Environmental Pollution 204 (2015) 264e270

Contents lists available at ScienceDirect

Environmental Pollution journal homepage: www.elsevier.com/locate/envpol

Transcriptional responses of earthworm (Eisenia fetida) exposed to naphthenic acids in soil Jie Wang a, Xiaofeng Cao a, Jinhua Sun b, Liwei Chai a, Yi Huang a, *, Xiaoyan Tang a a

State Key Joint Laboratory of Environmental Simulation and Pollution Control, College of Environmental Sciences and Engineering, Peking University, Beijing 100871, China b Chinese Research Academy of Environmental Sciences, Beijing 100012, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 24 January 2015 Received in revised form 30 April 2015 Accepted 2 May 2015 Available online xxx

In this study, earthworms (Eisenia fetida) were exposed to commercial NAs contaminated soil, and changes in the levels of reactive oxygen species (ROS) and gene expressions of their defense system were monitored. The effects on the gene expression involved in reproduction and carcinogenesis were also evaluated. Significant increases in ROS levels was observed in NAs exposure groups, and the superoxide dismutase (SOD) and catalase (CAT) genes were both up-regulated at low and medium exposure doses, which implied NAs might exert toxicity by oxidative stress. The transcription of CRT and HSP70 coincided with oxidative stress, which implied both chaperones perform important functions in the protection against oxidative toxicity. The upregulation of TCTP gene indicated a potential adverse effect of NAs to terrestrial organisms through induction of carcinogenesis, and the downregulation of ANN gene indicated that NAs might potentially result in deleterious reproduction effects. © 2015 Elsevier Ltd. All rights reserved.

Keywords: Eisenia fetida Naphthenic acids ROS Ecotoxicity Quantitative real-time PCR

1. Introduction Naphthenic acids (NAs), which are natural constituents of crude petroleum, are a group of cyclic and acyclic alkyl-substituted carboxylic acids with the general formula CnH2nþZO2 (where n is the number of carbons and Z refers to the number of rings) (Clemente and Fedorak, 2005; Frank et al., 2008; Headley et al., 2009). High concentrations of NAs are frequently found in petroleum refinery wastewaters (Wang et al., 2013; Misiti et al., 2013), oil sands process-affected water (OSPW) (Rogers et al., 2002; Holowenko et al., 2002; West et al., 2013; Jones et al., 2012), and lixivium from oil sand storage sites in the Athabasca region of Alberta, Canada (Holowenko et al., 2002; Gagne et al., 2013). NAs are also found in coastal sediments (Wan et al., 2014), oil sands tailings (Herman et al., 1994; Holowenko et al., 2002; Armstrong et al., 2010), and oil polluted soils (Wang et al., 2015a, 2015b). Wan et al. (2014) illustrated that NAs concentrations were 50e100 times higher than polycyclic aromatic hydrocarbons (PAHs) concentrations in the same sediment sample after oil spill. Our previous studies also showed that NAs concentrations in Daqing oil field was as high as 132.91 mg/kg, whereas the total PAHs concentration

* Corresponding author. E-mail address: [email protected] (Y. Huang). http://dx.doi.org/10.1016/j.envpol.2015.05.006 0269-7491/© 2015 Elsevier Ltd. All rights reserved.

in the same soil sample was only 5.21 mg/kg (Wang et al., 2015a, 2015b). These results indicate that NAs in oil spill-affected areas deserve more attention because of the potential toxicological risk they pose to the environment and human health. However, limited data are available regarding the biological and molecular responses of terrestrial organisms exposure to NAs to assess the risks and understand the mode of action of deleterious effects. By contrary, such effects of NAs on the aquatic environment have been studied systematically. Naphthenic acids may enter aquatic environments from different sources including effluent discharge, crude oil spills, and erosion of riverbank oil deposits, and cause potential environmental contamination and aquatic toxicity (Headly and McMartin, 2004). They have demonstrated acute and chronic toxicity to different aquatic organisms, such as acutely lethal effects on fish (Nero et al., 2006; Scarlett et al., 2013), amphibian (Melvin and Trudeau, 2012; Smits et al., 2012; Melvin et al., 2013), algae (Woodworth et al., 2012), and some microorganisms (Holowenko et al., 2002; Jones et al., 2011). Evidence has shown that the mechanism being related to NAs' narcosis-like effects. Subacute and chronic effects of NAs on fish include increased leukocyte count and increased incidence of deformity (Peters et al., 2007; He et al., 2012a). Several other studies have provided further evidence demonstrating the toxicity might exert on the organisms exposed

