBIA2300 amiR24C harboring the amiR-24 and amiR-24C gene cassette, respectively, were transferred into the Agrobacterium tumefaciens strain LBA4404 by the freeze–thaw method (Gelvin 2003). The leaf disc method was followed for the Agrobacterium-mediated transformation method (Zhan et al. 1997; Cortina and Culianez-Macia 2004). Putative transgenic plants growing under kanamycin selection were first selected using PCR with NPT II and gene-specific primers. PCR-positive plants were transferred to the greenhouse for raising the T1 generation plants. Southern and northern blot analyses was carried out to confirm

the stable transgenic nature of the plants. Transgenic tobacco lines expressing amiR-24 and amiR-24C were analysed further by real-time PCR. Insect rearing and feeding bioassay on transgenic tobacco plant The inbred strain of H. armigera were obtained from Dr. G.T. Gujar’s laboratory, and maintained in the insectary under controlled conditions of temperature 25 °C, 70 % relative humidity and a photoperiod of 12 h light:12 h dark (Dr. G.T. Gujar, IARI, New Delhi). Larval neonates of H. armigera were taken for the detached leaf insect feeding bioassays. Leaves from the 2-month-old wild-type and transgenic tobacco plants were collected and washed thoroughly in distilled water, blotted dry and placed in Petri-plates containing moistened Whatman filter paper, and fed to neonates of H. armigera for 5 days (Dowd et al. 1998). Leaves were examined on the 3rd, 4th and 5th days. Ten insects were released on each Petri-plate and the number of dead insects and weight of the leaves before and after the experiment were recorded to estimate the leaf damage. Data of insect mortality and leaf damage were recorded after 5 days. The experiment was replicated three times. Northern blotting Total RNA was isolated from the control tobacco leaves and transgenic lines using TriZOL reagent (Invitrogen) and 40 lg of total RNA was resolved on 20 % polyacrylamide gels containing 7 M urea. RNA was electro-blotted for 45 min at 60 V onto a HybondN? membrane (Amersham Biosciences, Piscataway, NJ, USA) and immobilized by UV cross-linking at 1200 9 100 lJ. Antisense probes of amiR-24 and amiR-24C were labeled with [c-32P] ATP by 50 -end labeling using T4 kinase and were allowed to hybridize at room temperature (RT) overnight. The membrane was washed three times in 29 SSC (19 SSC is 0.15 M NaCl plus 0.015 M sodium citrate) with 0.1 % SDS and once in 29 SSC at room temperature and then exposed to a phosphorimager screen (Amersham Biosciences) overnight and scanned at 200 lm with a Typhoon-9210 instrument (Amersham Biosciences).

123

Transgenic Res

Fig. 1 Structures of amiR precursors and their original backbone. The mature miRNA sequence of Sly-miR-159 was replaced by mature amiR-24 in the same orientation as the original and the passenger sequence was designed so that it

123

mimics the base pairing of the original one. The secondary structures of the precursor miRNAs are a Sly-miR-159, b amiR24, c amiR-24C

Transgenic Res

Quantitation of miR-24 in transgenic tobacco plants The steady-state levels of amiR-24 in transgenic tobacco plants were determined by real-time analysis using Thermo Scientific DyNAmo SYBR Green 2-Step qRT-PCR Kit and PikoRealTM Real Time system (Thermo Scientific). Total RNA was isolated from control and transgenic tobacco leaves using TriZOL reagent according to manufacturer’s instructions then treated with RQ1 RNase-Free DNase (Promega). Reverse transcription was performed on 1 lg of each RNA sample in a 10-ll reaction using Superscript III Reverse Transcriptase (Invitrogen) and adapter primers, following the manufacturer’s instructions with some modification. The amiR-24 and amiR-24C was amplified using primers listed in Table 1. The amount of total RNA was normalized to b-actin gene. Real-time cycling conditions included a preliminary reverse transcription 70 °C for 10 min, 42 °C for 60 min, 70 °C for 15 min and finally at 37 °C for 20 min. From cDNA to real-time PCR conditions includes an initial activation step at 42 °C for 10 min, 95 °C for 10 min followed by 40 cycles each of 95 °C for 15 s, 55 °C for 15 s and 72 °C for 15 s, respectively, followed by a data acquisition step which includes a gradual temperature increase from 72 to 95 °C to enable melt-curve data collection. A non-template control (NTC) was run with every set of experiments. Reactions were set up in triplicate. The threshold cycles (CT) were recorded for each set (amiR-24, amiR-24C, and b-actin) and the difference between the CT (i.e. DCT) was calculated. The relative expression was determined using the comparative CT method using the formula 2-DDCT. Real-Time qPCR analysis of chitinase of H. armigera The relative abundance of chitinase transcripts in H. armigera was determined by real-time qPCR

