Plant Cell Reports (1992) 11:219-224

Plant Cell Reports 9 Springer-Verlag1992

Transgenic herbicide-resistant Atropa belladonna using an Ri binary vector and inheritance of the transgenic trait Kazuki Saito 1, Mami Yamazaki a, Hiroyuki Anzai 2, Katsuyoshi Yoneyama 3, and lsamu Murakoshi 1 1 Faculty of Pharmaceutical Sciences, Chiba University, Yayoi-cho 1-33, Chiba 260, Japan 2 PharmaceuticalResearch Center, Meiji Seika Kaisha Ltd., Kohoku-ku,Yokohama222, Japan 3 Faculty of Agriculture, Meiji University, Tama-ku, Kawasaki214, Japan Received February 14, 1992/Revisedversion received March 24, 1992 - Communicatedby M. Tabata

Summary. Transgenic Atropa belladonna conferred with a herbicide-resistant trait was obtained by transformation with an Ri plasmid binary vector and plant regeneration from hairy roots. We made a chimeric construct, pARK5, containing the bar gene encoding phosphinothricin acetyltransferase flanked with the promoter for cauliflower mosaic virus 35S RNA and the 3' end of the nos gene. Leaf discs of A. belladonna were infected with Agrobacterium rhizogenes harboring an Ri plasmid, pRi15834, and pARK5. Transformed hairy roots resistant to bialaphos (5 mg/l) were selected and plantlets were regenerated. The integration of T-DNAs from pRi15834 and pARK5 were confirmed by DNA-blot hybridization. Expression of the bar gene in transformed R0 tissues and in backcrossed F1 progeny with a non-transformant and selffertilized progeny was indicated by enzymatic activity of the acetyltransferase. The transgenic plants showed resistance towards bialaphos and phosphinothricin. Tropane alkaloids of normal amounts were produced in the transformed regenerants. These results present a successful application of transformation with an Ri plasmid binary vector for conferring an agronomically useful trait to medicinal plants.

Abbreviations: CaMV: cauliflower mosaic virus, NPTII: neomycin phosphotransferase II, PAT: phosphinothricin acetyltransferase, PPT: phosphinothricin.

Introduction It is becoming attractive to confer agronomically useful traits to medicinal plants by modern molecular genetic technology (Saito et al. 1992). Some progress along this line has already been made for several crop plants (Gasser et al. 1989). The herbicide-resistant trait has been a successful target of genetic engineering of crop plants in the last couple of years. In particular, the bar gene encoding phosphinothricin (PPT) acetyltransferase (PAT) from Streptomyces hygroscopicus was transferred and expressed in transgenic plants of tobacco, potato, tomato (De Block et al. 1987), Brassica (De Block et al. 1989) and maize

Correspondence to: K. Saito

(Spencer et al. 1990). PAT inactivates the synthetic herbicide PPT (BasLa| H0chst), which acts as an analogue of L-glutamic acid in plant cells and consequently inhibits glutamine synthase to cause cell death. The antibiotic herbicide bialaphos (Herbiace| Meiji Seika Kaisha Ltd.) is a tripeptide containing PPT and two L-alanine residues produced by S. hygroscopicus possessing bar. Bialaphos releases PPT by endogenous peptidase in plant cells and inhibits glutamine synthase. The binary vector system based on an Agrobacterium-Ri plasmid can be efficiently used to produce transgenic hairy roots containing the T-DNAs of a helper Ri plasmid and a second binary vector (Simpson et al. 1986). This technique depends on the fact that the T-DNA derived from Ti plasmid can be mobilized in trans by vir gene products of the Ri plasmid. In some cases, the mature plants can be regenerated from hairy roots (Tepfer 1984, Tepfer et al. 1989). We have been exploring the genetic transformation of pharmaceutically important plants by means of Agrobacterium-Ri plasmid binary vector (Saito et al. 1990 a,b, 1991a). Atropa belladonna (Solanaceae) is one of the widely used medicinal plants in the world and contains tropane alkaloids, hyoscyamine, scopolamine and 68hydroxyhyoscyamine. These alkaloids show several pharmacological activities such as parasympathetic blocking activity (Trease and Evans 1983). The production of tropane alkaloids by hairy root culture was reported (Kamada et al. 1986, Jung et al. 1987). However, no report has been published on transfer of engineered genes and inheritance of a transgenic trait. In this study, we made transgenic fertile A. belladonna plants integrated with a herbicide resistant bar gene by means of Agrobacterium-Ri vector. The bar trait was transferred to progeny.