J. Wang et al. / Environmental Pollution 204 (2015) 264e270

to OSPW NAs due to oxidative stress, which induces higher concentration of reactive oxygen species (ROS) and abundance of gene expressions involved in antioxidant defense system (He et al., 2012a; Wiseman et al., 2013a, 2013b; Gagne et al., 2013). Several studies have shown that OSPW has endocrine disrupting effects both in vitro (He et al., 2010, 2011; Knag et al., 2013) and in vivo (Lister et al., 2008; Van den Heuvel et al., 2012; Kavanagh et al., 2012; He et al., 2012b; Wiseman et al., 2013b; Reinardy et al., 2013), and NAs have been suspected to be responsible for the adverse impacts. However, very little information is available on the molecular biochemical responses of terrestrial organisms exposure to NAs despite the widespread NAs pollution in soil. Earthworm are vital to the soil ecosystem because of their favorable effects on soil structure and functions (Van Groenigen et al., 2014). They are exposed to contaminants through their intestine and skin via alimentary and dermal uptake routes. Therefore, earthworms, especially Eisenia fetida, are well-recognized test organisms for evaluating environmental chemicals (OECD, 2004), and interest in using the molecular genetic responses of earthworms to contaminants as biomarkers of pollutant exposure is growing (Vasseur and Bonnard, 2014). The transcriptional levels of genes involved in the antioxidant system and stress proteins have been detected following exposures to heavy metals (Brulle et al., 2006; Mo et al., 2012) and dioxin (Roubalova et al., 2014). The annetocin (ANN) gene expression, a new reproductive biomarker in earthworm ecotoxicology, has been investigated in metal (Ricketts et al., 2004) and polycyclic musk (Chen et al., 2011a, 2011b) exposure experiments. The gene expression of translationally controlled tumor protein (TCTP) has also been used as a molecular biomarker to determine the carcinogenic effects of PAHs (Zheng et al., 2008). The purpose of this study is to investigate the sublethal effects of NAs on E. fetida at the molecular genetic level. The worms were exposed to different concentrations of NAs, and the transcriptional profiles of the genes involved in oxidative stress, carcinogenesis and reproduction were assessed. To investigate whether oxidative stress might perform a function in the impairment of the earthworm, the abundances of transcripts of the genes related to biotransformation, antioxidant enzymes, and stress protein were assessed. The gene expressions of ANN and TCTP were investigated to study the effects of NAs on reproduction and carcinogenesis. To our knowledge, this study is the first investigate on NAs-caused toxicity in earthworms at the gene expression level, which could provide insights into the toxicological mechanism of NAs. 2. Materials and methods 2.1. Exposure design and preparation Naphthenic acids were purchased from Sigma (USA). Stock solution of NAs was prepared in dichloromethane (HPLC grade) at a concentration of 100 mg/L. All other reagents used in the experiments were purchased from Sinopharm Chemical (Beijing, China) and were of analytical grade with a chemical purity of 97%. Adult E. fetida with well-developed clitellum (wet weight of 350e500 mg) were purchased from the Lutai Earthworm Breeding Farm (Tianjin, China). They were acclimatized for two weeks under laboratory conditions in culture pots containing 500 g of clean soil and 2 g of cattle manure. Water was added as necessary to maintain moisture content. Twenty-four hours prior to exposure, the earthworms were removed from the culture, rinsed in water, and kept on damp filter paper in the dark at 20  C to void their gut contents. The toxic effects of NAs on E. fetida were investigated by natural soil tests. Soil samples were taken from the upper layer (0e20 cm)

265

beside Weiming Lake in Peking University, Beijing, China. The soil sample was air dried for 2 weeks at room temperature, and sieved with a 2 mm mesh. The main physical and chemical properties of the soil were as follows: pH 6.37, organic matter 1.67%, cation exchange capacity 15.6 cmol kg1, total N 0.94 g kg1, total P 2.67 g kg1, clay 35.7%, silt 46.8%, sand 17.5%. According to our previous results (Wang et al., 2015c), 0 mg/kg of NAs was set as blank control, and 10, 50, and 100 mg/kg of NAs represent low, medium, and high exposure concentrations, respectively. The earthworms were sampled on day 1, day 3, day 7 and day 14 after exposure to evaluate the mode of action of alteration in the molecular biomarkers. Four earthworms were sampled for in vitro ROS assay, and five earthworms were sampled for gene analysis. After the exposure, the earthworms were collected and left for 1 day to void their gut contents and were then transferred to liquid nitrogen until required for future analysis. All exposures were conducted in an artificial climate incubator at 20  C in 70% relative humidity with a 16:8 h light: dark regime. 2.2. In vitro ROS assay Earthworms were homogenized on ice with phosphate buffer solution (PBS) and centrifuged at 10,000 rpm for 15 min. For the measurement of the ROS levels, the supernatant was subjected to in vitro assays with the OxiSelect In Vitro ROS Assay Kit (Cell Biolabs, USA) following the manufacturer's instructions. Data were normalized to protein level (measured by BCA Protein Assay Kit), and then the relative fold changes were determined. 2.3. Gene expression analysis Reverse transcription polymerase chain reaction (RT-PCR) was used to assess differences in the abundances of the target genes transcripts. The expression profiles of seven target and one housekeeping genes (Table 1) were quantified. The fold changes in the target gene expression level were normalized to the b-actin contents and calculated using the 2-DDCt method (Simon, 2003). Total RNA was isolated from an earthworm using the TRIzol reagent (Invitrogen, USA) following the manufacturer's instructions. Purification of the RNA and removal of any possible contaminating genomic DNA was performed using gDNA Eraser (Takara, Japan). First-strand cDNA synthesis was performed using a reverse transcriptase kit (Takara, Japan) according to the manufacture's instruction. The resulting cDNA was used in real-time PCR experiments. Proof-reading PCR was performed on ABI 7500 Real-Time PCR System (ABI, USA) in 96-well PCR plates using ABI Prower SybrGreen qPCR Master Mix (ABI, USA). Each reaction was performed in a total volume of 25 ml containing 2 ml of a cDNA sample, 12.5 ml of SybrGreen qPCR Master Mix, 9.5 ml RNase free water, and 0.5 ul of both forward and reverse primers. The PCR reaction mix was denatured at 95  C for 10 min before the first PCR cycle. The thermal cycle profile was as follows: denaturizing for 15 s at 95  C and annealing and extension for 1 min at 60  C for a total 40 PCR cycles. Melting curve analyses were performed after the final round of amplification to differentiate between the desired PCR products and primer-dimers or DNA contaminants. 2.4. Statistical analysis Statistical analyses were conducted with SPSS 16.0, and all data were expressed as mean ± SD. The data were checked for normality by KolmogoroveSmirnov test, and if necessary, data were log10transformed to approximate normality. The homogeneity of variance was assessed using Levene's test. Statistical differences were