analysis using Verso SYBR Green 1-Step qRT-PCR ROX mix (Thermo Scientific) kit and PikoRealTM Real Time system (Thermo Scientific). Gene-specific primers were designed from a sequence of H. armigera chitinase (NCBI Accession No. AY325496). The chitinase transcript was amplified using forward and reverse primers (Table 1). The amount of total RNA was normalised to b-actin transcript using primers listed in Table 1 (Agrawal et al. 2013). Each 25-ll reaction mixture contained 2 ll of template RNA (200 ng), 12.5 ll of 29 1-Step qPCR SYBR ROX Mix, 0.25 ll Verso Enzyme Mix, 1.25 ll of RT Enhancer, 1.75 ll of forward and reverse primer and nuclease-free water. Real-time cycling conditions included a preliminary reverse transcription at 50 °C for 15 min, an initial activation step at 95 °C for 15 min, followed by 40 cycles each of 95 °C, 15 s; 52 °C, 30 s and 72 °C, 15 s, respectively. The final step included a gradual temperature increase from 60 to 95 °C at the rate of 0.5 °C/10 s to enable meltcurve data collection. A non-template control (NTC) was run with every assay. Reactions were set up in triplicate. The threshold cycles (cT) were recorded for control and chitinase transcript and the difference between the cT was determined. The relative abundance was calculated using the Comparative cT method.

Statistical analysis To check the significance of the differences in the mean values of leaf damage and insect mortality, the feeding bioassay were performed and the normally distributed data were obtained and analyzed using the HSD tukey test and one-way analysis of variance (ANOVA) using the online website for statistical analysis, VassarStats: http://faculty.vassar.edu/lowry/ VassarStats.html, as described previously (Sharma et al. 2010).

Table 1 Primer sequences used in the real-time PCR Primer name

Forward primer

Reverse primer

amiR-24

GGATTCTCAGCCCTATCTATTTATG

CGGGTTGATCCTCAGTTCAAA

amiR-24C

GGATTCCTCAGCCCTATCT

GAAGAAACTAATTGCCGGGTTG

b-actin (tobacco)

TCAAGCTGTGTTGTCCCTATAC

TTATGAAGGTTACGCCCTTCC

Chitinase

AGGAACTTCACAGCTCTTCG

CTCATAAGCCCACTGATCATG

b-actin (H. armigera)

CAGATCATGTTTGAGACCTTCAAC

GA/C/TCCATCTCC/TTGCTCGAAA/GTC

123

Transgenic Res

Results Design of artificial miRNA We earlier reported the identification and characterization of larval chitinase targeting microRNA from H. armigera. Our preliminary results revealed that inclusion of miR-24 in insect diet resulted in cessation of growth of larvae and eventually the larvae died as a result of impaired chitinase regulation (Agrawal et al. 2013). The specific miRNA which was effectively targeting the chitinase gene was designed artificially. We chose S. lycopersicon (Sly-mir-159) pre-miRNA as the backbone for the generation of amiR-24 and its mutated control of amiR-24, i.e., amiR-24C. The amiR-24C is supposed to bind the chitinase target very weakly. The resident mature 21-mer miR sequences of the Sly-miR-159 backbone were replaced with the customized amiRs (amiR-24 and amiR-24C) to create pre-amiRs. The pairing relationships of the resident miR and miR* sequences were preserved in the amiR and amiR* sequences (Fig. 1). These pre-amiRs were synthesized commercially and cloned into pCAMBIA 2300 so that the expression of the pre-miRs could be driven by 35S in the binary vector and the recombinant vectors were finally sequenced. The potential for the formation of the folded structure of the predicted transcripts from the pre-amiRs was determined using the Mfold program (http://mfold.rna.albany.edu/?q= mfold/RNA-Folding-Form). The structures of the preamiRs are predicted to fold correctly to generate mature amiRs (Fig. 1). These amiRs were also designed to have one mismatch at the 30 end with the target sequence to minimize the formation of transient siRNAs, if any, in the plant-feeding insect. Analysis of transgenic plants for integration and expression of amiR-24 Transgenic tobacco plants were generated through Agrobacterium-mediated transformation. More than 15 transgenic lines were generated from each of binary vector. The transgenic tobacco plants obtained showed normal morphology, growth and development, similar to the wild-type plants, indicating that there were no significant side effects due to the expression of these amiRs. PCR and southern blot analysis (data not shown) confirmed the stable integration of the transgenes into the genomic DNA of the tobacco plants.

