CED
Clinical dermatology • Original article
Clinical and Experimental Dermatology
Transforming growth factor-b1 gene polymorphism in mycosis fungoides A. A. Zayed,1 M. R. E. Abdel-Halim,1 K. S. Sayed,1 F. N. Mohammed,2 D. M. Hany2 and K. S. Amr3 1 Dermatology Department, Faculty of Medicine, Cairo University, Egypt; and 2Dermatology Department and 3Molecular Genetic Department, National Research Centre (NRC), Cairo, Egypt
doi:10.1111/ced.12404
Summary
Background. Dysregulation in transforming growth factor (TGF)-b1 signalling pathways has been linked to cancer. Aim. To study the association between single nucleotide polymorphisms (SNPs) of the TGF-b1 gene and mycosis fungoides (MF). Methods. Using restriction fragment length polymorphism analysis, SNPs in the TGF-b1 gene were studied in 55 patients with MF of different stages and in 100 apparently healthy controls. Results. A significant difference was found between patients and controls in distribution of the different TGF-b1 genotypes, with mutant forms (T/C, T/T) encountered significantly more often in patients with MF (P < 0.001). The heterozygous genotype (T/C) was significantly associated with patch stage MF, whereas the homozygous genotype (T/T) was significantly associated with tumour stage (stage IIb) MF (P = 0.001), although this study included only a small number of these patients. Conclusions. Mutant TGF-b1 genotypes are significantly associated with MF in Egyptian patients, with the homozygous genotype (T/T) having a stronger association with tumour stage (stage IIb).
Introduction Mycosis fungoides (MF) is the most common form of cutaneous T-cell lymphoma (CTCL).1 The clinical consequences reflect not only the presence of malignant skin-homing lymphocytes, but also a complex reaction of the immune response to these cells.2 Regulatory T cells (Tregs) are a specialized subpopulation of CD4+ T cells with immunosuppressive effects, including suppression of anti-tumour responses in various cancers.3 Accordingly, they seem to play a role in the aetiopathogenesis of various malignancies, including CTCLs.4 Tregs secrete transforming growth factor (TGF)-b1, an immunosuppressive cytokine, which is critical for
Correspondence: Dr Faisal Nouredin Mohammed, National Research Centre, Al Tahrir St. Dokki, Giza 12622, Egypt E-mail: [email protected] Conflict of interest: the authors declare that they have no conflicts of interest. Accepted for publication 16 February 2014
806
Clinical and Experimental Dermatology (2014) 39, pp806–809
the development and differentiation of Tregs to inducible Tregs, and is considered the mechanism by which these cells mediate immunosuppression.5 TGF-b1 is a potent growth inhibitor for a wide variety of cell types including haematopoietic cells, and several cancers have been attributed to dysregulation of the TGF-b1 signalling pathway.6 Functional regulatory polymorphisms in the TGF-b1 gene are associated directly with interindividual variability in TGF-b1 plasma levels and modified risk of breast,7 lung,8 colorectal9 and prostate10 cancer. We therefore hypothesized that, similar to other cancers, polymorphisms in TGF-b1, the key cytokine of Tregs, may be present in patients with MF. Accordingly, we aimed to evaluate the association between MF and single nucleotide polymorphisms (SNPs) in the TGF-b1 gene.
Methods The study was approved by the ethics committee at the Dermatology Department, Faculty of Medicine,
ª 2014 British Association of Dermatologists
TGF-b1 gene polymorphism in MF A. A. Zayed et al.