266

J. Wang et al. / Environmental Pollution 204 (2015) 264e270

Table 1 Sequences of primers used for quantitative real-time PCR to assess transcript abundances in earthworm E. fetida exposed to NAs polluted soils. Genes

Primer pair (50 e30 )

Functions

Reverse primer

b-actin

F: TCCATCGTCCACAGAAAG R: AAATGTCCTCCGCAAGCT F: CATTGCGGATGGAAACTA R: TTCGGATTACGATTGAGA F: TGCTCACTTCAACCCATTT R: TTGGCAACACCACTTTCA F: CGGAAAAGCCGCGTACATTA R: GTAGCTCGGTGCTTGGCAAT F: CCAAGGACAACAACCTGCTC R: CGGCGTTCTTCACCATTC F: GCCGAACCGACTACCTAC R: GGCTGAGATGCCGTAAAA F: TTTCTTCCGCCTGCTTTG R: ACCGACCTACCACCGACA F: TCGAATATGCCCTCAGCA R: TGGACTCGCCACAGAAGA

Housekeeping gene

Brulle et al., 2006

Antioxidant enzyme, catalase

Brulle et al., 2006

Antioxidant enzyme, superoxide dismutase

Brulle et al., 2006

Biotransformation, glutathione-S-transferase

Brulle et al., 2008

Chaperone, stress protein

Roubalova et al., 2014

Chaperone, stress protein

Roubalova et al., 2014

Annetocin, involved in reproduction

Zheng et al., 2008

Transcriptionally controlled tumor protein, involved in carcinogenesis

Zheng et al., 2008

CAT SOD GST HSP70 CRT ANN TCTP

Fig. 1. Relative levels of ROS concentration in E. fetida exposed to NAs-contaminated soils. Data are described as mean ± SD (n ¼ 5). *Significant difference between different treatments (p < 0.05).

evaluated by one-way analysis of variance followed by post-hoc Tukey's test. Differences were considered statistically significant at p < 0.05. 3. Results 3.1. Effect of NAs on ROS level in earthworm in vitro The levels of ROS in Eisenia fetida exposed to NAs polluted soils are presented in Fig. 1. Significant increases in the ROS levels were observed at low, medium, and high doses after the whole exposure period, being 1.54-, 1.75-, and 1.54-fold higher, respectively. The maximum contents of ROS after exposure to low and medium doses were observed on day 7, with 2.01- and 2.19-fold increases, respectively. 3.2. Antioxidant enzymes and biotransformation gene expression responses The abundances of transcripts of the genes involved in oxidative stress (superoxide dismutase, SOD; catalase, CAT) and xenobiotic biotransformation (glutathione-S-transferase, GST) were examined (Fig. 2). In comparison with the control, significant changes in the expression levels of SOD gene in E. fetida were observed on day 1 after being exposed to medium and high doses, being 1.91- and

Fig. 2. Relative levels of abundances of transcripts of SOD, CAT, and GST genes in E. fetida exposed to NAs-contaminated soils. Data are described as mean ± SD (n ¼ 5). *Significant difference between different treatments (p < 0.05).

J. Wang et al. / Environmental Pollution 204 (2015) 264e270

267

period. However, when NAs concentration increased to medium dose, the abundance of transcripts of GST in E. fetida declined significantly on day 7 (0.48-fold, p < 0.05), and the abundance of transcripts of GST exposed to high dose were significantly downregulated (p < 0.05) during the exposure period. 3.3. Stress protein gene expression responses The abundances of transcripts of the genes encoding stress proteins (heat shock protein 70, HSP70; calreticulin; CRT) after exposure to NAs were determined (Fig. 3). A significant downregulation of the HSP70 gene expression was observed in the highdose treatments during the earlier exposure time, especially on day 3 (0.13-fold, p < 0.05). By contrast, low dose of NAs upregulated the HSP70 gene expression significantly on days 3 and 7 (1.63- and 1.94-fold, respectively). However, no significant difference between the control and exposed groups were observed after 14 days of exposure. A significant upregulation of CRT gene expression was observed in the medium-dose treatments on day 1 (2.24-fold, p < 0.05), the CRT gene expression then returned to the control level. No significant difference could be found in the high-dose treatments during the exposure period, except on day 3 (0.40 fold, p < 0.05). The abundances of the CRT gene transcripts was significantly upregulated in E. fetida exposed to low-dose NAs at the end of the exposure experiment.

3.4. Carcinogenesis gene expression responses Fig. 3. Relative levels of abundances of transcripts of HSP70 and CRT genes in E. fetida exposed to NAs-contaminated soils. Data are described as mean ± SD (n ¼ 5). *Significant difference between different treatments (p < 0.05).

