RESEARCH ARTICLE For reprint orders, please contact: [email protected]

Transcriptional response to vancomycin in a highly vancomycin-resistant Streptomyces coelicolor mutant Fernando Santos-Beneit1,2, Lorena T Fernández-Martínez1,3, Antonio Rodríguez García1,4, Seomara Martín-Martín1, María Ordóñez-Robles2, Paula Yagüe5, Angel Manteca5 & Juan F Martín*,2 ABSTRACT: Aim: The main objective of this study is to understand the mechanism of vancomycin resistance in a Streptomyces coelicolor disrupted mutant highly resistant to vancomycin. Materials & methods: Different techniques have been performed in the study including gene disruption, primer extension, antibiotic susceptibility tests, electron microscopy, confocal microscopy, cell wall analysis and microarrays. Results: During the phenotypical characterization of mutant strains affected in phosphateregulated genes of unknown function, we found that the S. coelicolor SCO2594 disrupted mutant was highly resistant to vancomycin and had other phenotypic alterations such as antibiotic overproduction, impaired growth and reduction of phosphate cell wall content. Transcriptomic studies with this mutant indicated a relationship between vancomycin resistance and cell wall stress. Conclusion: We identified a S. coelicolor mutant highly resistant to vancomycin in both high and low phosphate media. In addition to Van proteins, others such as WhiB or SigE appear to be involved in this regulatory mechanism. Nowadays, a significant number of nosocomial infections are due to antibiotic-resistant microorganisms. Vancomycin has long been used as a last-resort treatment for enterococcal infections and methicillin-resistant Staphylococcus aureus (MRSA), a major killer in hospital-acquired infections. In the last three decades, vancomycin-resistant enterococci (VRE) as well as vancomycin-resistant, methicillin-resistant Staphylococcus aureus (VRSA) have emerged in hospitals [1,2] . The mechanism of action of vancomycin involves the inhibition of peptidoglycan cross-linking by binding to the d-alanyl-d-alanine (d-Ala-d-Ala) terminus of peptidoglycan precursors [3] . The most common vancomycin resistance mechanism in pathogenic bacteria involves conversion of the dipeptide d-Ala-d-Ala to d-Ala-d-lactate (d-Lac) or d-Ala-d-Serine, coupled with peptidase-mediated elimination of d-Ala-d-Ala dipeptides from the cell wall. This resistance mechanism requires the following three genes: vanH, coding for a dehydrogenase, which is involved in the conversion of pyruvate to d-Lac [4] ; vanA, coding for a d-Ala-d-Lac ligase [5] ; and vanX, which codes for a dddipeptidase that cleaves the remaining d-Ala-d-Ala dipeptides [6] . Transcriptional activation of vanHAX genes is regulated by the VanR–VanS two-component system [7] . The number of genes present in the resistance cluster can vary, but the ‘core’ cluster usually consists of these five genes (vanSRHAX ).

KEYWORDS 

• cell wall • glycopeptides • PhoP • phosphate • SCO2594 • Streptomyces • teicoplanin • vancomycin

Instituto de Biotecnología de León (INBIOTEC), Avda. Real 1, 24006 León, Spain Departamento de Biología Molecular & IBBTEC, Facultad de Medicina, Universidad de Cantabria, 39011 Santander, Spain 3 Department of Molecular Microbiology, John Innes Centre, Norwich, NR4 7UH, UK 4 Área de Microbiología, Facultad de Ciencias Biológicas y Ambientales, Universidad de León, Campus de Vegazana s/n, 24071 León, Spain 5 Área de Microbiología, Departamento de Biología Funcional & IUOPA, Facultad de Medicina, Universidad de Oviedo, 33006 Oviedo, Spain *Author for correspondence: Tel.: +34987291505; Fax: +34987291506; [email protected] 1 2

10.2217/FMB.14.21 © 2014 Future Medicine Ltd

Future Microbiol. (2014) 9(5), 603–622

part of

ISSN 1746-0913

603

Research Article  Santos-Beneit, Fernández-Martínez, Rodríguez García et al. Table 1. Bacterial strains, plasmids and primers used in this study. Strain, plasmid or primer

Description

Source or reference Ref.

S. coelicolor M145 S. coelicolor INB201 S. coelicolor SCO1908::Tn5062 S. coelicolor SCO2591::Tn5062 S. coelicolor SCO2592::Tn5062

SCP1− SCP2− Pgl+ ΔphoP AmR SCO1908::Tn5062 , AmR SCO2591::Tn5062 , AmR SCO2592::Tn5062 , AmR

Kieser et al. Santos-Beneit et al. This study This study This study

S. coelicolor SCO2593::Tn5062 S. coelicolor SCO2594::Tn5062 S. coelicolor SCO4174::Tn5062 S. coelicolor SCO4873::Tn5062 S. coelicolor SCO4874::Tn5062 S. coelicolor SCO4878::Tn5062 S. coelicolor SCO4879::Tn5062

SCO2593::Tn5062 , AmR SCO2594::Tn5062 , AmR SCO4174::Tn5062 , AmR SCO4873::Tn5062 , AmR SCO4874::Tn5062 , AmR SCO4878::Tn5062 , AmR SCO4879::Tn5062 , AmR

This study This study This study This study This study This study This study

             

Cloning vector, AmpR PCR product carrying SCO2594 with its own promoter cloned into pBSIISK+/SpeI/EcoRI, AmpR Streptomyces integrative cloning vector (ϕC31 derivative), AmR NeoR BglII-EcoRV pFS-2594 fragment cloned into pLUXAR-neo, AmR NeoR S. coelicolor phoP DBD gene cloned into pGEX-2T SC17 cosmid carrying SC17.1.B12 transposant

Agilent This study

   

Bacterial strains [36] [19]

     

Plasmids & cosmids pBluescript II SK+ pFS-2594

pLUXAR-neo pCOM-2594 pGEX-DBD SC17.1.B12 SCC88.2.F11 SCC88.2.F03 SCC88.1.A06 SCC88.1.G10 SCD66.1.C11 K20.1.H01 K20.1.B06 2SCK8.1.A06 2SCK8.2.C10

Santos-Beneit et al. This study Sola-Landa et al.

Fernández-Martínez et al. SCC88 cosmid carrying SCC88.2.F11 Fernández-Martínez transposant et al. SCC88 cosmid carrying SCC88.2.F03 Fernández-Martínez transposant et al. SCC88 cosmid carrying SCC88.1.A06 Fernández-Martínez transposant et al. SCC88 cosmid carrying SCC88.1.G10 Fernández-Martínez transposant et al. SCD66 cosmid carrying SCD66.1.C11 Fernández-Martínez transposant et al. StK20 cosmid carrying K20.1.H01 transposant Fernández-Martínez et al. StK20 cosmid carrying K20.1.B06 transposant Fernández-Martínez et al. 2SCK8 cosmid carrying 2SCK8.1.A06 Fernández-Martínez transposant et al. 2SCK8 cosmid carrying 2SCK8.2.C10 Fernández-Martínez transposant et al.