Materials and Methods Plasmid construction. RecombinantDNA manipulationwas followed essentiallyas describedby Maniatiset al (1982). Two 18 mer synthetic oligonucleotides (5'-GATCCATGAGCCCAGAAC-3' and 5'-

220 CGTCGTTCTGGGCTCATG-3'), and the FokI-SalI fragment of bar gene in pMSB217 were cloned into BamHI-SalI sites of pTZ18R (Pharmaeia Inc.) to give pARK1, in which the original GTG start eodon was replaced with ATG by the synthetic oligonucleotides (Fig. 1). The BamHI-SalI fragment of pARK1 and the SalI-StuI fragment of pMSB217 were ligated into BamHI-SmaI sites of pTZ18R to produce pARK2. Then, the BamHI-SaeI fragment of pARK2 containing the entire reading frame of bar was inserted into BamHLSacI sites of pBI121 (Jefferson et al. 1987) to give a binary expression vector pARK5. In pARK5, the bar gene was placed under the transcriptional control of the promoter for cauliflower mosaic virus 35S RNA (CaMV35S) and flanked with the terminator of nos gene for nopaline synthase. pARK5 was mobilized from Escherichia coli HB101 to A. rhizogenes (Rif R) harboring pRi15834, a wild agropine-type Ri plasmid, by triparental mating using pRK2013 as a helper plasmid (Figurski et al. 1979). The transconjugant was selected on a YEB plate (Sg/l beef extract, lg/l yeast extract, 5g/1 peptone, 5g/l sucrose, 2mM MgSO4, 15g/l agar, pH 7.2) supplemented with 50 mg)l rifampicin and 25 mg/l kanamycin.

Fo~I Sail

PAT and neomycin phosphotransferase H (NPT-II) assays. PAT activity was determined by acetylation of PPT with 14C-acetyl-CoA by using thin layer chromatography (De Block et al. 1987). The NPT-/I assay was carried out as described previously (Reiss et al. 1984). Herbicide application. The commercially available Herbiace| and Basta| were used. The 0.2% aqueous solution of the formulated Herbiace| (bialaphos sodium salt content, 20%) and the 1% solution of Basta| (PPT ammonium content, 18.5%) were applied to the leaves of plants as recommended by the suppliers. Production of alkaloids. Tropane alkaloids were extracted from the dried leaves (50~ 6hr) as described previously (Saito et al. 1989b). Concentration of the alkaloids (hyoscyamine, scopolamine and 68hydroxyhyoscyamine) were determined by gas chromatography-mass spectrometry (GC/MS) after trimethylsilylation with N,OBis(trimethylsilyl)acetamide using sparteine as an internal standard. The silylated alkaloids were chromatographed on fuse silica capillary column DB-1 (J & W Scientific, Cal., USA, 0.25mm x 30m) with a programmed temperature gradient (100-280~ The combined GC/MS system (Hewlett Packard, 5980II/5971A) was used by selected-ionmonitor mode. Miscellaneous techniques. Protein was determined by the method of Bradford (1976) using the kit supplied by Bio-Rad Laboratory (Richmond, Cal. USA). Agropine and marmopine were detected as reported previously (Saito et aL 1989a).