123

Of 15 transgenic lines screened, 4 high-expressing plants were selected for each of the amiR-24 or amiR24C. The levels of amiR production in the tobacco transformants were examined by northern blots, using the reverse complement probes of the respective amiRs. The auto-radiographic signal with amiR-24specific plants revealed processing of the amiR product corresponding to 21 nt. Such signals were absent from the non-transgenic plants. This finding confirms that the amiR precursors were efficiently transcribed and processed in the transgenic plants and that mature 21 nucleotide (nt) amiRs are generated. The levels of amiR production varied among different lines. The amiR expression levels were quantified using ImageJ software (Schneider et al. 2012), and the obtained values indicated that line #2 containing the amiR-24 showed the highest expression (Fig. 2a). Real-time PCR was also performed for the expression analysis (Fig. 2b). These results were consistent with northern blotting and real-time PCR. Similarly, the amiR-24C lines also expressed the corresponding miRs very well and the line 24C #3 showed the highest expression (data not shown). Regulation of H. armigera chitinase in transgenic amiR-24 The relative abundance of the chitinase transcript was analyzed in larvae fed on control and transgenic leaves expressing amiR-24. The significant down-regulation of the expression of the transcript of chitinase was observed in larvae fed on amiR-24 in comparison to controls (Fig. 2c). Further cessation of molting was observed in larvae fed on transgenic miR-24, while the control larvae showed normal growth and molting. Insect bioassay The effects of amiR-24 transgene expression on the transgenic tobacco leaves were recorded 5 days after infestation with the insect larvae. Neonates fed on transgenic leaves had varying levels of effects on damage rates, mortality and insect weight. Significantly less larval mortality and subsequently high leaf damage were recorded in larvae feeding on control non transgenic leaves and amiR-24C as compared to transgenic lines expressing amiR-24. Based on graphical observations, it was estimated that control and amiR-24C leaves were three to four times more

Transgenic Res

Fig. 2 Quantitation of amiR-24 in different transgenic lines of tobacco plant. a Northern blots showing the expression of amiR transcripts in T1 line. 25S RNA was taken as control and abundance of transcripts were normalized to 25S RNA

employed as internal control. b Steady-state levels of amiR-24 were estimated in different transgenic lines by real-time PCR. c Relative abundance of chitinase transcript in amiR-24 fed H. armigera larvae was estimated by real-time PCR

damaged as compared to those of amiR-24 (ANOVA; P \ 0.0001) (Table 2). Insect bioassay using H. armigera on detached leaves of control and amiR-24 expressing tobacco suggested that the transgenic lines were distinctly insect resistant (Supplemental Fig. 1). Similarly, a significant difference between control, miR-24C and amiR-24 was observed in larval mortality (Table 3), and larvae which survived showed significantly less body mass relative to controls. After 5 days of infestation, six-fold more larvae were dead on transgenic leaves containing amiR-24 as compared to those of control leaves (ANOVA; P \ 0.0001). The larvae feeding on the transgenic leaves expressing amiR-24C survived well and significant differences in leaf damage as compared to amiR-24 were reported.

As amiR-24C was designed to have less harmful effects on the chitinase target, this result was predicted. Our study suggested that amiR-24 over-expression in tobacco modulates different metabolic activities leading to decreased chitinase level which gives insect resistance in tobacco.