1.61-fold higher, respectively. The upregulated responses could be observed during the first 7 days of exposure. However, SOD gene expression returned to control levels in the low- and medium-dose treatments, and decreased significantly in high dose treatments after 14 days of exposure (0.45-fold, p < 0.05). CAT and SOD gene expressions shared similar patterns in response to NAs. A significant upregulation (2.97- and 1.90-fold, p < 0.05) was observed in medium- and high-dose exposure groups on day 1 (Fig. 1). However, CAT gene transcript levels decreased significantly (0.47 and 0.39 fold, p < 0.05) after 7 days of exposure to medium and high dose. A low dose of NAs caused insignificant changes (p > 0.05) in the GST gene expression throughout the entire experimental

Fig. 4. Relative levels of abundances of transcripts of TCTP gene in E. fetida exposed to NAs-contaminated soils. Data are described as mean ± SD (n ¼ 5). *Significant difference between different treatments (p < 0.05).

A significant upregulation (2.11-fold, p < 0.05) of the TCTP gene expression was observed in high dose-exposure (Fig. 4). However, the abundances of the TCTP transcripts following a decreasing trend during the exposure period. No significant difference was found between the control group and groups exposed to the three doses of NAs after 14 days of treatment.

3.5. Reproduction gene expression responses A significant downregulation (0.32- and 0.22-fold, p < 0.05) of the ANN gene expression was observed in medium- and high-dose treatments (Fig. 5). However, low dose of NAs upregulated ANN gene expression significantly (1.75-fold, p < 0.05) on day 3. The ANN gene levels of all exposed groups returned to the control level at the end of the exposure period.

Fig. 5. Relative levels of abundances of transcripts of ANN gene in E. fetida exposed to NAs-contaminated soils. Data are described as mean ± SD (n ¼ 5). *Significant difference between different treatments (p < 0.05).

268

J. Wang et al. / Environmental Pollution 204 (2015) 264e270

4. Discussion Environmental stressors are well known to induce oxidative stress and alterations in cellular redox balance (Franco et al., 2009). An elevated ROS level is a direct indicator of oxidative stress in biological systems (Lim and Luderer, 2010). Previous studies have confirmed that OSPW induced oxidative stress in aquatic organisms by disrupting internal antioxidant protective mechanisms in vivo and in vitro (He et al., 2012a; Wiseman et al., 2013b; Gagne et al., 2012, 2013), and have speculated that NAs are responsible for the adverse impacts. In our study, a significant elevation in ROS concentration was clearly observed in the NAs treatment groups (Fig. 1), which implies that oxidative stress is a plausible explanation for the toxicity of NAs to E. fetida. Oxidative stress results when antioxidant defense mechanisms become saturated, and concentration of ROS exceed the levels produced during normal functioning of cells (Limon-Pacheco and Gonsebatt, 2009). Antioxidant systems are considered to be the primary defense that protects biological macromolecules from oxidative damage. SOD and CAT, two antioxidant enzymes, together with GST, a phase II enzyme that facilitates detoxification of drugs, perform key functions in the clearance of ROS (Limon-Pacheco and Gonsebatt, 2009). Higher abundances of the SOD and CAT transcripts were observed in our study, which are consistent with the results of previous studies on aquatic organisms (He et al., 2012a; Wiseman et al., 2013b). Downregulation of the SOD and CAT transcripts were observed in high-dose treatments, which may be ascribed to the heavy damage caused by the high dose of NAs (Jo et al., 2008). In the present study, the expression of the GST gene revealed a reduced response in the NAs exposed groups. However, a comparison between the results of the present study and those of previous studies indicates that the response pattern of GST was quite complex. He et al. (2012a) observed higher abundance of the GST gene in fathead minnow larvae exposed to NAs extracted from OSPW, and similar results could also be found in the studies of Gagne et al. (2013) and Wiseman et al. (2013b). However, GST enzyme activity and GST gene expression was significantly inhibited by exposure to OSPW extracts in earlier studies of Gagne et al. (2011, 2012). At present, a clear explanation cannot be provided, but the suggestion that some ingredients (i.e., thiol-derived organic compounds) in NAs block gene expression of GST has been proposed (Byington and Hansbrough, 1979; Gagne et al., 2012). Heat Shock Protein 70 (HSP70), which is one of the major classes of molecular chaperones, has been suggested to be a potentially sensitive biomarker for environmental monitoring (Webb and Gagnon, 2009; An et al., 2013; Roubalova et al., 2014). In our study, the expression of HSP70 was significantly upregulated in low-dose exposure and significantly downregulated in high-dose exposure, and returned to the control level after 14 days, which implies that the alteration of the HSP70 gene expression may be short-term, and may depend on the strength and duration of exposure (Molina et al., 2000; Franzellitti and Fabbri, 2005; Chen et al., 2011b). The gene expression of HSP70 in E. fetida influenced by anthropogenic chemicals has been investigated in previous studies. An increase in the HSP70 gene expression has been observed in earthworms after metal (Homa et al., 2005) and dioxin (Roubalova et al., 2014) exposure. However, exposure of earthworms to copper (Fisker et al., 2013) and polycyclic musk (Chen et al., 2011b) have resulted in a decrease in the HSP70 gene expression. The irregular HSP70 gene expression indicates that HSP70 protein is selectively induced by various environmental toxicants. Future studies are needed to elucidate the possible mechanism of the upregualation and downregulation of HSP70. Calreticulin (CRT) is a Ca2þ-binding combined molecular chaperone, which mostly exists in the endoplasmic reticulum (Silerova