Cairo University, and informed consent was obtained from all participants. Participants
This was a case–control study carried out in the Dermatology Outpatient Clinic of the Faculty of Medicine, Cairo University. During the period March 2011–2012, we recruited 55 patients [25 women (45.5%), 30 men (54.5%); mean SD age 39.24 13.02 years, range 17–65] with MF at various stages into this TGF-b1 gene polymorphism study. The control group comprised 100 apparently healthy volunteers [30 women (30%), 70 men (70%); mean SD age 32 7.43 years, range 20–55]. Patients and controls were age and sex matched (P = 0.63 and 0.82 respectively). Diagnosis of MF was based on clinical, histopathological, immunophenotypic and gene rearrangement findings. Disease staging was carried out in accordance with the TNM staging system.11 Transforming growth factor-b1 gene polymorphism
Blood samples were collected, and genomic DNA extracted (DNAzol; Invitrogen, Carlsbad, CA, USA) following the standard protocols given by the manufacturer. Reaction mixtures were prepared, containing 200 ng DNA, 1 U Taq polymerase (Invitrogen), 0.2 mmol/L dNTPs and 0.5 mmol/L of each primer (Invitrogen), made up to 25 mL with PCR buffer (10 mmol/L Tris–HCl pH 8.3, 50 mmol/L KCl and 1.0 mmol/L MgCl2). The primer sequence was based on the study of Syrris et al.12 (Table 1). Using a thermal cycler (PTC-100 Programmable Thermal Controller; MJ Research, Watertown, MA, USA), PCR was performed with an initial denaturation at 94 °C for 3 min, followed by 33 cycles of denaturation at 94 °C for 50 s, annealing at 66 °C for 1 min, and elongation at 72 °C for 1 min, with a final elongation step of 10 min at 72 °C. An amplification check was carried out using electrophoresis with a 2.5% agarose gel (Invitrogen) in 0.5% TAE buffer (40 mmol/L Tris acetate, 5.7% glacial acetic acid, 2 mmol/L Na2EDTA.2H2O) containing 0.25 mL ethidium bromide. Following this, 3.0 mL of the amplification product was digested with 4 U PstI restriction endonuclease enzyme (Roche Diagnostics, Hague Road, IN, USA) in a 12 mL volume mixture containing 0.9 mL SuRE/Cut Buffer H (Roche Diagnostics). The reaction mixture was incubated at 37 °C for 1 h. Restriction enzyme-digested PCR products were subjected to electrophoresis in a 2.5% aga-
ª 2014 British Association of Dermatologists
rose gel (Seakem; FMC, Rockland, ME, USA) at 270 mV for 2 h in 200 mL Tris–borate–EDTA buffer. Using ultraviolet transillumination after ethidium bromide staining, the products were visualized and the size of the product was determined using a 123 bp ladder (Invitrogen). In each digestion, control samples were included from subjects who had been confirmed by DNA sequencing as Leu/Leu, Leu/Pro or Pro/Pro. Statistical analysis
Data are presented as mean SD and range, or frequencies (number of cases) and percentages when appropriate. Comparison of numerical variables between the study groups was carried out using the Mann–Whitney U-test for independent samples when comparing two groups, and the Kruskal–Wallis test with post hoc multiple two-group comparisons when comparing more than two groups. For comparing categorical data, the v² test was performed. The Fisher exact test was used when the expected frequency was < 5. P < 0.05 was considered significant. All statistical calculations were performed using SPSS software (version 15 for Microsoft Windows; SPSS Inc., Chicago, IL, USA).
Results Mean disease duration was 8.06 7.75 years (range 1–40). The patient group comprised 54 cases with classic MF and 1 case with erythrodermic MF. The classic cases were composed of 27 (49.1%) patch stage, 23 (41.8%) plaque stage and 4 (7.3%) tumour stage. Disease stages were 13 (23.6%) stage Ia, 28 (50.9%) stage Ib, 9 (16.4%) stage IIa, 4 (7.3%) stage IIb and 1 (1.8%) stage III. Transforming growth factor-b1 genotype analysis
Three TGF-b1 genotypes were identified: C/C normal (wild type), T/C (mutant heterozygous) and T/T (mutant homozygous). Table 2 illustrates the incidence of various genotypes in patients and controls. A statistically significant difference in genotype distribution was found between the groups, with the mutant genotypes being significantly more frequent in patients with MF than in controls (98.2% and 69% respectively, P < 0.001). The odds ratio between cases Table 1 Primers used for sequencing analysis. Primer Forward Reverse
Sequence 50 ?30 ACCACACCAGCCCTGTTCGC AGTAGCCACAGCAGCGGTAGCAGCTGC
Clinical and Experimental Dermatology (2014) 39, pp806–809
807
TGF-b1 gene polymorphism in MF A. A. Zayed et al.