Primers FSC80 FSC81 2594-rev_+44-FAM 2594-dir_-242

604

Future Microbiol. (2014) 9(5)

5´GACCGACTAGTAGATCTGGACGAGGC­ CCAGCAGGAG 5´GCGGTGAATTCGTCGGGCACGGTGAC­GCAG (6-FAM) 5´CGCCGGTAGACACCGACCAAC 5´GCAGGAGTTCGACGGCTTCGAG

This study This study This study This study

future science group

[19]

  [15] [29] [29] [29] [29] [29] [29] [29] [29] [29] [29]

Transcriptional response to vancomycin in a vancomycin-resistant S. coelicolor mutant  van-like genes have been found not only in the most virulent enterococci and staphylococci strains, but also in glycopeptide antibiotic producers, such as Streptomyces toyocaensis and Amycolatopsis orientalis, producers of compounds A47934 and vancomycin, respectively [8] . Hong et al. [9] reported the first example of vancomycin resistance in a nonpathogenic and nonglycopeptide-producing bacterium, Streptomyces coelicolor. The S. coelicolor vancomycin resistance cluster consists of seven genes, divided into four transcription units: vanRS (SCO3589–90), vanJ (SCO3592), vanK (SCO3593) and vanHAX (SCO3594–96). VanK belongs to the Fem family of enzymes, which add the branch amino acids to the stem pentapeptide of peptidoglycan precursors [10] . Despite this protein not being found in other vancomycin resistance gene clusters, it is essential for vancomycin resistance in S. coelicolor [10] . VanJ is a membrane protein that is not involved in vancomycin resistance; however, it seems to be involved in resistance to another glycopeptide, teicoplanin [11] . Other mechanisms such as synthesis of a thicker cell wall, reduced peptidoglycan crosslinking, modification of the cell wall precursor with a tetra stem peptide, or increasing numbers of d-Ala-d-Ala residues, have also been described as mechanisms to reduce the susceptibility to glycopeptides in bacteria [12] . Recently, we have demonstrated that vancomycin resistance in S. coelicolor depends on the inorganic phosphate (Pi) concentration of the culture media. Addition of Pi to the medium significantly increased vancomycin sensitivity in S. coelicolor wild-type and ΔphoP mutant strains [13] . Pi control in S. coelicolor, as in other bacteria, is mainly mediated by the two-component system PhoR–PhoP [14] . Under Pi limitation the phosphorylated active form of PhoP binds to specific sequences and regulates expression of PhoP-dependent genes [15] . Over the past few years, several PhoP-regulated genes coding for proteins involved in Pi transport, scavenging or saving have been identified in S. coelicolor [15–18] . PhoP is also involved in secondary metabolite regulation and nutritional crossregulation [19–24] . More than 30 PhoP targets have been identified in vitro by electrophoretic mobility shift assays (EMSAs) and DNase I footprinting analyses, and many others in vivo with chromatin immunoprecipitation-on-microarray (ChIP-on-chip) analysis in this bacterium [14,25] . However, there

future science group

Research Article

are still a large number of uncharacterized PhoP targets [14,16,25–27] . In this study we explored vancomycin resistance and other phenotypic characteristics of S. coelicolor M145 and mutant strains affected in uncharacterized Pi-regulated genes potentially involved in cell wall metabolism [16,25,26] . One of the mutants (SCO2594::Tn5062) demonstrated a different vancomycin resistance phenotype from that of the parental strain, as well as many other phenotypic alterations, including antibiotic overproduction, impaired growth and reduction of phosphate cell wall content. This mutant was highly resistant to vancomycin and lost the phosphate control of vancomycin resistance on high Pi media. The main objective of this study was to understand the mechanism of vancomycin resistance in S. coelicolor SCO2594::Tn5062. To achieve this we combined biochemical and transcriptomic methods to study S. coelicolor strains: M145 and SCO2594::Tn5062, and two distinct Pi-replete media, tryptic soy agar (TSA) and MG-18.5. Materials & methods ●●Bacterial strains, plasmids & growth

conditions

The S. coelicolor species used in this work are listed in Table 1. Escherichia coli strains were cultured and transformed using standard procedures. The SCO2594 promoter region for EMSA analyses was amplified by PCR using total DNA as a template and the primers 2594-dir_-242 and 2594-rev_+44-FAM (see Table 1). The SCO2594 gene with its own promoter was amplified by PCR using total DNA as template as follows. The primers FSC80 (sense) and FSC81 (antisense) amplified a 2248-bp fragment encompassing the SCO2594 full open-reading frame and the promoter region of the gene from the -254 position. A SpeI–EcoRI (FSC80–FSC81) fragment was cloned into pBluescriptIISK+, yielding pFS-2594. The insert of the plasmid was checked by sequencing and introduced into the Streptomyces integrative plasmid pLUXAR-neo to generate pCOM-2594. Tryptic soy broth (TSB; 3% of tryptone soya broth containing 14 mM phosphate), MG-3.2 (defined medium containing 3.2 mM phosphate) [17] and MG-18.5 (defined medium containing 18.5 mM phosphate) [17] S. coelicolor liquid cultures (100 ml of medium in 500-ml baffled flasks) were inoculated with 106 spores ml-1 and incubated at 30°C and 300 rpm

www.futuremedicine.com

605

Research Article  Santos-Beneit, Fernández-Martínez, Rodríguez García et al. MG-18.5 medium provides sufficient phosphate concentration for at least 90 h of culture. On the contrary, phosphate is starved from the medium in MG-3.2 before 44 h of culture [17] . Samples in MG-18.5 medium were taken at 36, 44 and 48 h; and in MG-3.2 at 44, 48, 56, 72 and 80 h. Antibiotic production was determined in MG-3.2, as described by Santos-Beneit et al. [19] . For dry weight determination, culture samples of 2 ml were washed twice with MilliQ water and dried for 4 days at 80°C. The following agar-containing media were used: TBO, TSA, MMCGT [28] and MMCGT+P (MMCGT plus 1% potassium phosphate) [13] . Of these media, only MMCGT has a low phosphate ­concentration (i.e., 2.87 mM). ●●Gene disruption

All the disrupted mutants were obtained using the apramycin resistance Tn5062 cassette as described in Fernández-Martínez et al. [29] . The SCO2594 insertion was verified by Southern hybridization using internal probes to both the apramycin resistance and SCO2594 genes. The rest of mutants were checked by Southern blot hybridization using the Tn5062 itself as probe. Two independent clones of each mutant were selected for this study. ●●Electrophoretic mobility shift assay

The conditions for DNA-protein binding were described previously by Sola-Landa et al. [15] . Samples were run in 0.5× TBE buffer on a 5% polyacrylamide native gel over 2 h at 80V using Bio-Rad Mini Protean III. After, the run the gel was scanned in a CCD camera Ettan™ DIGE Imager (GE Healthcare) and analyzed using the software ImageQuant TL. ●●Primer extension analysis

At 36 h, RNA samples were taken from MG-18.5 cultures of S. coelicolor M145 (wild-type). The isolation of RNA was performed with the RNeasy Mini Kit (Qiagen). RNA concentration and quality was checked using a Nanodrop ND-1000 (Thermo Fisher Scientific) and a 2100 Bioanalyzer (Agilent). The 5´-end was determined, as described by Santos-Beneit et al. [30] using Superscript III reverse transcriptase (Invitrogen) and the primer 2594-rev_+44-FAM (complementary to the coding strand from +24 to +44). To determine the product size accurately, sequencing reactions were performed with the same primer and with the Thermo Sequenase

606

Future Microbiol. (2014) 9(5)

Primer Cycle Sequencing kit (GE Healthcare). The products were combined with the GeneScan LIZ-500 size standard and loaded onto an ABI PRISM 3130 sequencer (Applied Biosystems). Electrophoretograms were analyzed using the Peak Scanner software (Applied Biosystems). ●●Vancomycin & teicoplanin susceptibility

tests

For MIC determination, confluent lawns of 107 spores were spread onto the plates containing a range of different antibiotic concentrations, and the results were evaluated after 3 days of incubation at 30°C. For broth dilution analyses the antibiotic was added to the medium before inoculation. Vancomycin hydrochloride was purchased from Sigma (code 94747). The vancomycin and teicoplanin disc diffusion assays were performed as described in Santos-Beneit and Martín [13] using commercial antibiotic discs containing 30 μg of the antibiotic (BD BBL™; Germany). ●●Transmission electronic microscopy