et al., 2007). In the present study, the expression level of the CRT gene was significantly increased in E. fetida in response to NAs exposure, which is consistent with previous studies (Mo et al., 2012; Roubalova et al., 2014). CRT, as an important chaperone, performs a vital function in the protection against oxidative toxicity, and Ca2þ buffering capacity, and the increase in CRT represents a part of the cellular response to oxidative stress (Nunez et al., 2001). Environmental toxicants have been concluded to induce oxidative stress, subsequent rapid increase in free intracellular Ca2þ, and protein damage, thereby affecting the expression of the CRT gene (Chen et al., 2011a, 2011b; Roubalova et al., 2014). In our study, another potential response of the CRT gene, the narcosis effect, might be associated with the surfactant characteristics of NAs. As surfactants, NAs can easily penetrate the cell wall, disrupt the ability of the endoplasmic reticulum and Ca2þ homeostasis, and then alter the expression of the CRT gene. Future study is needed to elucidate this speculation. TCTP is a highly conserved protein that is involved in cell cycle regulation and tumor reversion (Telerman and Amson, 2009). In our study, the TCTP gene expression level in E. fetida was significantly upregulated by high dose of NAs, which indicates a potential adverse effect of NAs to terrestrial organisms through induction of carcinogenesis. Although no direct experimental data that indicate NAs-induced carcinogenesis are available, several polycyclic monoaromatic acids have been predicted to be relatively carcinogenic compounds (Scarlett et al., 2012). Moreover, several NAs (15 mg/L) have showed genotoxic potential in rainbow trout (Lacaze et al., 2014). ANN is a structurally and functionally oxytocin-related peptide, which has been confirmed to induce egg-laying behaviors in earthworms, E. fetida (Oumi et al., 1996). The correlation between ANN gene expression and earthworm reproduction has been established in previous studies (Ricketts et al., 2004). Thus ANN gene is proposed as a potential reproductive biomarker in earthworm ecotoxicology (Zheng et al., 2008; Chen et al., 2011b). In the present study, the significant downregulation of the ANN gene expression was caused by NAs exposure, which indicates that the reduction of ANN might lead to less cocoon production in short period. In Kavanagh's studies (2011, 2012, 2013), NAs had negative effects on the fecundity rate and the number of spawns in female fathead minnows, and the size and number of nuptial tubercles in males, which indicates that NAs impaired the reproductive physiology of aquatic organisms. These results showed reproductive toxicity of NAs to both aquatic and terrestrial organisms. 5. Conclusion In this study, gene expression responses in E. fetida were first used to assess the ecotoxicological effects of NAs on terrestrial organisms. NAs, as xenobiotics, caused more sever ecotoxicity in soil by causing oxidative damage to organisms. The abundances of transcripts of SOD, CAT, and GST, which are important for the response to oxidative stress, were significantly altered in E. fetida exposed to NAs. A similar response of one molecular chaperone, HSP70, was observed in earthworms. The alteration of the CRT gene maight be associated with the oxidative stress caused by NAs and the surfactant characteristics of NAs. The upregulated TCTP gene expression indicated that NAs had potential effects on terrestrial organisms through induction of carcinogenesis. The downregulation of the ANN gene expression might indicate potential effects on reproduction. This study suggested that the analysis of gene expression changes is a powerful tool for diagnosing the effects of major stressors and to analyze mechanisms of toxicity. Further study is necessary to evaluate the usefulness of these genes as potential molecular biomarkers induced by NAs.