Table 2 Distribution of different genotypes of the TGF-b1 gene in patients with mycosis fungoides and controls. TGF-b1 genotype
Patients, n (%)
Controls, n (%)
C/C T/C T/T
1/55 (1.8) 44/55 (80.0) 10/55 (18.2)
31/100 (31) 51/100 (51) 18/100 (18)
P < 0.001*
*Significant. TGF, transforming growth factor.
of MF with the homozygous genotype and those with the heterozygous genotype was < 1. Table 3 illustrates the distribution of the various genotypes in relation to clinical type (P = 0.001) and disease stage (P < 0.001). All tumour stage cases (4/4) had the T/T homozygous genotype while all patch stage cases (27/27) and the majority of plaque stage cases (16/23) had the T/C heterozygous genotype. All patients with stage Ia (13/13) and the majority of patients with stage Ib (27/28) had the T/C heterozygous genotype. Most of the stage IIa patients (5/9) and all the stage IIb patients (4/4) had the T/T homozygous genotype. Distribution of genotypes was not affected by sex or age in patients (P = 0.59 and 0.96, respectively) or controls (P = 0.94 and 0.99, respectively).
Discussion In this study, we found that mutant TGF-b1 genotypes were significantly associated with MF. To our knowledge, this is the first study in Egypt to investigate a possible association between TGF-b1 SNPs and suscepTable 3 Comparison between the three genotypes of the TGF-b1 gene in relation to the clinical data of patients with MF. TGF-b1 genotype C/C (wildtype) Clinical type of MF, Classic Patch stage Plaque stage Tumour stage Erythrodermic Stage, n (%) Ia Ib IIa IIb III
T/C (heterozygous)
T/T (homozygous)
P
Conclusion
n (%) – 1 (100) – –
27 (61.4) 16 (36.4) – 1 (2.3)
– 6 (60) 4 (40)
0.001*
– – 1 (100) – –
13 (29.5) 27 (61.3) 3 (6.8) 0 (0) 1 (2.3)
0 1 (10) 5 (50) 4 (40) –
< 0.001*
*Significant. MF, mycosis fungoides; TGF, transforming growth factor.
808
tibility to MF. To date, only one study has evaluated TGF-b1 gene polymorphisms in MF; that study, carried out in the USA by Hodak et al., evaluated 33 patients with patch-stage MF and found no significant results.13 The differences in results between that study and our current study might be related to population differences. In addition, many conditions in which heritable factors play a role are not due to a single gene defect, but rather are thought to be determined by the interaction of multiple genetic factors, both with each other and with the environment. The aetiopathogenesis of such conditions is referred to as ‘complex’ or ‘multifactorial’. MF, vitiligo and psoriasis vulgaris are examples of such conditions.14 In normal cells, TGF-b stops cell proliferation by arresting the cell cycle at the G1 phase, and also can induce differentiation or promote apoptosis. When a cell is transformed into a cancer cell, parts of the TGF-b signalling pathway are mutated, and TGF-b1 no longer controls the cell, allowing it to proliferate in an uncontrolled manner.15 Whether the TGF-b1producing Tregs in MF are malignant Tregs (putative origin of MF) or are part of the anti-tumour immune response is still not clear. Assuming that these Tregs are malignant, the detected polymorphisms might have altered the TGF-b1 signalling pathway, resulting in a possible stimulatory effect on the proliferation of the malignant lymphocytes. Although there was a significant difference in distribution of genotypes in the different clinical types and disease stages, with all tumour-stage cases (stage IIb) having the homozygous genotype and all patch-stage cases having the heterozygous genotype, the small number of tumour cases makes it difficult to draw definite prognostic conclusions. Multicentre studies on larger numbers of cases are needed to solidify these findings and their prognostic and therapeutic implications.
Clinical and Experimental Dermatology (2014) 39, pp806–809
Mutant TGF-b1 genotypes were significantly associated with MF. This study provides a further step towards understanding the genetic background of MF in Egyptian patients. Larger multicentre studies are needed to confirm these results and clarify their relation with different clinical types and stages of this disease.