Discussion The prevention of predation of crop plants by insects is being intensively sought after globally. Applications of specific chemicals and the expression of insecticidal proteins in desired crop plants have provided adequate protection. However, insects continue to evolve

123

Transgenic Res Table 2 Estimation of damage to leaves expressing amiR-24 caused by larvae of H. armigera Treatment

Control

miR-24C

miR-24-2

miR-24-4

miR-24-5

Replication

Weight of leaf (mg)

Damage

Initial weight

Weight after 5 days of feeding

I

842.3

595.6

246.6

II

864.3

635.6

228.6

III

914

674.6

239.3

I

1091.7

865

226.6

II

1017.6

811

206.6

III

966

732.6

233.3

I

966.67

906.6

60

II

963.33

895

68.3

III

1016.6

916.6

100

I

1236.7

1036.6

200

II

993.3

803.3

190

III

936.6

726.6

210

I

946.3

809.6

136.6

II

853.3

728.3

125

III

896.6

744

152.6

Source

Sum of square

Degree of freedom

238.22 ± 7.39

222.22 ± 11.3

76.11 ± 17.2

200 ± 8.1

138.11 ± 11.3

Mean of square

F value

P value

66.62

\0.0001

ANOVA summary for mortality Treatment (between groups)

53,975.3128

4

13,493.8282

2025.6294

10

202.5629

56,000.9421

14

Error Ss/Bl Total HSD Tukey test HSD[.05] = 0.05; HSD[.01] = 0.01 Control versus miR-24C Control versus miR-24-2

Non-significant P \ 0.01

Control versus miR-24-4

Non-significant

Control versus miR-24-5

P \ 0.01

miR-24C versus miR-24-2

P \ 0.01

miR-24C versus miR-24-4

Non-significant

miR-24C versus miR-24-5

P \ 0.01

Neonate larvae were allowed to feed on excised leaves of transgenic tobacco plants. The results represent averages of three sets of independent experiments with ten larvae each. The damage of leaves on different transgenic lines was recorded 5 days post-feeding

mechanisms to overcome the lethal effects of insecticides and to develop resistance to insecticidal proteins expressed in crop plants. In such situations, efforts have continued to explore, identify and apply novel insecticidal proteins. Insecticidal protein produced by a strain of Gram-positive soil bacterium Bacillus thuringiensis (Bt) has been successfully

123

expressed in plants and has provided excellent protection against targeted pests (James 2013). Recent reports of the development of resistance against such Bt proteins has prompted efforts to identify novel insecticidal bio-molecules (Ojha et al. 2014). In the present report, we have taken further our observation that microRNAs specific to insects and modulating

Transgenic Res Table 3 Mortality of larvae during insect bioassay using transgenic tobacco plants expressing amiR-24

Treatment Control

miR-24C

miR-24-2

miR-24-4

miR-24-5

Replication

Total number of larvae

Mortality (%) (n = 10 per replication)

I

10

0 (0)

II

10

1 (10)

III

10

0 (0)

I

10

0 (0)

II

10

1 (10)

III

10

1 (10)

I

10

6 (60)

II III

10 10

7 (70) 6 (60)

I

10

4 (40)

II

10

4 (40)

III

10

3 (30)

I

10

5 (50)

II

10

5 (50)

III

10

5 (50)

Source

Sum of square

Degree of freedom

0.33 ± 0.47

0.66 ± 0.47

6.33 ± 0.47

3.66 ± 0.47

5.0 ± 0.47

Mean of square

F value

P value

78.5

\0.0001

ANOVA summary for mortality of larvae Treatment (between groups)

83.733333

4

20.933333

2.666667

10

0.266667

Error Ss/Bl Total Neonate larvae were released on excised leaves of transgenic tobacco plants and incubated at 26 ± 1 °C for 5 days. The larvae were maintained in moist Petriplates with moist Whatman paper circles. The results represent averages of three sets of independent experiments with ten larvae each