J. Wang et al. / Environmental Pollution 204 (2015) 264e270

Acknowledgments This work was financially supported by the Public Welfare Project of Ministry of Environmental Protection of China (201309034). References An, L.H., Lei, K., Zheng, B.H., 2013. Use of heat shock protein mRNA expressions as biomarkers in wild crucian carp for monitoring water quality. Environ. Toxicol. Pharmacol. 37, 248e255. Armstrong, S.A., Headley, J.V., Peru, K.M., Mikula, R.J., Germida, J.J., 2010. Phytotoxicity and naphthenic acid dissipation from oil sands fine tailings treatments planted with the emergent macrophyte Phragmites australis. J. Environ. Sci. Health A-Toxic/Hazard. Subst. Environ. Eng. 45, 1008e1016. Brulle, F., Cocquerelle, C., Mitta, G., Castric, V., Douay, F., Lepretre, A., Vandenbulcke, F., 2008. Identification and expression profile of gene transcripts differentially expressed during metallic exposure in Eisenia fetida coelomocytes. Dev. Comp. Immunol. 32, 1441e1453. Brulle, F., Mitta, G., Cocquerelle, C., Vieau, D., Lemiere, S., Lepretre, A., Vandenbulcke, F., 2006. Cloning and real-time PCR testing of 14 potential biomarkers in Eisenia fetida following cadmium exposure. Environ. Sci. Technol. 40, 2844e2850. Byington, K.H., Hansbrough, E., 1979. Inhibition of the enzymatic activity of ligandin by organogermanium, organolead or organotin compounds and the biliary excretion of sulfobromophthalein by the rat. J. Pharmacol. Exp. Ther. 208, 248e253. Clemente, J.S., Fedorak, P.M., 2005. A review of the occurrence, analyses, toxicity, and biodegradation of naphthenic acids. Chemosphere 60, 585e600. Chen, C., Zhou, Q., Liu, S., Xiu, Z., 2011a. Acute toxicity, biochemical and gene expression responses of the earthworm Eisenia fetida exposed to polycyclic musks. Chemosphere 83, 1147e1154. Chen, C., Xue, S., Zhou, Q., Xie, X., 2011b. Multilevel ecotoxicity assessment of polycyclic musk in the earthworm Eisenia fetida using traditional and molecular endpoints. Ecotoxicology 20, 1949e1958. Fisker, K.V., Holmstrup, M., Sorensen, J.G., 2013. Variation in metallothionein gene expression is associated with adaptation to copper in the earthworm Dendrobaena octaedra. Comp. Biochem.. Physiol. Part C-Toxicol. Pharmacol. 157, 220e226. Franco, R., Sanchez-Olea, R., Reyes-Reyes, E.M., Panayiotidis, M.I., 2009. Environnage  mental toxicity, oxidative stress and apoptosis: Me a Trois. Mutat. Res. 674, 3e22. Frank, R.A., Kavanagh, R., Burnison, B.K., Arsenault, G., Headley, J.V., Peru, K.M., Van Der Kraak, G., Solomon, K.R., 2008. Toxicity assessment of collected fractions from an extracted naphthenic acid mixture. Chemosphere 72, 1309e1314. Franzellitti, S., Fabbri, E., 2005. Differential HSP70 gene expression in the mediterranean mussel exposed to various stressors. Biochem. Biophys. Res. Commun. 336, 1157e1163. Gagne, F., Andre, C., Doubille, M., Talbot, A., Parrot, J., McMaster, M., Hewitt, M., 2011. An examination of the toxic properties of water extracts in the vicinity of an oil sand extraction site. J. Environ. Monit. 13, 3075e3086. Gagne, F., Andre, C., Turcotte, P., Gagnon, C., Sherry, J., Talbot, A., 2013. A comparative toxicogenomic investigation of oil sand water and processed water in rainbow trout hepatocytes. Arch. Environ. Contam. Toxicol. 65, 309e323. Gagne, F., Douville, M., Andre, C., Debenest, T., Talbot, A., Sherry, J., Hewitt, L.M., Frank, R.A., McMaster, M.E., Parrott, J., Bickerton, G., 2012. Differential changes in gene expression in rainbow trout hepatocytes exposed to extracts of oil sands process-affected water and the Athabasca River. Comp. Biochem. Physiol. C-Toxicol. Pharm. 155, 551e559. He, Y.H., Wiseman, S.B., Zhang, X.W., Hecker, M., Jones, P.D., El-Din, M.G., Martin, J.W., Giesy, J.P., 2010. Ozonation attenuates the steroidogenic disruptive effects of sediment free oil sands process water in the H295R cell line. Chemosphere 80, 578e584. He, Y.H., Wiseman, S.B., Hecker, M., Zhang, X.W., Wang, N., Perez, L.A., Jones, P.D., ElDin, M.G., Martin, J.W., Giesy, J.P., 2011. Effect of Ozonation on the estrogenicity and androgenicity of oil sands process-affected water. Environ. Sci. Technol. 45, 6268e6274. He, Y.H., Patterson, S., Wang, N., Hecker, M., Martin, J.W., El-Din, M.G., Giesy, J.P., Wiseman, S.B., 2012a. Toxicity of untreated and ozone-treated oil sands process-affected water (OSPW) to early life stages of the fathead minnow (Pimephales promelas). Water Res. 46, 6359e6368. He, Y.H., Wiseman, S.B., Wang, N., Perez-Estrada, L.A., Gamal El-Din, M., Martin, J.W., Giesy, J.P., 2012b. Transcriptional responses of the Brain-Gonad-Liver axis of fathead minnows exposed to untreated and ozone-treated oil sands processaffected water. Environ. Sci. Technol. 46, 9701e9708. Headly, J.V., McMartin, D.W., 2004. A review of the occurrence and fate of naphthenic acids in aquatic environments. J. Environ. Sci. Heal. Part A e Toxic/ Hazard. Subst. Environ. Eng. 39, 1989e2010. Headley, J.V., Peru, K.M., Barrow, M.P., 2009. Mass spectrometric characterization of naphthenic acid in environmental samples: a review. Mass Spectrom. Rev. 28, 121e134.