Acknowledgements We thank all members of the Dermatology Department, Faculty of Medicine, Cairo University for their
ª 2014 British Association of Dermatologists
TGF-b1 gene polymorphism in MF A. A. Zayed et al.
valued help in the collection of cases. We also thank Dr M. I. Mostafa for performing the statistical analysis.
What’s already known about this topic? • The TGF-b1 signalling pathway has been impli-
cated in the development of several cancers. • Functional regulatory polymorphisms of the
TGF-b1 gene have been directly associated with interindividual variability in TGF-b1 plasma levels, and modified risk of breast, lung, colorectal and prostate cancers.
What does this study add? • Gene expression of TGF-b1 in the blood of
patients with MF was significantly lower than in controls. • A higher frequency of TGF-b1 gene polymorphisms was observed in patients with MF than in controls. • The homozygous genotypes were more likely to develop advanced clinical types and disease stages.
References 1 Trautinger F, Knobler R, Willemze R et al. EORTC consensus recommendations for the treatment of mycosis fungoides/Sezary syndrome. Eur J Cancer 2006; 42: 1014–30. 2 Wong HK, Mishra A, Hake T et al. Evolving insights in the pathogenesis and therapy of cutaneous T-cell lymphoma (mycosis fungoides and Sezary syndrome). Br J Haematol 2011; 155: 150–66. 3 Wang HY, Wang RF. Regulatory T cells and cancer. Curr Opin Immunol 2007; 19: 217–23.
ª 2014 British Association of Dermatologists
4 Carreras J, Guillermo AL, Fox BC et al. High numbers of tumor-infiltrating FOXP3-positive regulatory T cells are associated with improved overall survival in follicular lymphoma. Blood 2006; 108: 2957–64. 5 Tran DQ. TGF-b1: the sword, the wand, and the shield of FOXP3 + regulatory T cells. J Mol Cell Biol 2011; 4: 1–9. 6 Elliott RL, Blobe GC. Role of transforming growth factor b in human cancer. J Clin Oncol 2005; 23: 2078–93. 7 Dunning AM, Ellis PD, McBride S et al. A transforming growth factor-1 signal peptide variant increases secretion in vitro and is associated with increased incidence of invasive breast cancer. Cancer Res 2003; 63: 2610–15. 8 Kang HG, Chae MH, Park JMS et al. Polymorphisms in TGF-b1 gene and the risk of lung cancer. Lung Cancer 2006; 52: 1–7. 9 Saltzman BS, Yamamoto JF, Decker R et al. Association of genetic variation in the transforming growth factor b-1 gene with serum levels and risk of colorectal neoplasia. Cancer Res 2008; 68: 1236–44. 10 Ewart-Toland A, Chan JM, Yuan J et al. A gain of function TGFB1 polymorphism may be associated with late stage prostate cancer. Cancer Epidemiol Biomarkers Prev 2004; 13: 759–64. 11 Olsen E, Vonderheid E, Pimpinelli N et al.; ISCL/EORTC. Revisions to the staging and classification of mycosis fungoides and Sezary syndrome: a proposal of the International Society for Cutaneous Lymphomas (ISCL) and the cutaneous lymphoma task force of the European Organization of Research and Treatment of Cancer (EORTC). Blood 2007; 110: 1713–22. 12 Syrris P, Carter ND, Metcalfe JC et al. Transforming growth factor-beta 1 gene polymorphisms and coronary artery disease. Clin Sci (Lond) 1998; 95: 659–67. 13 Hodak E, Akerman L, David M et al. Cytokine gene polymorphisms in patch-stage mycosis fungoides. Acta Derm Venereol 2005; 85: 109–12. 14 Mir AM, Christiano AM. Basics of genetics. Chapter 53. In: Bolognia Textbook of Dermatology, 2nd edn (Bolognia JL, Jorrizo JL, Rapini RP, eds). Spain: Mosby Elsevier, 2008; 693–704. 15 Blobe GC, Schiemann WP, Lodish HF. Role of transforming growth factor beta in human disease. N Engl J Med 2000; 342: 1350–8.