I

bar

GTGAGCCCAGAACGACGCCCG

slarl

5'-GATCC~AGCCCAGAAC-3' 3'- GTACTCGGGTCTTGCTGC-5'

FOkl

p'fZ18R I BamHI +Sail

pARK1 : Ba~HI

1

Sall

Sail

ST[I

p'rZ18R

PBI121

Ba~H,

pARK2 : I I

BamHI + Sacl

Sa,,

Bglll

SIul

I

I I

+BarnHl SrnalI

Plant transformation, regeneration and progeny. Agrobacterium containing pRi15834 and pARK5 was cultured in liquid minimal A medium (Miller 1972) for 2 days at 28~ Leaves of sterile shoot culture of A. belladonna grown on the modified A1 medium (half-strength Murashige and Skoog (1962) salts except for Fe 2+ ion at the original concentration, 1% sucrose and 0.8% agar, pH 5.7) were used for transformation by the method described previously (Saito et al. 1989a). The hairy roots excised from leaf discs were selected on the B5 agar medium (Gamborg et al. 1968) supplemented with 5 mg/1 bialaphos for 2 weeks. The resistant hairy roots were cultured further in the same agar medium without bialaphos until adventitious shoots were regenerated. The shoots were isolated and transferred onto a new agar plate for roofing. The rooted plants were propagated as sterile shoot cultures and then transferred to culture soil. The progenies were obtained by handpollinated backcross to a non-transformant or by self-feailization. DNA-blot hybridization. Plant DNA was extracted as described (Dellaporta et al. 1983) and further purified with a Qiagen tube (Qiagen Inc., Cal. USA). DNA was then digested with EcoRV and electrophoresed in a 1.2% agarose gel, transferred to Hybond N+ filter (Amersham, Bucks, UK), and hybridized with the random prime labelled 32p-probes (Takara, Kyoto, Japan) by the protocols recommended by the suppliers. The EcoRV-digested fragments of pLJ1 were used as the probe for TL-DNA of pRi15834 (Jouanin 1984, Slightom et al. 1986). The purified BamHI-EcoRI fragment of pARK5 was used as the probe for the bar gene. The filter was finally washed with 0.1x SSC, 0.1% SDS at 65~

]

pMS

BQIII Stul

I Stul/Smal

~.~Sacl

II

I

NPTII /

pARK5

P35S

11.7 kb \

'\

Fig. 1. Construction of the expression vector pARK5 containing the chimeric bar gene. The original GTG start codon was replaced with ATG by the synthetic oligonucleotides. In pARK5, the bar gene was placed under the control of CaMV35S promoter. RB, right border;, LB, left border; Pnos, promoter of nopaline synthase gene (nos); 3' nos, 3' end of nos; P3ss, promoter of CaMV35S RNA.

Results

Construction of the chimeric bar gene The chimeric bar gene for expression in plant cells was constructed as shown in Fig. 1. The initiation codon for translation of the bar gene in S. hygroscopicus was GTG. This unusual start codon was replaced with ATG by the synthetic oligonucleotide. The entire coding sequence of bar gene in the BamHI-SacI fragment of pARK2 was inserted into the corresponding site of the binary vector pBI121 (Jefferson et al. 1987) to yield a expression binary vector pARK5. In the T-DNA region of pARK5, the bar gene was placed between the CaMV35S promoter and the nos terminator. The chimeric NPT-II gene was also present in the T-DNA as the reporter gene for transformation. This plasmid was introduced in A. rhizogenes harboring a wild Ri plasmid, pRi15834, for plant transformation. Plant transformation and selection of hairy roots Initially, the optimum concentration of bialaphos for the selection of transformants was determined using leaf discs and stem segments of sterile A. belladonna. The

221 Fig. 2. Regeneration of transgenic plant of Atropa belladonna (done A1) from bialaphos resistant hairy roots. (a) Induction of hairy roots on leaf discs. (b) Selection on B5 agar medium supplemented with 5mg/l bialaphos. (c) (d) Formation of adventitious shoots on B5 agar medium. (e) Rooting of regenerated shoots on B5 medium. (f) Regenerated plant A1 on culture soil showed characteristic phenotype due to the expression of Ri plasmid genes.