S. coelicolor strains were grown on TBO agar for 5 days. Samples were fixed with 2.5% glutaraldehyde and then treated with 1% OsO4 in 0.1 M phosphate-buffered saline (PBS) at room temperature for 60 min. Subsequently, the samples were dehydrated with increasing concentrations of ethanol, treated with propylene oxide and embedded in EPON 812. Ultra-thin sections were stained with toluidine blue and examined with a JEOL 1010 Transmission Electron Microscope (Tokyo, Japan). ●●Confocal laser scanning fluorescence

microscopy

For the vancomycin staining, cells were fixed using PBS containing 2.8% paraformaldehyde and 0.0045% glutaraldehyde. BODIPY FL vancomycin was purchased from Invitrogen (V34850) and used at a concentration of 0.5 μg ml-1 for 15 min. After staining, samples were washed twice with PBS and observed under a Leica TCS-SP2-AOBS confocal laser scanning microscope at an excitation wavelength of 505 nm and an emission wavelength of 513 nm. ●●Phosphate cell wall analyses

Cell walls were isolated from S. coelicolor MG-18.5 cultures as described by Meredith et al. [31] with the following modifications. At the desired time, 20 ml of culture were collected by

future science group

Transcriptional response to vancomycin in a vancomycin-resistant S. coelicolor mutant  centrifugation (4000 × g; 10 min), washed once with 30 ml of buffer 1 (50 mM 2-[N-morpholino] ethanesulfonic acid [MES], pH 6.5) and resuspended again in 30 ml of buffer 1. Cells were broken by sonication and subsequently boiled for 15 min in order to avoid the autocatalytic activity of the cells. The samples were cooled down and incubated with DNase and RNase for 1 h at 37°C. After centrifugation (1000 × g; 10 min) the supernatant was collected into a new tube and the pellet (containing the unbroken cells) discarded. The supernatant was centrifuged at 10,700×g for 20 min and the pellet, containing the cell walls, was resuspended in 1 ml of buffer 2 (4% SDS, 50 mM MES, pH 6.5) and transferred to a 2-ml microcentrifuge tube. Samples were then boiled for 30 min in order to destroy the membranes. Next, the pellets were washed once with buffer 1, digested with proteinase K (20 mM Tris-HCl, pH 8.0, 0.5% SDS and 80 μg ml-1 of proteinase K) for 4 h at 50°C, washed three times with 0.9% NaCl, and resuspended in 500 μl of 1 N NaOH. In order to obtain a good phosphate extraction, samples were shaken at 100°C for at least 3 h. Finally, the supernatant was neutralized with 500 μl of 1 N HCl and directly analyzed with the malachite green assay as described by Lanzetta et al. [32] . ●●RNA isolation, microarray hybridization

& data analysis

Transcriptomic profiles of both S. coelicolor M145 and INB201 (ΔphoP) strains were determined using the data from the temporal series TS1 and TS3 of the ERA-NET SysMO project STREAM (GEO accessions GSE18489 and GSE31068). Cultures were carried out in 3-l fermentors as described by Nielset et al. [26] and Thomas et al. [27] . For the transcriptomic analyses using MG-18.5 samples, total RNA was isolated after stabilization of liquid culture samples with two volumes of RNAProtect™ Bacteria Reagent (Qiagen). The samples were treated with lysozyme (15 mg ml-1, 10 min, room temperature), suspended in RLT buffer (Qiagen) and transferred to Lysing Matrix B tubes (MP Biochemicals) for mechanical disruption with a FastPrep® homogenizer (speed 6.5, 30 s, two times). The lysates were extracted twice with acid phenol:chloroform:isoamyl alcohol 25:24:1 and the RNA was purified using the RNeasy ® Mini Kit (Qiagen), including on-column DNase digestion. RNA from solid TSA cultures was

future science group

Research Article

purified as follows. The mycelia was carefully removed with a small spatula and immediately put in a 50-ml plastic tube containing glass balls and 5 ml of RNAProtect Bacteria reagent. Vigorous vortexing was performed to provide disaggregation of the cells from the agar remnants and immediate stabilization of RNA. A centrifugation step was then performed in order to collect the cells in the bottom of the tubes. Suspended cells were transferred to a new tube, centrifuged, and the resulting pellets were treated in the same way as the samples from the liquid cultures. RNA concentration, purity and integrity were checked using a NanoDrop™ ND-1000 (Thermo Fisher Scientific) and a 2100 Bioanalyzer (Agilent). RNA integrity number (RIN) values ranged between 8.9 and 10. cDNA samples labelled with Cy3-dCTP were obtained as indicated previously [16] . Genomic DNA of S. coelicolor M145 was labelled with Cy5-dCTP and used as the common reference. gDNA labelling, hybridization and washing conditions were as previously described [33] . The microarrays for gene expression analysis were obtained from Oxford Gene Technology in the 4x44k format (AMADID 017905). Each microarray comprises 43,798 experimentally validated probes (60-mer oligonucleotides) that cover both CDS and intergenic regions. Hybridized slides were scanned with an Agilent G2565BA scanner using the extended dynamic mode. Fluorescence intensities were quantified and processed as indicated in Yagüe et al. [33] . For the statistical contrasts, only data from the 35,621 probes that target CDS and lack potential cross-hybridization were used (see previous reference for details). Results ●●Disruption of Pi-regulated genes in

S. coelicolor

The European STREAM consortium has provided the transcriptomic data from the time series of the S. coelicolor parental M145 and ΔphoP mutant INB201 strains [26,27] ; these data have revealed a wealth of Pi- and PhoPdependent patterns of regulation [14] . In this work, we investigated the following Pi-regulated profiles (see Figure 1): PhoP dependent upregulation (SCO4872–82), PhoP dependent downregulation (SCO2592–94), PhoP independent upregulation (SCO1908) and PhoP independent downregulation (SCO2591). Several authors have implicated all these genes, except SCO1908, in cell wall metabolism; however, no

www.futuremedicine.com

607

Research Article  Santos-Beneit, Fernández-Martínez, Rodríguez García et al. further studies have been performed [16,25,26,34] . Previous results of our laboratory identified SCO4872–82 genes as new members of the PhoP regulon in S. coelicolor; that is, PhoP binding to the promoters of these genes was proven [16,25] . To determine if Pi control of SCO2592–94 genes is exerted directly by PhoP, we performed an EMSA analysis with the purified GST-PhoPDBD protein [15] . The promoter of the operon was deduced by primer extension analysis (Figure 2A) . Then, a 286-bp fragment encompassing this promoter was labeled with the fluorophore 6-FAM and assayed with two concentrations of GST-PhoPDBD protein. Binding of PhoP to the SCO2594 promoter region was clearly observed, even when concentrations as low as 0.5 μM of protein were used (Figure 2B) . We have recently reported that vancomycin resistance is regulated by Pi in an apparent PhoP-independent manner [13] . In this work we attempted to make progress in this finding by using different S. coelicolor mutants. We chose the aforementioned Pi-regulated genes for the study and we performed the next nine disrupted mutants: SCO4873::Tn5062, SCO4874 ::Tn5062, SCO4878 ::Tn5062, SCO4879 ::Tn5062, SCO2592 ::Tn5062, SCO2593 ::Tn5062, SCO2594 ::Tn5062, SCO1908::Tn5062 and SCO2591::Tn5062 (Figure 1) . ●●Effect of vancomycin over the growth of