Clinical and Experimental Dermatology (2014) 39, pp806–809
809
Clinical dermatology • Original article
Clinical and Experimental Dermatology
Transforming growth factor-b1 gene polymorphism in mycosis fungoides A. A. Zayed,1 M. R. E. Abdel-Halim,1 K. S. Sayed,1 F. N. Mohammed,2 D. M. Hany2 and K. S. Amr3 1 Dermatology Department, Faculty of Medicine, Cairo University, Egypt; and 2Dermatology Department and 3Molecular Genetic Department, National Research Centre (NRC), Cairo, Egypt
doi:10.1111/ced.12404
Summary
Background. Dysregulation in transforming growth factor (TGF)-b1 signalling pathways has been linked to cancer. Aim. To study the association between single nucleotide polymorphisms (SNPs) of the TGF-b1 gene and mycosis fungoides (MF). Methods. Using restriction fragment length polymorphism analysis, SNPs in the TGF-b1 gene were studied in 55 patients with MF of different stages and in 100 apparently healthy controls. Results. A significant difference was found between patients and controls in distribution of the different TGF-b1 genotypes, with mutant forms (T/C, T/T) encountered significantly more often in patients with MF (P < 0.001). The heterozygous genotype (T/C) was significantly associated with patch stage MF, whereas the homozygous genotype (T/T) was significantly associated with tumour stage (stage IIb) MF (P = 0.001), although this study included only a small number of these patients. Conclusions. Mutant TGF-b1 genotypes are significantly associated with MF in Egyptian patients, with the homozygous genotype (T/T) having a stronger association with tumour stage (stage IIb).
Introduction Mycosis fungoides (MF) is the most common form of cutaneous T-cell lymphoma (CTCL).1 The clinical consequences reflect not only the presence of malignant skin-homing lymphocytes, but also a complex reaction of the immune response to these cells.2 Regulatory T cells (Tregs) are a specialized subpopulation of CD4+ T cells with immunosuppressive effects, including suppression of anti-tumour responses in various cancers.3 Accordingly, they seem to play a role in the aetiopathogenesis of various malignancies, including CTCLs.4 Tregs secrete transforming growth factor (TGF)-b1, an immunosuppressive cytokine, which is critical for
Correspondence: Dr Faisal Nouredin Mohammed, National Research Centre, Al Tahrir St. Dokki, Giza 12622, Egypt E-mail: [email protected] Conflict of interest: the authors declare that they have no conflicts of interest. Accepted for publication 16 February 2014
806
Clinical and Experimental Dermatology (2014) 39, pp806–809
the development and differentiation of Tregs to inducible Tregs, and is considered the mechanism by which these cells mediate immunosuppression.5 TGF-b1 is a potent growth inhibitor for a wide variety of cell types including haematopoietic cells, and several cancers have been attributed to dysregulation of the TGF-b1 signalling pathway.6 Functional regulatory polymorphisms in the TGF-b1 gene are associated directly with interindividual variability in TGF-b1 plasma levels and modified risk of breast,7 lung,8 colorectal9 and prostate10 cancer. We therefore hypothesized that, similar to other cancers, polymorphisms in TGF-b1, the key cytokine of Tregs, may be present in patients with MF. Accordingly, we aimed to evaluate the association between MF and single nucleotide polymorphisms (SNPs) in the TGF-b1 gene.
Methods The study was approved by the ethics committee at the Dermatology Department, Faculty of Medicine,
ª 2014 British Association of Dermatologists
TGF-b1 gene polymorphism in MF A. A. Zayed et al.