concentration of 5 mg/l of bialaphos in B5 agar medium was sufficient to inhibit callus formation on the excised plant tissues. More than 95% of explants assayed turned yellow within 2 weeks at this concentration of bialaphos. Thus, we decided the concentration of bialaphos to be 5 mg/l. Within 2 weeks after leaf-disc infection by co-culture with Agrobacterium, the hairy roots appeared at veins of the leaves on B5 agar medium (Fig. 2a). Thirty five clones of hairy roots were excised from leaf discs and selected on the B5 agar medium containing bialaphos (5 rag/l) for 2 weeks. Sixteen clones out of 35 grew on the selection medium. The adventitious shoots were regenerated spontaneously from hairy roots without addition of phytohormones (Fig. 2 c,d). The regenerated shoots could be isolated and rooted again in the B5 medium to form plantlets (Fig. 2e). The regenerated plant was transferred on culture soil (Fig. 2f). We have obtained three regenerated clones (A1, A8, E2) from the hairy roots. The phenotype of the regenerated clone A1 (Fig. 2f) showed the characteristic features of a regenerated plant from hairy roots caused by the expression of T-DNA genes of a Ri plasmid, such as wrinkled leaves and short internodes.

Confirmation of transgenic state of the transformants The integration of the T-DNAs of pRi15834 and pARK5 was analyzed by DNA-blot hybridization (Fig. 3). Plant DNA was digested with EcoRV which cut once within the T-DNA region of pARK5. The presence of TL-DNA sequence of pRi15834 was indicated in all transformants examined by using the EcoRV-digested fragments of pLJ1 (Jouanin 1984) as the probe (Fig. 3a). The same filter was re-hybridized with BamHI-EcoRI fragment of pARK5 covering the bar gene and the nos terminator as the probe (Fig. 3b). The results indicated that all bialaphos-selected clones except for E2 contained one to six copies of T-DNA of pARK5. The control hairy root (clone HR1) transformed with only pRi15834 showed the hybridization signals only with the pLJ1 probe but not with the pARK5 probe.

Fig. 3. DNA-blot hybridization of transformants. Plant DNA was digested with EcoRV and electrophoresed in 1.2% agarose gel, transferred to nylon filter and hybridized with the 32p-probes. Lanes: 1, non-transformed control; 2, clone HR1, control hairy root transformed only with pri15834; 3, clone A1; 4, clone A3; 5, clone A8; 6, clone B1; 7, clone D20; 8, clone El; 9, clone E2; 10, clone El2; 11, clone El4; 12, 10pg of BamHI-SacI fragment (bar) of pARK5; 13, 50pg of the same bar fragment; 14, 100pg of the same bar fragment. (a) Hybridization with EcoRV-digested fragments of pLll Oouanin 1984) containing entire TL-DNA of pRi15834 as the probe. (b) Hybrodization with BamHI-EcoRI fragment of pARK5 as the probe.

All these transformants produced agropine. In some transformants (A3, A8, D20, E2), mannopine was also detected (data not shown). These indicated the integration of TR-DNA of pRi15834 in the plant genome (De Paolis et al. 1985).

222

Expression of chimeric genes and resistance towards herbicide The expression of chimeric bar gene was analyzed by enzymatic assay of PAT (Fig. 4). The clones, A1, A3, A8, El, El2 and El4, showed the positive activities. The clones, B 1 and D20, gave no detectable activities, although the bar gene of pARK5 was integrated into the genome of these clones. NPT-II activities by the expression of NPT-II gene present in pARK5 were also measured in these transformed clones. The clones, A1, A3, B1, D20, El, El2 and El4, showed the positive NPT-II activities (data not shown). The clone E2 gave no activities of both PAT and NPT-II. This negative clone is certainly the "escaped" clone during the selection with bialaphos. To ascertain resistance of the regenerated transformants towards the commercial formulation of the herbicides, we applied the bialaphos solution to the regenerated plant of clone A1 and the control regenerant clone HR1 from hairy roots transformed only with pri15834 (Fig. 5). The control leaf applied with bialaphos died after 10 days. On the contrary, the A1 plant is fully resistant towards the herbicide. The A1 plant was resistant towards PPT as well as bialaphos.

Inheritance of a transgenic trait in progeny The F1 progenies of A1 clones were obtained by backcross with a non-transformed parent. Fig 6 shows the results of PAT assay of the F1 offspring clones of A1. Eleven out of 15 F1 offspring clones in both cases of transgenic female and male parent gave positive PAT activity (Table 1). Selffertilized progeny of A8 also showed the PAT activity (7/20). These results indicated transmission of dominant bar trait by inheritance.