the mutants

The vancomycin resistance pattern of S. coelicolor has been the subject of several studies, mostly carried out using the defined MMCGT medium [9,11,28,35] . Alternatively, we have reported that S. coelicolor becomes sensitive to vancomycin when grown at high Pi concentrations, such as on TSA or Pi-supplemented MMCGT (MMCGT+P) agar plates [13] . In this study, we tested the vancomycin resistance pattern of the afore mentioned nine mutant strains. Disc diffusion assays (i.e., va-30) revealed that all the mutants, as well as the parental strain, were resistant to vancomycin in MMCGT (data not shown). On the other hand, large inhibition zones were produced around the vancomycin discs in all the strains when TSA or MMCGT+P media were used, except for SCO2594::Tn5062 (Figure 3A) . Complementation of SCO2594::Tn5062 with the SCO2594 native gene restored the parental phenotype (Figure 3A) .

608

Future Microbiol. (2014) 9(5)

In order to quantify the different magnitude of vancomycin resistance between the M145 and SCO2594::Tn5062 strains, we determined MIC values in TSA, MMCGT and MMCGT+P media (see ‘Material & methods’ section). MIC values with TSA were markedly different (20 and >200 μg ml-1 for M145 and SCO2594::Tn5062, respectively). The difference in MMCGT+P was also high; SCO2594::Tn5062 presented a fivefold higher resistance (20 and 100 μg ml-1 for M145 and SCO2594::Tn5062, respectively). On the contrary, MIC values in MMCGT (lacking additional phosphate) were similar (80–100 μg ml-1 for M145 and SCO2594::Tn5062, respectively). We also tested vancomycin resistance in the non-agar-containing version of TSA (i.e., TSB). As shown in Figure 3B, only 10 μg ml-1 of vancomycin was required to abolish growth in the parental strain; whereas 150 μg ml-1 of vancomycin was not sufficient to abolish growth completely in the mutant. These results indicate that, in contrast to the parental strain, SCO2594::Tn5062 is highly resistant to ­vancomycin in all media tested. ●●SCO2594 disruption does not confer

general glycopeptide resistance

In order to test if disruption of SCO2594 confers general resistance to glycopeptides, teicoplanin resistance of SCO2594::Tn5062 was also assayed. Teicoplanin is a glycopeptide antibiotic to which the parental strain is normally sensitive [9,11] . On the contrary to vancomycin, this antibiotic fails to induce expression of the van gene cluster in S. coelicolor [9] . However, when van gene expression is induced the bacterium is also able to grow in the presence of teicoplanin [11] . Although the aim of the experiment was to check teicoplanin resistance of SCO2594::Tn5062, the rest of the mutants were also included in the test. None of the strains, including SCO2594::Tn5062, were resistant to teicoplanin in any of the conditions tested (high or low Pi), as shown with disc diffusion assays (Tei-30; Supplementary Figure S1, please see online at http://www.futuremedicine.com/doi/ full/10.2217/FMB.14.21). In order to test the effect of another class of antibiotic targeting a different reaction of the cell wall biosynthesis, SCO2594::Tn5062 was assayed with the nucleoside antibiotic tunicamycin. The fact that SCO2594 shares a eukaryotic domain (DUF3184) with

future science group

Research Article

Transcriptional response to vancomycin in a vancomycin-resistant S. coelicolor mutant 

C SCO1908 51

K20.1.H01

K20.1.B06

76

4878

4879

13.0 12.0 11.0 10.0 9.0 8.0 7.0 6.0 5.0 4.0 12 18 24 30 36 42 48 54 60

81

82

INB201, ∆ phoP strain

13.0 12.0 11.0 10.0 9.0 8.0 7.0 6.0 5.0 4.0 12 18 24 30 36 42 48 54 60

Time (h) B SCO2592-SCO2594

80

1908

2SCK8.1.A06 2SCK8.2.C10

M145, parental strain

Log transcription values

77

SC17.1.B12

Log transcription values

4874

Log transcription values

72 4873

M145, parental strain

13.0 12.0 11.0 10.0 9.0 8.0 7.0 6.0 5.0 4.0 12 18 24 30 36 42 48 54 60

Time (h)

2592

2593

12 18 24 30 36 42 48 54 60 Time (h)

2591

12 18 24 30 36 42 48 54 60 Time (h)

13.0 12.0 11.0 10.0 9.0 8.0 7.0 6.0 5.0 4.0

M145, parental strain Log transcription values

13.0 12.0 11.0 10.0 9.0 8.0 7.0 6.0 5.0 4.0

INB201, ∆phoP strain Log transcription values

Log transcription values

Log transcription values

13.0 12.0 11.0 10.0 9.0 8.0 7.0 6.0 5.0 4.0

Time (h)

C88.2.F11

C88.2.F03 C88.1.A06 C88.1.G10

M145, parental strain

INB201, ∆phoP strain 13.0 12.0 11.0 10.0 9.0 8.0 7.0 6.0 5.0 4.0 12 18 24 30 36 42 48 54 60

Time (h) D SCO2591

2594

Log transcription values

A SCO4872-SCO4882

12 18 24 30 36 42 48 54 60 Time (h)

13.0 12.0 11.0 10.0 9.0 8.0 7.0 6.0 5.0 4.0

INB201, ∆phoP strain

12 18 24 30 36 42 48 54 60 Time (h)

Figure 1. Identification of Pi-regulated genes. Data are taken from the temporal series TS1 and TS3 of the ERA-NET SySMO Project STREAM. Cultures were performed in 3-l fermentors as described in Nielset et al. [26] and Thomas et al. [27]. Transcriptomic profiles of (A) SCO4872–82, (B) SCO2592–94, (C) SCO1908 and (D) SCO2591 genes from cultures of M145 and ΔphoP strains are shown at the left and right parts of the figure, respectively. Horizontal axis corresponds to the time (hours) after inoculation in the fermentors. The vertical axis shows the normalized log transcription values (i.e., log2 abundance). Individual gene profiles are indicated by gray lines; thick black lines are the averaged profiles or SCO1908 and SCO2591 genes. The vertical thin lines indicate the time of culture when Pi is depleted from the medium (i.e., 35 h in M145 and 41 h in ΔphoP). Above the graphs the physical map of the genes with the different insertions used to construct the Streptomyces coelicolor disrupted mutants is represented.

N-acetylglucosamine-1-phosphotransferases (these enzymes are inhibited with tunicamycin in higher eukaryotes; see ‘Discussion’ section) prompted us to select this antibiotic rather than others, such as bacitracin. Both SCO2594::Tn5062 and M145 strains were susceptible to the antibiotic, showing a MIC value of approximately 2 μg ml-1 in TSA. Therefore, SCO2594 mutation does not confer general resistance to glycopeptides or to other antibiotics that target different reactions of the cell wall biosynthesis.

future science group

●●Disruption of SCO2594 produces increased

antibiotic production & other phenotypic alterations

Species of the Streptomyces genus are the main producers of a great variety of secondary metabolites including most known antibiotics [36] . The model species S. coelicolor produces, among others, the pigmented antibiotics actinorhodin (Act) and undecylprodigiosin (Red). The SCO2594::Tn5062 mutant was cultured in MG-3.2 medium to evaluate whether the production of these antibiotics was affected.

www.futuremedicine.com

609

Research Article  Santos-Beneit, Fernández-Martínez, Rodríguez García et al.