269

Herman, D.C., Fedorak, P.M., MacKinnon, M.D., Costerton, J.W., 1994. Biodegradation of naphthenic acids by microbial populations indigenous to oil sands tailings. Can. J. Microbiol. 40, 467e477. Holowenko, F.M., MacKinnon, M.D., Fedorak, P.M., 2002. Characterization of naphthenic acids in oil sands wastewaters by gas chromatography-mass spectrometry. Water Res. 36, 2843e2855. Homa, J., Olchawa, E., Sturzenbaum, S.R., Morgan, A.J., Plytycz, B., 2005. Early-phase immunodetection of metallothionein and heat shock proteins in extruded earthworm coelomocytes after dermal exposure to metal ions. Environ. Pollut. 135, 275e280. Jo, P.G., Choi, Y.K., Choi, C.Y., 2008. Cloning and mRNA expression of antioxidant enzymes in the Pacific oyster, Crassostrea gigas in response to cadmium exposure. Comp. Biochem. Physiol. Part C-Toxicol. Pharm. 147, 460e469. Jones, D., Scarlett, A.G., Wast, C.E., Rowland, S.J., 2011. Toxicity of individual naphthenic acids to Vibrio fischeri. Environ. Sci. Technol. 45, 9776e9782. Jones, D., West, C.E., Scarlett, A.G., Frank, R.A., Rowland, S.J., 2012. Isolation and estimation of the ‘aromatic’ naphthenic acid content of an oil sands processaffected water extract. J. Chromatogr. A 1247, 171e175. Kavanagh, R.J., Frank, R.A., Oakes, K.D., Servos, M.R., Young, R.F., Fedorak, P.M., MacKinnon, M.D., Solomon, K.R., Dixon, D.G., van der Kraak, G., 2011. Fathead minnow (Pimephales promelas) reproduction is impaired in aged oil sands process-affected waters. Aquat. Toxicol. 101, 214e220. Kavanagh, R.J., Frank, R.A., Burnison, B.K., Young, R.F., Fedorak, P.M., Solomon, K.R., van der Kraak, G., 2012. Fathead minnow (Pimephales promelas) reproduction is impaired when exposed to a naphthenic acid extract. Aquat. Toxicol. 116e117, 34e42. Kavanagh, R.J., Frank, R.A., Solomon, K.R., van der Kraak, G., 2013. Reproductive and health assessment of fathead minnows (Pimephales promelas) inhabiting a pond containing oil sands process-affected water. Aquat. Toxicol. 130e131, 201e209. Knag, A.C., Verhaegen, S.V., Ropstad, E., Mayer, I., Meier, S., 2013. Effects of polar oil related hydrocarbons on steroidogenesis in vitro in H295R cells. Chemosphere 92, 106e115. Lacaze, E., Devaux, A., Bruneau, A., Bony, S., Sherry, J., Gagne, F., 2014. Genotoxic potential of several naphthenic acids and a synthetic oil sands process-affected water in rainbow trout (Oncorhynchus mykiss). Aquat. Toxicol. 152, 291e299. Lim, J., Luderer, U., 2010. Oxidative damage increases and antioxidant gene expression decreases with aging in the mouse ovary. Biol. Reprod. 84, 775e782. Limon-Pacheco, J., Gonsebatt, M.E., 2009. The role of antioxidants and antioxidantrelated enzymes in protective responses to environmentally induced oxidative stress. Mutat. Res. 674, 137e147. Lister, A., Nero, V., Farwell, A., Dixon, D.G., Van Der Kraak, G., 2008. Reproductive and stress hormone levels in goldfish (Carassius auratus) exposed to oil sands process-affected water. Aquat. Toxicol. 87, 170e177. Melvin, S.D., Lanctot, C.M., Craig, P.M., Moon, T.W., Peru, K.M., Headly, J.V., Trudeau, V.L., 2013. Effects of naphthenic acid exposure on development and liver metabolic processes in anuran tadpoles. Environ. Pollut. 177, 22e27. Melvin, S.D., Trudeau, V.L., 2012. Growth, development and incidence of deformities in amphibian larvae exposed as embryos to naphthenic acid concentrations detected in the Canadian oil sands region. Environ. Pollut. 167, 178e183. Misiti, T., Tezel, U., Pavlostathis, S.G., 2013. Fate and effect of naphthenic acids on oil refinery activated sludge wastewater treatment systems. Water Res. 47, 449e460. Mo, X., Qiao, Y., Sun, Z., Sun, X., Li, Y., 2012. Molecular toxicity of earthworms induced by cadmium contaminated soil and biomarkers screening. J. Environ. Sci. China 24, 1504e1510. Molina, A., Biemar, F., Muller, F., Iyengar, A., Prunet, P., Maclean, N., Martial, J.A., Muller, M., 2000. Cloning and expression analysis of an inducible HSP70 gene from tilapia fish. FEBS Lett. 474, 5e10. Nero, V., Farwell, A., Lee, L.E.J., van Meer, T., MacKinnon, M.D., Dixon, D.G., 2006. The effects of salinity on naphthenic acid toxicity to yellow perch: gill and liver histopathology. Ecotox. Environ. Safe 65, 252e264. Nunez, M.T., Osorio, A., Tapia, V., Vergara, A., Mura, C.V., 2001. Iron-induced oxidative stress up-regulates calreticulin levels in intestinal epithelial (Caco-2) cells. J. Cell. Biochem. 82, 660e665. OECD., 2004. Guideline for Testing of Chemicals, No. 222, Earthworm Reproduction Test (Eisenia Fetida/andrei). Organization for Economic Co-Operation and Development, Paris. Oumi, T., Ukena, K., Matsushima, O., Ikeda, T., Fujita, T., Minakata, H., Nomoto, K., 1996. Annetocin, an annelid oxytocin-related peptide, induces egg-laying behavior in the earthworm, Eisenia foetida. J. Exp. Zool. Part A 276, 151e156. Peters, L.E., MacKinnon, M., Van Meer, T., Van den Heuvel, M.R., Dixon, D.G., 2007. Effects of oil sand process-affected waters and naphthenic acids on yellow perch (Perca flavescens) and Japanese medaka (Orizias latipes) embryonic development. Chemosphere 67, 2177e2183. Reinardy, H.C., Scarlett, A.G., Henry, T.B., West, C.E., Hewitt, L.M., Frank, R.A., Rowland, S.J., 2013. Aromatic naphthenic acids in oil sands process-affected water, resolved by GCGC-MS, only weakly induce the gene for vitellogenin production in zebrafish (Danio rerio) larvae. Environ. Sci. Technol. 47, 6614e6620. Ricketts, H., Morgan, A., Spurgeon, D., Kille, P., 2004. Measurement of annetocin gene expression: a new reproductive biomarker in earthworm ecotoxicology. Ecotox. Environ. Safe 57, 4e10. Rogers, V.V., Liber, K., MacKinnon, M.D., 2002. Isolation and characterization of naphthenic acids from Athabasca oil sands tailings pond water. Chemosphere 48, 519e527.