86.4

14

HSD Tukey test HSD[.05] = 1.39; HSD[.01] = 1.83 Control versus miR-24C

Non-significant

Control versus miR-24-2

P \ 0.01

Control versus miR-24-4

P \ 0.01

Control versus miR-24-5

P \ 0.01

miR-24C versus miR-24-2 miR-24C versus miR-24-4

P \ 0.01 P \ 0.01

miR-24C versus miR-24-5

P \ 0.01

insect development could be used as insecticidal molecules (Agrawal et al. 2013). Two important characteristics are critical in assessing the utility of miRNAs as insecticidal molecules, first their specificity of activity, and second their stable expression in plants. Our earlier results had revealed that miR-24 is specific to modulating chitinase expression in H. armigera. Further, we had observed that miR-24 of H. armigera is not active against a related polyphagous pest, Spodoptera litura, thereby establishing its

specificity of activity. To evaluate the possibility of presenting insect-specific miRNA in plants, we cloned miR-24 in a backbone of miR-159, a highly expressing miRNA in plants. The vectors bearing amiR-24 and its sequence variants were used to transform tobacco plants. Several transgenic plants showing varying levels of expression of miR-24 were evaluated for protection against predation by H. armigera. The level of protection correlated well with the amount of expression of amiR-24. Such variation in expression

123

Transgenic Res

of transgenes is well known and is often ascribed to the consequences of the site of insertion of the transgene (Pursel and Rexroad 1993; Wall 1996). The transgenic tobacco plants expressing amiR-24 were grown to maturity. No deleterious effects on growth, yield, flowering and longevity were observed, suggesting the absence of any non-target effects of amiR-24 on plant development. Feeding of larvae of H. armigera on plants expressing amiR-24 resulted in the cessation of their molting. The effect was reminiscent of earlier observations of feeding synthetic miR-24 to larvae (Agrawal et al. 2013). The fed larvae, irrespective of the stage of development (L1–L4), failed to molt further and eventually died. The feeding larvae had reduced levels of expression of chitinase, thereby confirming the basis of the correlation between development and death. Taken together, our results have highlighted possible applications of insectspecific miRNAs targeting critical larval function as some novel insecticidal molecules. They demonstrate the specificity of activity which is so critical for their development when delivered through the transgenic route. Acknowledgments We acknowledge the financial support from National Agriculture Innovation project (NAIP) of ICAR (Indian Council for Agricultural Research), India (Grant No. RNAi-2012). We acknowledge the assistance of Dr. Anil Sharma during the statistical analysis. We sincerely thank Tara Ram for technical assistance during rearing of H. armigera larvae.

References Agrawal NB, Sachdev B et al (2013) Development associated profiling of chitinase and microRNA of Helicoverpa armigera identified Chitinase repressive microRNA. Sci Rep 3:2292 Ali I, Amin I et al (2013) Artificial microRNA-mediated resistance against the monopartite begomovirus Cotton leaf curl Burewala virus. Virol J 10(1):231 Ambros V (2004) The functions of animal microRNAs. Nature 431(7006):350–355 Asgari S (2012) MicroRNA functions in insects. Insect Biochem Mol Biol 43(4):388–397 Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116(2):281–297 Behura SK (2007) Insect microRNAs: structure, function and evolution. Insect Biochem Mol Biol 37(1):3–9 Bischoff V, Vignal CC et al (2006) Downregulation of the Drosophila immune response by peptidoglycan-recognition proteins SC1 and SC2. PLoS Pathog 2(2):e14