75

139

100

80

150 160

G T

50 A C C AC G A T C C C +1 -10 box CATACTTGACGTGTCTGTATCCGCCCGCGTCGTCGTCGTCAAGGGGATCGTGG.GTG -35 box

-80

-70

-60

c

-50

0.5 µm

-40

2 µm

Figure 2. Determination of SCO2594 promoter and PhoP-binding. (A) Primer extension analysis of SCO2594 using automated fluorescent capillary electrophoresis. The unfilled traces represent the LIZ-500 standard that was included in the sample to determine the apparent size of the extension product (filled trace). To the right, the fluorograms corresponding to the four sequencing reactions (A, C, G and T) obtained with the Thermo Sequenase kit using the same primer (2594-rev_+44-FAM) is represented. The underlined character indicates the sequencing product with the same apparent size as the respective extension product (note that the sequencing reactions correspond to the noncoding strand). Below is a scheme that shows the localization of the 5´-end of the SCO2594 transcript as well as the putative -10 and -35 promoter elements. (B) Electrophoretic mobility shift assay (EMSA) of the SCO2594 promoter region with different concentrations of the GST-PhoDBD protein. Lane 1 (control; probe without protein), lane 2 (probe with 0.5 μM of GST-PhoDBD) and lane 3 (probe with 2 μM of GST-PhoDBD).

Interestingly, the mutant overproduced both undecylprodigiosin and actinorhodin (Figure 4A) . Of interest was also the reduction of growth shown by SCO2594::Tn5062, mainly in TSA (see the different size of the parental and mutant colonies in Figure 4B) . Another important phenotypic difference observed in the mutant was related to the Pi amount of the cell wall. Cultures of parental and SCO2594::Tn5062 strains in Pi-replete MG-18.5 medium revealed a significant reduction of the Pi cell wall content (nmol Pi × mg-1 dry cell wall) in the mutant (Figure 5A) . In

610

Future Microbiol. (2014) 9(5)

addition, the total amount of isolated cell wall with respect to the total cell biomass was 10% reduced in the mutant strain. We checked whether this alteration of the normal cell wall composition in SCO2594::Tn5062 could have an effect on the morphology of the cell envelope. Transmission electronic microscopy images of the mutant revealed a slightly distorted cell envelope (Figure 5B & Supplementary Figure S2) . Thus, whereas M145 formed uniform round envelopes (including plasma membrane and cell wall), the mutant cells showed more irregular and diffuse surfaces.

future science group

Transcriptional response to vancomycin in a vancomycin-resistant S. coelicolor mutant 

A Vancomycin resistance in TSA M145

SCO2594::Tn5062 (pCOM-2594)

SCO2594::Tn5062

B Vancomycin resistance in TSB

Mut (C) Wt (C)

5 Growth (mg DW × ml -1)

Research Article

Mut (10 µg ml-1)

4

Mut (150 µg ml-1)

3

Wt (10 µg ml-1) 2 1 0 0

8

16

24

32

40

48

56

64

72

Time (h)

Figure 3. Effect of SCO2594 gene disruption on vancomycin resistance. (A) Disc diffusion assays with 30 μg of vancomycin of S. coelicolor M145, SCO2594::Tn5062 and SCO2594::Tn5062 (+ pCOM2594) strains in TSA medium. (B) Broth dilution analyses of S. coelicolor M145 and SCO2594::Tn5062 strains in TSB. Cultures (100 ml of medium in 500-ml baffled flasks) were inoculated with 106 spores ml-1 and incubated at 30°C and 300 rpm. The control condition (without vancomycin addition) is represented with solid lines. The different vancomycin additions in each strain are indicated in the plot. Error bars correspond to the standard error of the mean of two culture replicates. DW: Dry weight; Mut: Mutant; TSA: Tryptic soy agar; TSB: Tryptic soy broth; Wt: Wild-type.

Consequently with this result, we checked whether the alteration of the cell wall composition in the mutant could prevent the action of vancomycin by hampering antibiotic binding to its target. For this purpose, fluorescent vancomycin binding to both strains was monitored by confocal microscopy, as described in the ‘Materials & methods’ section. In both parental and mutant strains, vancomycin stained cell walls and hyphal tips, and no significant differences were observed between them in any of the media tested (Supplementary Figure S3) . Taken together, these results showed strong pleiotropic effects on SCO2594::Tn5062 which might be related to the abnormal cell wall composition of this mutant.

future science group

●●Vancomycin induces whiB & van genes in

the SCO2594::Tn5062 mutant

In order to have an overview of the genes that could be involved in the phenotypic alterations of the SCO2594::Tn5062 mutant, including its high resistance to vancomycin, we performed two different transcriptomic analyses. In the first experiment, a vancomycin disc diffusion assay was carried out in TSA, and samples were taken from the area surrounding the disc (sample A; SCO2594::Tn5062) and outside of the inhibition zone (samples B and C for mutant and parental strains, respectively; see Figure 6A). The main goal of the experiment was to determine whether vancomycin resistance of SCO2594::Tn5062 was due to the induction of

www.futuremedicine.com

611

Research Article  Santos-Beneit, Fernández-Martínez, Rodríguez García et al. B

A 3.0

M145

nM Red × mg DW-1

2.5 2.0 1.5 1.0 0.5 0.0

48

56

72

80

Time (h) SCO2594::Tn5062

nM Act × mg DW-1

100 80 60 40 20 0

48

56

72

80

Time (h)

Figure 4. Effect of SCO2594 gene disruption on antibiotic production and growth. (A) Specific production of Red and Act in MG-3.2 liquid medium by M145 (darker columns) and SCO2594::Tn5062 (lighter columns). Error bars correspond to the standard error of the mean of 4 cultures replicates. (B) Streptomyces coelicolor colonies in tryptic soy agar medium. Act: Actinorhodin; DW: Dry weight; Red: Undecylprodigiosin.

vancomycin resistance genes or to an indirect effect due to the mutation. In the second experiment, the two strains were analyzed in MG-18.5 liquid cultures. In both cases, samples were taken at the end of the exponential growth phase (samples D and E for mutant and parental strains, respectively; see Figure 6A). No vancomycin was added to the cultures. The goal of the second experiment was to determine which genes could be affected by the SCO2594 mutation under high Pi conditions in liquid medium (i.e., the level of SCO2594 transcription in wild-type is dropped after Pi depletion; see Figure 1). In the first experiment only 19 genes were significantly regulated (false discovery rate-corrected p-value < 0.1) when SCO2594::Tn5062 was grown in the presence of vancomycin (see Table 2). The genes showing the highest induction levels under these conditions were those belonging to the van cluster (vanSRJKHAX). In sample A (mutant

612

Future Microbiol. (2014) 9(5)

cells in contact with vancomycin), these genes were upregulated between 6 and 18 times with respect to sample B (not affected by the antibiotic). This result indicates that vancomycin resistance in SCO2594::Tn5062 may depend on Van ­induction (although this may not be necessary). Interestingly, we have detected transcription in the intergenic region of vanR and vanJ. Recently, the vanJ open-reading frame has been corrected and its transcription start site determined [11] . According to these authors, vanR and vanJ are divergently transcribed as leaderless mRNAs. Therefore, we did not expect to detect transcription in the intergenic region of these genes. However, the vanR-vanJ intergenic transcript was the third highest transcript upregulated by vancomycin in the whole S. coelicolor SCO2594::Tn5062 genome. The existence of a small RNA in the vanR-vanJ 87-bp intergenic region and/or a novel transcriptional start site of vanJ may explain this result.