270

J. Wang et al. / Environmental Pollution 204 (2015) 264e270

Roubalova, R., Dvorak, J., Prochazkova, P., Elhottova, D., Rossmann, P., Skanta, F., Bilej, M., 2014. The effect of dibenzo-p-dioxin- and dibenzofuran-contaminated soil on the earthworm Eisenia Andrei. Environ. Pollut. 193, 22e28. Scarlett, A.G., Reinardy, H.C., Henry, T.B., West, C.E., Frank, R.A., Hewitt, L.M., Rowland, S.J., 2013. Acute toxicity of aromatic and non-aromatic fractions of naphthenic acids extracted from oil sands process-affected water to larval zebrafish. Chemosphere 93, 414e420. Scarlett, A.G., West, C.E., Jones, D., Galloway, T.S., Rowland, S.J., 2012. Predicted toxicity of naphthenic acids present in oil sands process-affected waters to a range of environmental and human endpoints. Sci. Total Environ. 425, 119e127. Silerova, M., Kauschke, E., Prochazkova, P., Joskova, R., Tuckova, L., Bilej, M., 2007. Characterization, molecular cloning and localization of calreticulin in Eisenia fetida earthworms. Gene 397, 169e177. Simon, P., 2003. Q-gene: processing quantitative real-time RT-PCR data. Bioinformatics 19, 1439e1440. Smits, J.E.G., Hersikorn, B.D., Yound, R.F., Fedorak, P.M., 2012. Physiological effects and tissue residues from exposure of leopard frogs to commercial naphthenic acids. Sci. Total Environ. 437, 36e41. Telerman, A., Amson, R., 2009. The molecular programme of tumour reversion: the steps beyond malignant transformation. Nat. Rev. Cancer 9, 206e216. Van den Heuvel, M.R., Hogan, N.S., Roloson, S.D., van der Kraak, G.J., 2012. Reproductive development of yellow perch (Perca flavescens) exposed to oil sandsaffected waters. Environ. Toxicol. Chem. 31, 654e662. Van Groenigen, J.W., Lubbers, I.M., Vos, H.M.J., Brown, G.G., De Deyn, G.B., Van, Groenigen, J.V., 2014. Earthworms increase plant production: a meta-analysis. Sci. Rep. 4, 6365. http://dx.doi.org/10.1038/srep06365. Vasseur, P., Bonnard, M., 2014. Ecogenotoxicology in earthworms: a review. Curr. Zool. 60, 255e270. Wan, Y., Wang, B.L., Khim, J.S., Hong, S., Shim, W.J., Hu, J.Y., 2014. Naphthenic acids in coastal sediments after the Hebei sprit oil spill: a potential indicator for oil contamination. Environ. Sci. Technol. 48, 4153e4163.

Wang, J., Cao, X.F., Chai, L.W., Liao, J.Q., Huang, Y., Tang, X.Y., 2015a. Quantification and characterization of naphthenic acids in soil of oil exploring area in China by GC/MS. Anal. Methods 7, 2149e2154. Wang, J., Cao, X.F., Liao, J.Q., Huang, Y., Tang, X.Y., 2015b. Carcinogenic potential of PAHs in oil-contaminated soils from the main oil fields across China. Environ. Sci. Pollut. Res. http://dx.doi.org/10.1007/s11356-014-3954-9. Wang, J., Cao, X.F., Chai, L.W., Liao, J.Q., Huang, Y., Tang, X.Y., 2015c. Oxidative damage of naphthenic acids on the Eisenia fetida earthworm. Environ. Toxicol. http://dx.doi.org/10.1002/tox.22139. Wang, B., Wan, Y., Gao, Y., Yang, M., Hu, J., 2013. Determination and characterization of oxy-naphthenic acids in oil field wastewater. Environ. Sci. Technol. 47, 9545e9554. Webb, D., Gagnon, M.M., 2009. The value of stress protein 70 as an environmental biomarker of fish health under field conditions. Environ. Toxicol. 24, 287e295. West, C.E., Scarlett, A.G., Pureveen, J., Tegelaar, E.W., Rowland, S.J., 2013. Abundant naphthenic acids in oil sands process-affected water: studies by synthesis, derivatisation and two-dimensional gas chromatography/high-resolution mass spectrometry. Rap. Commun. Mass Spectrom. 27, 357e365. Wiseman, S.B., He, Y.H., Din, M.G.E., Martin, J.W., Jones, P.D., Hecker, M., Giesy, J.P., 2013a. Transcriptional responses of male fathead minnows exposed to oil sands process-affected water. Comp. Biochem. Physiol. C-Toxicol. Pharm. 157, 227e235. Wiseman, S.B., Anderson, J.C., Liber, K., Giesy, J.P., 2013b. Endocrine disruption and oxidative stress in larvae of Chironomus dilutus following short-term exposure to fresh or aged oil sands process-affected water. Aquat. Toxicol. 142, 414e421. Woodworth, A.P.J., Frank, R.A., McConkey, B.J., Muller, K.M., 2012. Toxic effects of oil sand naphthenic acids on the biomass accumulation of 21 potential phytoplankton remediation candidates. Ecotox. Environ. Safe 86, 156e161. Zheng, S., Song, Y., Qiu, X., Sun, T., Leigh, A.M., Zhang, W., 2008. Annetocin and TCTP expressions in the earthworm Eisenia fetida exposed to PAHs in artificial soil. Ecotox. Environ. Safe 71, 566e573.