Cairo University, and informed consent was obtained from all participants. Participants
This was a case–control study carried out in the Dermatology Outpatient Clinic of the Faculty of Medicine, Cairo University. During the period March 2011–2012, we recruited 55 patients [25 women (45.5%), 30 men (54.5%); mean SD age 39.24 13.02 years, range 17–65] with MF at various stages into this TGF-b1 gene polymorphism study. The control group comprised 100 apparently healthy volunteers [30 women (30%), 70 men (70%); mean SD age 32 7.43 years, range 20–55]. Patients and controls were age and sex matched (P = 0.63 and 0.82 respectively). Diagnosis of MF was based on clinical, histopathological, immunophenotypic and gene rearrangement findings. Disease staging was carried out in accordance with the TNM staging system.11 Transforming growth factor-b1 gene polymorphism
Blood samples were collected, and genomic DNA extracted (DNAzol; Invitrogen, Carlsbad, CA, USA) following the standard protocols given by the manufacturer. Reaction mixtures were prepared, containing 200 ng DNA, 1 U Taq polymerase (Invitrogen), 0.2 mmol/L dNTPs and 0.5 mmol/L of each primer (Invitrogen), made up to 25 mL with PCR buffer (10 mmol/L Tris–HCl pH 8.3, 50 mmol/L KCl and 1.0 mmol/L MgCl2). The primer sequence was based on the study of Syrris et al.12 (Table 1). Using a thermal cycler (PTC-100 Programmable Thermal Controller; MJ Research, Watertown, MA, USA), PCR was performed with an initial denaturation at 94 °C for 3 min, followed by 33 cycles of denaturation at 94 °C for 50 s, annealing at 66 °C for 1 min, and elongation at 72 °C for 1 min, with a final elongation step of 10 min at 72 °C. An amplification check was carried out using electrophoresis with a 2.5% agarose gel (Invitrogen) in 0.5% TAE buffer (40 mmol/L Tris acetate, 5.7% glacial acetic acid, 2 mmol/L Na2EDTA.2H2O) containing 0.25 mL ethidium bromide. Following this, 3.0 mL of the amplification product was digested with 4 U PstI restriction endonuclease enzyme (Roche Diagnostics, Hague Road, IN, USA) in a 12 mL volume mixture containing 0.9 mL SuRE/Cut Buffer H (Roche Diagnostics). The reaction mixture was incubated at 37 °C for 1 h. Restriction enzyme-digested PCR products were subjected to electrophoresis in a 2.5% aga-
ª 2014 British Association of Dermatologists
rose gel (Seakem; FMC, Rockland, ME, USA) at 270 mV for 2 h in 200 mL Tris–borate–EDTA buffer. Using ultraviolet transillumination after ethidium bromide staining, the products were visualized and the size of the product was determined using a 123 bp ladder (Invitrogen). In each digestion, control samples were included from subjects who had been confirmed by DNA sequencing as Leu/Leu, Leu/Pro or Pro/Pro. Statistical analysis
Data are presented as mean SD and range, or frequencies (number of cases) and percentages when appropriate. Comparison of numerical variables between the study groups was carried out using the Mann–Whitney U-test for independent samples when comparing two groups, and the Kruskal–Wallis test with post hoc multiple two-group comparisons when comparing more than two groups. For comparing categorical data, the v² test was performed. The Fisher exact test was used when the expected frequency was < 5. P < 0.05 was considered significant. All statistical calculations were performed using SPSS software (version 15 for Microsoft Windows; SPSS Inc., Chicago, IL, USA).
Results Mean disease duration was 8.06 7.75 years (range 1–40). The patient group comprised 54 cases with classic MF and 1 case with erythrodermic MF. The classic cases were composed of 27 (49.1%) patch stage, 23 (41.8%) plaque stage and 4 (7.3%) tumour stage. Disease stages were 13 (23.6%) stage Ia, 28 (50.9%) stage Ib, 9 (16.4%) stage IIa, 4 (7.3%) stage IIb and 1 (1.8%) stage III. Transforming growth factor-b1 genotype analysis
Three TGF-b1 genotypes were identified: C/C normal (wild type), T/C (mutant heterozygous) and T/T (mutant homozygous). Table 2 illustrates the incidence of various genotypes in patients and controls. A statistically significant difference in genotype distribution was found between the groups, with the mutant genotypes being significantly more frequent in patients with MF than in controls (98.2% and 69% respectively, P < 0.001). The odds ratio between cases Table 1 Primers used for sequencing analysis. Primer Forward Reverse
Sequence 50 ?30 ACCACACCAGCCCTGTTCGC AGTAGCCACAGCAGCGGTAGCAGCTGC
Clinical and Experimental Dermatology (2014) 39, pp806–809
807
TGF-b1 gene polymorphism in MF A. A. Zayed et al.