future science group

Transcriptional response to vancomycin in a vancomycin-resistant S. coelicolor mutant 

Amount of Pi in cell wall (nmol Pi × mg-1 CW)

A

Research Article

B M145

100 80

CW

SCO2594::Tn5062

PM

PM

CW

60 40 20 0

20 nm M145

20 nm

SCO2594::Tn5062

Figure 5. Cell wall analyses. (A) Cell wall Pi content (nmoles of Pi per mg of isolated dried cell wall) of M145 and SCO2594::Tn5062 strains grown on MG-18.5 (Pi-replete medium) at 30°C and 300 rpm during 44 and 48 h, respectively. Dry cell weights at this time were almost the same in parental and mutant strains (7.1 ± 0.3 and 6.6 ± 0.4 mg ml-1, respectively) and phosphate concentration in the medium of 12 mM in both cases (12.0 ± 0.1 mM in M145 and 12.1 ± 0.5 mM in SCO2594::Tn5062). Vertical error bars correspond to the standard error of the mean of two biological replicates. (B) Transmission electronic microscopy images of M145 and SCO2594::Tn5062 cells grown in TBO sporulation medium (magnification ×600,000). Note the irregularity of the mutant cell envelope. CW: Cell wall; Pi: Inorganic phosphate; PM: Plasma membrane.

Among the other 12 significantly vancomycin regulated genes, six of them were induced and six repressed. The most upregulated genes (excluding the van genes) were SCO4262 and SCO3034 (whiB). SCO4262 is a doubtful coding sequence that may encode a peptide of 115 amino acids without any conserved domain. It is not clear what the role of this small protein in vancomycin resistance could be. On the other hand, it is very probable that whiB could be involved in vancomycin resistance. In fact, the whiB homolog in Mycobacterium tuberculosis (whiB2) is involved in the resistance to cell wallacting antibiotics [37] . In S. coelicolor WhiB has not been described to play a role in antibiotic resistance; however, one of the sigma factors responsible for whiB expression, σE , has been previously shown to be involved in vancomycin resistance [28,38] . In our transcriptomic studies sigE showed the same profile as whiB and van genes (Figure 6B) . Among the other four upregulated genes in sample A, three genes (SCO3397, SCO5035 and SCO5036) were also reported to be upregulated by vancomycin in previous S. coelicolor transcriptomic analyses [38] . The SCO5035–6 genes may form a single transcription unit [39] and encode a putative transporter and a putative PadR-like regulator, respectively. The role of these genes in vancomycin resistance is still unknown. On the other hand, SCO3397, encoding a lysyl-tRNA synthetase, seems to play an important role in

future science group

vancomycin resistance. Deletion of this gene reduced markedly vancomycin MIC in S. coelicolor [38] . These authors noted that among the 28 genes predicted to encode tRNA synthetases in the S. coelicolor genome, only SCO3397 was upregulated following vancomycin treatment. Finally, SCO6178 may code for a deacetylase (see Table 2 ). The role of this protein in ­vancomycin resistance is still unknown. Interestingly, all the six genes downregulated by vancomycin in SCO2594::Tn5062 were upregulated in the mutant when comparing samples B and C (see below). ●●Transcriptomic analyses of the SCO2594

mutation

To select the genes differentially expressed in samples B versus C and D versus E (i.e., the effect of the SCO2594 mutation in TSA plates and in Pi-replete liquid medium, respectively), the following criteria were used: a higher than two-fold change in the transcription value (Mc >2) and a p-value of < 0.1. According to this, 46 genes were differently transcribed on TSA, and 71 in MG-18.5 cultures (Supplementary Tables S1 & S2, respectively). We focused on data from the TSA cultures because the effect of vancomycin (described above) could be taken into account (samples B vs C and A vs B). Among these genes almost two thirds appeared to be regulated in a growth phase-dependent manner, as determined by inspection of the results of the STREAM

www.futuremedicine.com

613

Research Article  Santos-Beneit, Fernández-Martínez, Rodríguez García et al. TSA

TSA Sample A

No growth

Sample B

Sample C

SCO2594::Tn5062

M145 MG-18.5

MG-18.5

Sample D

Sample E

SCO2594::Tn5062

A B

C

D E

5 4 3 2 1 0 -1 -2 -3 -4

sigE Log transcription values

5 4 3 2 1 0 -1 -2 -3 -4

whiB Log transcription values

Log transcription values

Upregulation by vancomycin vanX

M145

A B

C

D E

5 4 3 2 1 0 -1 -2 -3 -4

A B

C

D E

Downregulation in the mutant SCO4174

A B

C

D E

5 4 3 2 1 0 -1 -2 -3 -4

SCO4175 Log transcription values

5 4 3 2 1 0 -1 -2 -3 -4

Log transcription values

Log transcription values

SCO4173

A B

C

D E

5 4 3 2 1 0 -1 -2 -3 -4

A B

C

D E

Upregulation in the mutant SCO4156

614

A B

C

Future Microbiol. (2014) 9(5)

D E

5 4 3 2 1 0 -1 -2 -3 -4

SCO4157 Log transcription values

5 4 3 2 1 0 -1 -2 -3 -4

Log transcription values

Log transcription values

SCO4155

A B

C

D E

5 4 3 2 1 0 -1 -2 -3 -4

A B

C

D E

future science group

Transcriptional response to vancomycin in a vancomycin-resistant S. coelicolor mutant 

Research Article

Figure 6. Transcriptional experiments. (A) Experimental conditions used for the microarray analyses. Samples were taken from TSA cultures with vancomycin discs and MG-18.5 cultures without vancomycin. Differential transcription values Mc were obtained by subtracting: (i) the A condition Mg values from the B condition Mg values, (ii) the B condition Mg values from the C condition Mg values and (iii) the D condition Mg values from the E condition Mg values. TSA cultures were grown at 30°C during 24 h. MG-18.5 parental and mutant cultures were grown at 30°C and 300 rpm during 44 and 48 h, respectively. Dry cell weights at this time were almost the same in parental and mutant strains (7.1 ± 0.3 and 6.6 ± 0.4 mg ml-1, respectively) and phosphate concentration in the medium of 12 mM in both cases (12.0 ± 0.1 mM in M145 and 12.1 ± 0.5 mM in SCO2594::Tn5062). Three (TSA) and two (MG-18.5) sample replicates were used for the transcriptomic analyses. (B) Main transcription profiles obtained with SCO2594::Tn5062 and M145 strains in TSA and MG-18.5 cultures (samples A, B, C, D and E). Graphs depict the change in transcription (vertical axis) from each of the samples (i.e., log2 abundance).

consortium time series. Thus, genes whose expression could be influenced by the growth phase were excluded; as an example, many genes of the SCO0379-SCO0401 cluster, or those located in the SCO3215-SCO3249 region (Supplementary Table S1) . Finally, only 16 genes were selected for further analysis (Table 3) . The most downregulated genes in the SCO2594::Tn5062 mutant were those forming the putative SCO4175–73 operon (Table 3 & Figure 6B) . In fact, SCO4174 was the most regulated gene both in TSA and MG-18.5 cultures (greater than 100-fold; Supplementary Tables S1 & S2 ). SCO4173 belongs to the DsrE family, which includes small soluble proteins involved in

intracellular sulfur reduction [40] . On the other hand, both SCO4174 and SCO4175 genes lack any conserved domains. A SCO4174 disrupted mutant was reported to overproduce antibiotics and to sporulate sooner than wild-type [41] . Since SCO4174 was the most downregulated gene in SCO2594::Tn5062, we disrupted this gene to determine if the corresponding vancomycin resistance phenotype was similar to that of SCO2594::Tn5062. As with wild-type, clear inhibition halos appeared around the vancomycin discs when SCO4174::Tn5062 was grown in TSA (Supplementary Figure S4) . Moreover, the MIC value of SCO4174::Tn5062 in TSA was 20 μg ml-1 (i.e., ten times lower than that of