Production of tropane alkaloids in regenerated transgenic plants The production of tropane alkaloids in trangenic plants was determined by GC/MS (Table 2). All plants produced hyoscyamine as the major alkaloid, and scopolamine and 613-hydroxyhyoscyamine as the minor bases. There were some differences in the levels of alkaloid accumulation in the regenerated plants, in particular, low contents in clone A8. These differences may result from either the differences of age and physiological conditions of plants or the variations among clones derived from hairy roots. Discussion The binary vector system based on Agrobacterium-Ri plasmid has been applied to several plaint species (Shahin et

Fig. 4. Expression of PAT activity in transformants. The reaction products of 14C-acetyl-CoA and PPT in the presence of protein extracts of plant tissues were analyzed by thin layer chromatography as described previously (De Block et al. 1987). Lanes: 1, ll-14C]-acetyl CoA (2GBq/mmole); 2, clone HR1, control hairy root transformed only with pri15834 as a negative control; 3, the negative control plus the purified PAT from S. hygroscopicus; 4, clone A1; 5, clone A3; 6, clone B1; 7, clone A8; 8, clone D20; 9, clone El; 10, clone E2; 11, clone El2; 12, clone El4.

Fig. 6. Expression of PAT activity in progenies. Assay was carried out by the same method in Fig. 4. Lanes: 1, [1-14C]-acetyl-CoA; 2, purified PAT from S. hygroscoplcus; 3, clone HR1, a negative control; 4, R 0 of clone A1; 5-9, independent FI progenies of transgenic female parent of clone A1; 10-14, independent F1 progenies of transgenic male parent of clone A1. Fig. 5. Resistance of the transgenic regcnerant expressing bar gene towards bialaphos. The 0.2% aqueous solution of the commercially formulated Herbiace| 0aialaphos sodium salt content, 20%) was applied to one leaf of plant as recommended. by the supplier. (a) 0a) Clone HRI, control regenerant from hairy roots transformed only with pRi15834. After I0 days of application, the leaf applied with bialaphos (indicated by arrow) died completely. (c) Clone A1 after 10 days of application. No change was observed in the leaf applied with bialaphos (indicated by arrow).

223 Table 1. Inheritance of PAT activity in progeny.

Progeny A1 femalex non-transformedmale A1 male x non-transformedfemale A8, self-fertilized

Numberof PAT (+) / Total 11/15 11/15 7/20

PAT activity was determinedin the independentprogeniesas described in Materials and Methods. al. 1986, Simpson et al. 1986, Hamil et al. 1987, Stougaard et al. 1987, Saito, et al. 1990 a,b, 1991a). However, the foreign genes introduced in these studies were the marker genes such as for NPT-II and g-glucuronidase. In the present study, we have transferred and expressed the bar gene for an agronomically useful trait into a pharmaceutically important plant using an Ri binary vector. The Ri plasmid vector has some characteristic features compared with a completely disarmed Ti vector as follows: (1) one can easily obtain transgenic roots integrated with any desirable foreign genes on a second binary vector in high frequency; in the present study 46% (16/35) gave double transformation; (2) this technique can be used for genetic manipulation of secondary metabolism of rapidly growing hairy roots that produce secondary products in high yield; (3) in some plant species, mature plants can be regenerated from hairy roots and offspring is also obtained (Tepfer 1984, Tepfer et al. 1989). These features could be advantages in some cases of genetic engineering. However, the plants transformed with Ri vector also show unfavorable "hairy root syndrome" for certain application to transgenic plants. In the case of A. belladonna, the regeneration of plantlet occured spontaneously from hairy roots on the agar medium without addition of any phytohormones. A few reports are available on inheritance of the presence of T-DNAs and expression genes encoded on T-DNA in the progeny of regenerants from hairy roots (Tepfer 1984, Constantino et al. 1984, Sukhapinda et al. 1987). In some cases, the expression of integrated genes in offspring generation was suppressed in spite of the presence of full-length transgenes in progeny. In the present study, 73% (11/15) of the backcrossed F1 progeny and 35% (7/20) of S 1 progeny gave the PAT activity (Table 1). The reason for these abnormal segregation ratios is not clear for the moment. However, the fact of transmission of transgenic trait is a promising indication for molecular breeding of A. belladonna by the Ri vector, although detailed analysis would be necessary to investigate inheritance and expression of transgenes at molecular level. The selection of hairy roots with bialaphos was satisfactory in A. belladonna. Only one clone (E2) was a possible escape in bialaphos selection, because this clone had neither detectable hybridization bands in DNA-blot assay nor PAT and NPT-II activities. The clones, B 1 and D20, had the integrated T-DNA of pARK5 and showed the positive NPT-II activities, but these clones gave no PAT activities. Since the PAT assay was carried out after finishing the selection with bialaphos, the bar gene could be possibly inactivated by methylation or developmental regulation in these clones. Other explanation could be that very low level of expression of PAT activity might be sufficient for the resistance to 5 mg/1 of bialaphos in the