Table 2 Distribution of different genotypes of the TGF-b1 gene in patients with mycosis fungoides and controls. TGF-b1 genotype
Patients, n (%)
Controls, n (%)
C/C T/C T/T
1/55 (1.8) 44/55 (80.0) 10/55 (18.2)
31/100 (31) 51/100 (51) 18/100 (18)
P < 0.001*
*Significant. TGF, transforming growth factor.
of MF with the homozygous genotype and those with the heterozygous genotype was < 1. Table 3 illustrates the distribution of the various genotypes in relation to clinical type (P = 0.001) and disease stage (P < 0.001). All tumour stage cases (4/4) had the T/T homozygous genotype while all patch stage cases (27/27) and the majority of plaque stage cases (16/23) had the T/C heterozygous genotype. All patients with stage Ia (13/13) and the majority of patients with stage Ib (27/28) had the T/C heterozygous genotype. Most of the stage IIa patients (5/9) and all the stage IIb patients (4/4) had the T/T homozygous genotype. Distribution of genotypes was not affected by sex or age in patients (P = 0.59 and 0.96, respectively) or controls (P = 0.94 and 0.99, respectively).
Discussion In this study, we found that mutant TGF-b1 genotypes were significantly associated with MF. To our knowledge, this is the first study in Egypt to investigate a possible association between TGF-b1 SNPs and suscepTable 3 Comparison between the three genotypes of the TGF-b1 gene in relation to the clinical data of patients with MF. TGF-b1 genotype C/C (wildtype) Clinical type of MF, Classic Patch stage Plaque stage Tumour stage Erythrodermic Stage, n (%) Ia Ib IIa IIb III
T/C (heterozygous)
T/T (homozygous)
P
Conclusion
n (%) – 1 (100) – –
27 (61.4) 16 (36.4) – 1 (2.3)
– 6 (60) 4 (40)
0.001*
– – 1 (100) – –
13 (29.5) 27 (61.3) 3 (6.8) 0 (0) 1 (2.3)
0 1 (10) 5 (50) 4 (40) –
< 0.001*
*Significant. MF, mycosis fungoides; TGF, transforming growth factor.
808
tibility to MF. To date, only one study has evaluated TGF-b1 gene polymorphisms in MF; that study, carried out in the USA by Hodak et al., evaluated 33 patients with patch-stage MF and found no significant results.13 The differences in results between that study and our current study might be related to population differences. In addition, many conditions in which heritable factors play a role are not due to a single gene defect, but rather are thought to be determined by the interaction of multiple genetic factors, both with each other and with the environment. The aetiopathogenesis of such conditions is referred to as ‘complex’ or ‘multifactorial’. MF, vitiligo and psoriasis vulgaris are examples of such conditions.14 In normal cells, TGF-b stops cell proliferation by arresting the cell cycle at the G1 phase, and also can induce differentiation or promote apoptosis. When a cell is transformed into a cancer cell, parts of the TGF-b signalling pathway are mutated, and TGF-b1 no longer controls the cell, allowing it to proliferate in an uncontrolled manner.15 Whether the TGF-b1producing Tregs in MF are malignant Tregs (putative origin of MF) or are part of the anti-tumour immune response is still not clear. Assuming that these Tregs are malignant, the detected polymorphisms might have altered the TGF-b1 signalling pathway, resulting in a possible stimulatory effect on the proliferation of the malignant lymphocytes. Although there was a significant difference in distribution of genotypes in the different clinical types and disease stages, with all tumour-stage cases (stage IIb) having the homozygous genotype and all patch-stage cases having the heterozygous genotype, the small number of tumour cases makes it difficult to draw definite prognostic conclusions. Multicentre studies on larger numbers of cases are needed to solidify these findings and their prognostic and therapeutic implications.
Clinical and Experimental Dermatology (2014) 39, pp806–809
Mutant TGF-b1 genotypes were significantly associated with MF. This study provides a further step towards understanding the genetic background of MF in Egyptian patients. Larger multicentre studies are needed to confirm these results and clarify their relation with different clinical types and stages of this disease.