Table 2. Genes activated by vancomycin (i.e., Mc_A-B) in Streptomyces coelicolor SCO2594::Tn5062 according to the transcriptomic analyses shown in Figure 6A . Mc_A-B

FDR_A-B

Gene ID

Gene/function

4.184 4.119 3.833 3.689 3.256 3.058 2.603 1.697 1.388 1.363 1.325 1.313 1.127 -1.072 -1.293 -1.338 -1.525 -1.705 -1.735

1.80E-05 0.0003 7.80E-05 7.80E-05 6.00E-05 0.0001 0.0011 0.0881 0.0655 0.0169 0.0169 0.0385 0.0709 0.0882 0.0818 0.0455 0.0406 0.0047 0.0787

SCO3592 SCO3594 SCO3596 SCO3590 SCO3595 SCO3593 SCO3589 SCO4262 SCO3034 SCO5035 SCO3397 SCO5036 SCO6178 SCO4935 SCO4936 SCO0958 SCO5981 SCO4156 SCO4157

vanJ vanH vanX vanR vanA vanK vanS Unknown whiB ABC transporter protein Putative lysyl-tRNA synthetase Putative PadR-like regulator Putative deacetylase ABC transporter protein ABC transporter protein Putative acyl-CoA acyltransferase Putative sulphotransferase Two component system protein HtrA-like serine protease

The table shows all the genes that were significantly regulated with a false discovery rate-corrected p-value lower than 0.1. FDR: False discovery rate.

future science group

www.futuremedicine.com

615

Research Article  Santos-Beneit, Fernández-Martínez, Rodríguez García et al. SCO2594::Tn5062 and the same range of the parental value). Therefore, disruption of this gene does not confer the same vancomycin-resistance phenotype of S. coelicolor SCO2594::Tn5062. Among the other most significantly downregulated genes in the SCO2594::Tn5062 mutant (SCO2492, SCO1222 and SCO1223), only SCO2492 has been related to vancomycin resistance in previous studies. This gene was downregulated by vancomycin, moenomycin and bacitracin in S. coelicolor [38] . In our transcriptomic analyses, SCO2492 was also downregulated by vancomycin, although with a p-value higher than 0.1 (Table 3) . SCO1222–23 genes appear to be involved in arginine catabolism and it is unknown if they can contribute or not to vancomycin resistance. Nine of the ten most upregulated genes in SCO2594::Tn5062 mutant (i.e., samples B vs C) were downregulated by vancomycin (i.e., samples A vs B); five of them were significantly regulated in both comparisons (see Table 3 & Figure 6B). Only SCO2995 (upregulated in the mutant in both TSA and MG-18.5 cultures) was not downregulated by vancomycin (see Table 3 & Supplementary Table S2 ). This gene codes for a Bacillus subtilis tagG homolog and could be involved, together with SCO2996 (tagH), in the export of teichoic acids for cell wall biosynthesis [34] . SCO2996 was also significantly upregulated in SCO2594::Tn5062 (almost two times) in both

solid and liquid cultures, which also happened with SCO2589 and SCO2590 genes, coding for two putative teichoic acid biosynthetic enzymes [34] . According to these results, a relationship between teichoic acids biosynthesis and SCO2594 seems reasonable. SCO4157, the highest upregulated gene in SCO2594::Tn5062 (B vs C), codes for a HtrAlike serine protease and shares 50% of amino acid similarity to M. tuberculosis PepD [42] . Both SCO4157 and pepD genes are located adjacent to genes coding for two-component systems (SCO4156–55 and mprAB, respectively). The M. tuberculosis MprAB two-component system has been shown to be important in the response to cell wall-perturbing stresses [43] . Actually, M. tuberculosis ΔmprAB and ΔpepD mutants exhibited increased sensitivity to cell wall-acting antibiotics [44] . The MprAB two-component system regulates pepD and several other genes in M. tuberculosis [43,45] . Thus, it is possible that in S. coelicolor some of the referred genes with the same profile are regulated by the response regulator SCO4156. We also looked for genes with a lower than two-fold change in the transcription values (Mc < 2 and a p-value of < 0.1), which could be involved in vancomycin resistance according to previous works. Only SCO1875, coding for a putative penicillin-binding protein, showed a statistically significant result (false discovery

Table 3. Genes regulated by the SCO2594 mutation in tryptic soy agar (i.e., Mc_B-C). Only 16 genes are shown out of 46 genes that showed an increase or decrease in expression higher than twofold and a false discovery rate-corrected p-value lower than 0.1 (see text for details).  Mc_B-C

FDR_B-C

Genes.ID

Mc_A-B

Gene/function

5.325 4.895 3.596 3.554 2.806 2.523 2.478 2.189 2.041 2.007 -2.225 -2.579 -2.726 -3.147 -3.525 -7.144

4.00E 0.0038 4.00E-06 1.60E-05 5.80E-05 0.0716 4.70E-05 0.0086 0.0088 0.0006 0.0664 0.0027 0.0655 0.0541 0.0139 0.0006

SCO4157 SCO0753 SCO4156 SCO5981 SCO4936 SCO2995 SCO4935 SCO4155 SCO3074 SCO4020 SCO4173 SCO2492 SCO1223 SCO1222 SCO4175 SCO4174

-1.735 -1.810 -1.705 -1.525 -1.293 2.194 -1.072 -1.192 -1.101 -0.658 0.249 -0.462 -0.239 -0.070 0.019 0.079

HtrA-like serine protease Putative α subunit ATP synthase Two component system protein Putative sulphotransferase ABC transporter protein ABC transporter protein ABC transporter protein Two component system protein Integral membrane protein Two component system protein DsrE family protein Putative membrane nuclease Ornithine aminotransferase Putative amidinotransferase Unknown Unknown

-06

Bold characters in the Mc_A-B column indicate a FDR-corrected p-value < 0.1 in the A versus B comparison. FDR: False discovery rate.

616

Future Microbiol. (2014) 9(5)