Table 2. Accumulationof tropane alkaloids in leaves of transgenic

regeneratedplants of Atropa belladonna. Plant clone

Tropane alkaloid (%) Hyoscyamine

Untransformed control ttR-1c A1 A8

Scopolamine 6g-Hydroxyhyoscyamine

0.212a (0.017)b 0.165 (0.014) 0.292 (0.023) 0.278 (0.016) 0.073 (0.009)

0.066(0.005)

0.028(0.002) 0.031(0.002) 0.091(0.005) 0.015(0.001) 0.030(0.004) 0.041(0.005)

a % Dry weight, b % Fresh weight, c Transformed with only pRi15834. The tropane alkaloids were extractedfrom dry leaves and determined by GC/MS by selected-ion-monitormode using sparteine as an internal standard as describedin Materials and Methods. Data are the means of triplicate determinations.

selection medium. The expression of bar gene can be an excellent selectable marker in the plant cells, in which kanamycin selection does not work well. The substantial level of alkaloid accumulation was observed in transgenic A. belladonna integrated with TDNAs o f the Ri plasmid and the bar gene. The concenlrations of alkaloids were almost comparable as those reported previously in the regenerants of A. belladonna from hairy roots (Jung et al. 1987). This result suggested that the expression of the bar gene and the genes encoded in Ri plasmid T-DNA does not incite remarkable metabolic effects in the secondary metabolism of A. belladonna as observed in the case of expression of foreign cytochrome P450 gene in Nicotiana tabacum (Saito et al. 1991b). However, in the regenerants of N. tabacum from hairy roots, the contents of nicotine alkaloids were rather higher than those of normal plants (Ko et al. 1988, Saito et al. 1991c). These metabolic effects of expression of foreign genes, in particulars, on secondary metabolism should be clarified in further investigations. In conclusion, our present invesigation presents the first successful application for conferring an agronomically useful trait to medicinal plants by an Ri plasmid vector.

Acknowledgments. We thank Dr. L. Jouanin 0NRA, Versailles, France) for a gift of pL.I1. Claforan| was from Htchst Japan (Tokyo,Japan). This research was supported, in part, by Grants-in Aids from the Ministry of Education, Science and Culture, Japan, from the Japan Health Sciences Foundation, from Iwaki Scholarship Foundation, and from the Research Foundation for Pharmaceutical Sciences, Japan. M.Y. is supportedby JSPS Fellowships for Japanese Junior Scientists. References

Bradford, M. M. (1976) Anal. Biochem., 72, 248-254 Constatino, P., Spano, L., Pomponi, M., Benvenuto, E. and Ancora, G. (1984) J. Mol. Appl. Genet., 2, 465-470 De Block, M., Botterman, J., Vandewiele, M., Dockx, J., Thoen, C., Gossele, V., Rao Movva, N., Thompson, C., Van Montagu, M. and Leemans, J. (1987) EMBO J., 6, 2513-2518 De Block, M., De Brouwer, D. and Tenning, P. (1989)