Acknowledgements We thank all members of the Dermatology Department, Faculty of Medicine, Cairo University for their
ª 2014 British Association of Dermatologists
TGF-b1 gene polymorphism in MF A. A. Zayed et al.
valued help in the collection of cases. We also thank Dr M. I. Mostafa for performing the statistical analysis.
What’s already known about this topic? • The TGF-b1 signalling pathway has been impli-
cated in the development of several cancers. • Functional regulatory polymorphisms of the
TGF-b1 gene have been directly associated with interindividual variability in TGF-b1 plasma levels, and modified risk of breast, lung, colorectal and prostate cancers.
What does this study add? • Gene expression of TGF-b1 in the blood of
patients with MF was significantly lower than in controls. • A higher frequency of TGF-b1 gene polymorphisms was observed in patients with MF than in controls. • The homozygous genotypes were more likely to develop advanced clinical types and disease stages.
References 1 Trautinger F, Knobler R, Willemze R et al. EORTC consensus recommendations for the treatment of mycosis fungoides/Sezary syndrome. Eur J Cancer 2006; 42: 1014–30. 2 Wong HK, Mishra A, Hake T et al. Evolving insights in the pathogenesis and therapy of cutaneous T-cell lymphoma (mycosis fungoides and Sezary syndrome). Br J Haematol 2011; 155: 150–66. 3 Wang HY, Wang RF. Regulatory T cells and cancer. Curr Opin Immunol 2007; 19: 217–23.
ª 2014 British Association of Dermatologists
4 Carreras J, Guillermo AL, Fox BC et al. High numbers of tumor-infiltrating FOXP3-positive regulatory T cells are associated with improved overall survival in follicular lymphoma. Blood 2006; 108: 2957–64. 5 Tran DQ. TGF-b1: the sword, the wand, and the shield of FOXP3 + regulatory T cells. J Mol Cell Biol 2011; 4: 1–9. 6 Elliott RL, Blobe GC. Role of transforming growth factor b in human cancer. J Clin Oncol 2005; 23: 2078–93. 7 Dunning AM, Ellis PD, McBride S et al. A transforming growth factor-1 signal peptide variant increases secretion in vitro and is associated with increased incidence of invasive breast cancer. Cancer Res 2003; 63: 2610–15. 8 Kang HG, Chae MH, Park JMS et al. Polymorphisms in TGF-b1 gene and the risk of lung cancer. Lung Cancer 2006; 52: 1–7. 9 Saltzman BS, Yamamoto JF, Decker R et al. Association of genetic variation in the transforming growth factor b-1 gene with serum levels and risk of colorectal neoplasia. Cancer Res 2008; 68: 1236–44. 10 Ewart-Toland A, Chan JM, Yuan J et al. A gain of function TGFB1 polymorphism may be associated with late stage prostate cancer. Cancer Epidemiol Biomarkers Prev 2004; 13: 759–64. 11 Olsen E, Vonderheid E, Pimpinelli N et al.; ISCL/EORTC. Revisions to the staging and classification of mycosis fungoides and Sezary syndrome: a proposal of the International Society for Cutaneous Lymphomas (ISCL) and the cutaneous lymphoma task force of the European Organization of Research and Treatment of Cancer (EORTC). Blood 2007; 110: 1713–22. 12 Syrris P, Carter ND, Metcalfe JC et al. Transforming growth factor-beta 1 gene polymorphisms and coronary artery disease. Clin Sci (Lond) 1998; 95: 659–67. 13 Hodak E, Akerman L, David M et al. Cytokine gene polymorphisms in patch-stage mycosis fungoides. Acta Derm Venereol 2005; 85: 109–12. 14 Mir AM, Christiano AM. Basics of genetics. Chapter 53. In: Bolognia Textbook of Dermatology, 2nd edn (Bolognia JL, Jorrizo JL, Rapini RP, eds). Spain: Mosby Elsevier, 2008; 693–704. 15 Blobe GC, Schiemann WP, Lodish HF. Role of transforming growth factor beta in human disease. N Engl J Med 2000; 342: 1350–8.
Clinical and Experimental Dermatology (2014) 39, pp806–809
809