123

Carrington JC, Ambros V (2003) Role of microRNAs in plant and animal development. Science 301(5631):336–338 Cortina C, Culianez-Macia FA (2004) Tomato transformation and transgenic plant production. Plant Cell Tissue Organ Cult 76(3):269–275 Daborn PJ, Lumb C et al (2012) Using Drosophila melanogaster to validate metabolism-based insecticide resistance from insect pests. Insect Biochem Mol Biol 42(12):918–924 Dowd PF, Lagrimini LM et al (1998) Differential leaf resistance to insects of transgenic sweetgum (Liquidambar styraciflua) expressing tobacco anionic peroxidase. Cell Mol Life Sci 54(7):712–720 Fire A, Xu S et al (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391(6669):806–811 Gelvin SB (2003) Agrobacterium-mediated plant transformation: the biology behind the ‘‘gene jockeying’’ tool. Microbiol Mol Biol Rev 67(1):16–37 Huvenne H, Smagghe G (2010) Mechanisms of dsRNA uptake in insects and potential of RNAi for pest control: a review. J Insect Physiol 56(3):227–235 James C (2013) ISAAA Report on Global Status of Biotech/GM Crops, International Service for the Acquisition of AgriBiotech Applications (ISAAA) Mao Y-B, Cai W-J et al (2007) Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat Biotechnol 25(11):1307–1313 Martin D, Maestro O et al (2006) RNAi studies reveal a conserved role for RXR in molting in the cockroach Blattella germanica. J Insect Physiol 52(4):410–416 Miller SC, Brown SJ et al (2008) Larval RNAi in Drosophila? Dev Genes Evol 218(9):505–510 Miska EA (2005) How microRNAs control cell division, differentiation and death. Curr Opin Genet Dev 15(5):563–568 Napoli C, Lemieux C et al (1990) Introduction of a chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans. Plant Cell 2(4):279–289 Niu Q-W, Lin S-S et al (2006) Expression of artificial microRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nat Biotechnol 24(11):1420–1428 Ohnishi A, Hull JJ et al (2006) Targeted disruption of genes in the Bombyx mori sex pheromone biosynthetic pathway. Proc Natl Acad Sci USA 103(12):4398–4403 Ojha A, Sree KS et al (2014) Analysis of resistance to Cry1Ac in field-collected pink bollworm, Pectinophora gossypiella (Lepidoptera: Gelechiidae), populations. GM Crops Food 5(4):280–286 Ossowski S, Schwab R et al (2008) Gene silencing in plants using artificial microRNAs and other small RNAs. Plant J 53(4):674–690 Pursel VG, Rexroad CE (1993) Status of research with transgenic farm animals. J Anim Sci 71(suppl 3):10–19 Quan GX, Kanda T et al (2002) Induction of the white egg 3 mutant phenotype by injection of the double-stranded RNA of the silkworm white gene. Insect Mol Biol 11(3):217–222 Rajagopal R, Arora N et al (2009) Resistance of Helicoverpa armigera to Cry1Ac toxin from Bacillus thuringiensis is due to improper processing of the protoxin. Biochem J 419:309–316

Transgenic Res Roignant J-Y, Carre C et al (2003) Absence of transitive and systemic pathways allows cell-specific and isoformspecific RNAi in Drosophila. RNA 9(3):299–308 Schneider CA, Rasband WS et al (2012) NIH Image to ImageJ: 25 years of image analysis.’’. Nat Methods 9(7):671–675 Sharma A, Kumar S et al (2010) Bacillus thuringiensis protein Cry6B (BGSC ID 4D8) is toxic to larvae of Hypera postica. Curr Microbiol 62(2):597–605 Tabashnik BE, Van Rensburg JBJ et al (2009) Field-evolved insect resistance to Bt crops: definition, theory, and data. J Econ Entomol 102(6):2011–2025 Terenius O, Papanicolaou A et al (2011) RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental design. J Insect Physiol 57(2):231–245 Tomoyasu Y, Denell RE (2004) Larval RNAi in Tribolium (Coleoptera) for analyzing adult development. Dev Genes Evol 214(11):575–578 Turner CT, Davy MW et al (2006) RNA interference in the light brown apple moth, Epiphyas postvittana (Walker) induced by double stranded RNA feeding. Insect Mol Biol 15(3):383–391

Van der Krol AR, Mur LA et al (1990) Flavonoid genes in petunia: addition of a limited number of gene copies may lead to a suppression of gene expression. Plant Cell 2(4):291–299 Vu TV, Roy Choudhury N et al (2012) Transgenic tomato plants expressing artificial microRNAs for silencing the pre-coat and coat proteins of a begomovirus, Tomato leaf curl New Delhi virus, show tolerance to virus infection. Virus Res 172(1):35–45 Wall RJ (1996) Transgenic livestock: progress and prospects for the future. Theriogenology 45(1):57–68 Zha W, Peng X et al (2011) Knockdown of midgut genes by dsRNA-transgenic plant-mediated RNA interference in the hemipteran insect Nilaparvata lugens. PLoS ONE 6(5): e20504 Zhan X, Kawai S et al (1997) A new approach based on the leaf disc method for Agrobacterium mediated transformation and regeneration of aspen. Plant Sci 123(1):105–112 Zuker M (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31(13): 3406–3415

123