224 Plant Physiol., 91,694-701 Dellaporta, S. L., Wood, J. and Hicks, J. B. (1983) Plant Mol. Biol. Reporter, 1, 19-21 De Paolis, A., Mauro, M. L., Pomponi, M., Cardarelli, M., Spano, L. and Costantino, P. (1985) Plasmid, 13, 1-7 Figurski, D. H. and Helinski, D. R. (1979) Proc. Natl. Acad. Sci. USA, 76, 1648-1652 Gamborg, O. L., Miller, R. A. and Ojima, K. (1968) Exp. Cell Res., 50, 151-158 Gasser, C. S. and Fraley, R. T. (1989) Science, 244, 1293-1299 Hamil, J. D., Prescott, A. and Martin, C. (1987) Plant Mol. Biol., 9 573-584 Jefferson, R. A., Kavanagh, T. A. and Bevan, M. (1987) EMBO J., 6, 3901-3907 Jouanin, L. (1984) Plasmid, 12, 91-102 Jung, G. and Tepfer, D. (1987) Plant Sci., 50, 145-151 Kamada, H., Okamura, N., Satake, M., Harada, H. and Shimomura, K. (1986) Plant Cell Rep., 5, 239-242 Ko, S. K., Ebizuka, Y., Noguchi, H. and Sankawa, U. (1988) Chem. Pharm. Bull., 36, 4217-4220 Maniatis, T., Fritsch, E. F. and Sambrook, J. (1982) Molecular Cloning A Laboratory Manual. New York, USA: Cold Spring Harbor Laboratory Miller J. H. (1972) Experiments in Molecular Genetics. New York, USA: Cold Spring Harbor Laboratory Murashige, T.and Skoog, F. (1962) Physiol. Plant, 15, 473-479 Reiss, B., Sprengel, R., Will, H. and Schaller, H. (1984) Gene, 30, 211-218 Saito, K., Murakoshi, I., Inz6, D. and Van Montagu, M. (1989a) Plant Cell Rep., 7, 607-610 Saito, K., Yamazaki, M., Takamatsu, S., Kawaguchi, A.

and Murakoshi, I. (1989b) Phytochemistry, 28, 23412344 Saito, K., Kaneko, H., Yamazaki, M., Yoshida, M, and Murakoshi, I. (1990a) Plant Cell Rep., 8, 718-721 Saito, K., Yamazaki, M., Shimomura, K., Yoshimatsu, K. and Murakoshi, I. (1990b) Plant Cell Rep., 9, 121124 Saito, K., Yamazaki, M., Kaneko, H., Murakoshi, I., Fukuda, Y. and Van Montagu, M. (1991a) Planta, 184, 40-46 Saito, K., Noji, M., Ohmori, S., Imai, Y. and Murakoshi, I. (1991b) Proc. Natl. Acad. Sci. USA, 88, 7041-7045. Saito, K., Yamazaki, M., Kawaguchi, A. and Murakoshi, I. (1991c) Tetrahedron, 47, 5955-5968. Saito, K., Yamazaki, M., and Murakoshi, I. (1992) J. Nat. Prod., 55, 149-161. Shahin, E. A., Sukhapinda, K., Simpson, R. B. and Spivey, R. (1986) Theor. Appl. Genet., 72, 770-777 Simpson, R. B., Spielmann, A., Margossian, L. and McKnight, T., D. (1986) Plant Mol. Biol., 6, 403-415 Slightom, J. L., Durand-Tardif, M., Jouanin, L. and Tepfer, D. (1986) J. Biol. Chem., 261, 108-121 Spencer, T. M., Gordon-Kamm, W. J., Daines, R. J., Start, W. G. and Lemaux, P. G. (1990) Theor. Appl. Genet., 79, 625-631 Stougaard, J., Abildsten, D. and Marcker, K. A. (1987) Mol. Gen. Genet., 207, 251-255 Sukhapinda, K. Spivey, R., Simpson, R. B. and Shahin, E. A. (1987) Mol. Gen. Genet., 206, 491-497 Tepfer, D. (1984) Cell, 37, 959-967 Tepfer, D., Metzger, L. and Prost, R. (1989) Plant Mol. Biol., 13, 295-302 Trease, G. E. and Evans, W. C. (1983) Pharmcognosy 12th edition. Eastbourne, UK: Bailliere TindaU