future science group

Transcriptional response to vancomycin in a vancomycin-resistant S. coelicolor mutant  rate-corrected p-value = 0.009). This gene was more than two-times upregulated in the mutant strain (i.e., 1.2 log2 units). In a previous study, deletion of SCO1875 markedly decreased vancomycin resistance in S. coelicolor, pointing to an important role of this penicillin-binding protein in glycopeptide resistance [38] . Finally, the most interesting result deduced from the MG-18.5 analysis (i.e., not detected with the TSA cultures) was the downregulation profiles shown by SCO2776–79 genes. All these genes were repressed in SCO2594::Tn5062 between two and 12 times and were apparently not regulated in a growth phase-dependent manner (see Figure 7). SCO2776–79 code for enzymes involved in lipid and acetate metabolism: two acetyl-CoA carboxylases (β and α), one 3-hydroxy-3-methylglutaryl-CoA lyase and one acyl-CoA dehydrogenase, respectively [46,47] . This result might explain some of the phenotypic alterations of the SCO2594::Tn5062 mutant. Discussion In this work we analyzed the role of several Pi-regulated genes (dependently or independently of PhoP regulator) on vancomycin resistance. To detect these profiles we used transcriptomic data from the European STREAM consortium. We selected for the analysis the following genes: SCO4872–82, SCO2591–94 and SCO1908. PhoP binding to several promoter regions of the SCO4872–82 cluster has been proven previously by EMSA and DNase I footprinting assays [16,48] , as well as by ChIP-on-chip [25] . However, PhoP control of SCO2594 has not been characterized before. In this study, we have demonstrated PhoP binding to the SCO2594 promoter region, increasing the number of ­characterized PhoP targets in S. coelicolor. In total, we analyzed the vancomycin resistance of ten different disrupted mutants. The only mutant showing an alteration in the vancomycin resistance pattern was SCO2594::Tn5062. As previously reported, increasing the Pi concentration results in repression of vancomycin resistance in MMCGT medium. Thus, addition of 30 mM Pi to the medium decreased the MIC of vancomycin in S. coelicolor more than four times [13] . In this work we have shown that Pi regulation of vancomycin resistance is impaired in the SCO2594 mutant. This mutant, contrary to the parental strain, was resistant to vancomycin independently of the Pi concentration. Complementation of SCO2594::Tn5062 with

future science group

Research Article

the SCO2594 native gene restored the parental phenotype, excluding a polar effect over its two downstream genes (SCO2593–92). Based on sequence homology is not easy to define the function of SCO2594. It may encode a phosphotransferase, as the two proteins that share the highest homology in a BLAST search are annotated as exopolysaccharide phosphotransferases. These proteins belong to Streptomyces spp. e14 (76% identity) and Streptomyces pristinaespiralis ATCC 25486 (56% identity). In the UniProtKB/Swiss-Prot databases, SCO2594 protein is defined as a Stealth protein [49] . Stealth proteins are conserved from bacteria to higher eukaryotes and are predicted to function as hexose-1-phosphoryltransferases and to be involved in exopolysaccharides synthesis. In this study we have investigated the morphology and Pi content of the SCO2594::Tn5062 cell wall. Interestingly, we have observed a huge reduction of Pi content in the mutant cell wall, as well as a slightly distorted cell envelope (see Figure 5). Despite the observed cell wall alteration, the mutant was not impaired in sporulation and had equal binding affinity for fluorescent vancomycin as the parental strain. Moreover, much like the wild-type, SCO2594::Tn5062 was susceptible to teicoplanin (the bacterium is resistant to the antibiotic only when Van induction is achieved) and to tunicamycin. We can conclude therefore that the high vancomycin resistance of the mutant could neither be explained by a hampering of the antibiotic binding, nor by a constitutive expression of the Van proteins (this was further supported by transcriptomic ­analyses; see below). In order to further understand the physiological mechanisms by which the SCO2594::Tn5062 mutant maintains growth around the vancomycin discs in TSA medium, we analyzed changes to the mutant’s transcriptional profile in a vancomycin disc diffusion bioassay. To the best of our knowledge this is the first time samples from an antibiotic bioassay have been used directly for transcriptional approaches, correlating the results of the bioassay with changes in gene transcription. This experiment allowed us to identify 19 genes differentially regulated after exposing the SCO2594::Tn5062 strain to a concentration of vancomycin at which the parental strain is completely susceptible. This included, among others, the well-known van genes [9] and whiB. Several studies with Streptomyces and other Gram-positive bacteria (i.e., Staphylococcus,

www.futuremedicine.com

617

Research Article  Santos-Beneit, Fernández-Martínez, Rodríguez García et al. A 2776

2777

2778

accD1

accC

hmgL acdH

2779

B INB201, ∆phoP strain 13.0

12.0

12.0

Log transcription values

Log transcription values

M145, parental strain 13.0

11.0 10.0 9.0 8.0 7.0 6.0

11.0 10.0 9.0 8.0 7.0 6.0 5.0

5.0

4.0

4.0 12 18 24 30 36 42 48 54 60

12 18 24 30 36 42 48 54 60 Time (h)

Time (h) C 2.0 Log transcription values

1.5 1.0 0.5 0.0

SCO2777

-0.5 -1.0

SCO2776

-1.5 -2.0 -2.5 -3.0

SCO2778 SCO2779 D (Mut)

E (Wt)

Figure 7. Transcriptional analyses of SCO2776–79 genes. (A) Map of the genetic organization of the genes, with their respective name according to strepDB web server. (B) Transcriptomic profiles from cultures of M145 and ΔphoP strains of the STREAM Project (see Figure 1). (C) Transcription profiles obtained with SCO2594::Tn5062 and M145 strains in MG-18.5 cultures (i.e., samples D and E; see Figure 6). In all cases, individual gene profiles are indicated by gray lines; thick black lines are the averaged profiles.

Mycobacterium and Bacillus) have reported a relationship between antibiotic resistance and cell wall stress [33,38,50–52] . In particular, the σE signal transduction system was reported to be induced in S. coelicolor by cell wall acting

618

Future Microbiol. (2014) 9(5)

antibiotics, such as penicillins and glycopeptides. This system senses and responds to certain changes in the integrity of the cell envelope by activating different genes, some of which are involved in the biosynthesis of cell wall

future science group

Transcriptional response to vancomycin in a vancomycin-resistant S. coelicolor mutant  glycans [28] . Interestingly, vancomycin resistance is decreased in a S. coelicolor sigE null mutant, suggesting a role of this sigma factor in glycopeptide resistance [38] . In this study, we have shown vancomycin induction of both sigE and a σE target, whiB. In fact, whiB induction was significantly higher than the sigE one; pointing to a putative new role for WhiB in vancomycin resistance. Several genes seem to be affected by the SCO2594 mutation. We have demonstrated that the most divergent transcribed gene (i.e., SCO4174) in SCO2594::Tn5062 is not related to the high vancomycin resistance pattern of the mutant, although it could be involved in the higher antibiotic production of the strain, as reported previously by Sprusansky et al. [41] . In addition, we have found important genes involved in primary metabolism that are downregulated in SCO2594::Tn5062; for example, SCO2776–79. This could be responsible for the observed reduced growth of the mutant strain. Furthermore we have identified several genes whose products could be involved in antibiotic stress protection and contributing to confer the basal level of S. coelicolor SCO2594::Tn5062 resistance to vancomycin. Some of these genes, such as SCO4155–57 (see ‘Results’ section), will be very promising subjects in future studies to progress our understanding of the physiology of the Streptomyces envelope and resistance to cell wall acting antibiotics. Conclusion In summary, we have demonstrated a PhoPdependent regulation of SCO2594, a gene most likely involved in cell wall metabolism. We have shown that disruption of SCO2594 can overcome Pi inhibition of the vancomycin resistance mechanism, transforming the mutant into a highly vancomycin resistant strain. In addition, the SCO2594::Tn5062 mutant was shown to overproduce antibiotics and to have a reduced Pi cell wall content. No resistance to other glycopeptides, such as teicoplanin, was observed in the mutant. By analyzing the variation of the global transcription profile in SCO2594::Tn5062 mutant cultures exposed to inhibitory concentrations of vancomycin, we have identified several proteins that may contribute to vancomycin resistance. These include ABC transport systems, penicillin-binding proteins, lysil-tRNA synthetases, sigma factors, different regulators and the well-known Van

future science group

Research Article

proteins. The mechanism by which SCO2594 disruption confers resistance to vancomycin in high-Pi media is still enigmatic. SCO2594 disruption causes apparent growth defects as well as abnormal cell wall properties. Disruption of the gene does not upregulate transcription of van genes constitutively; induction of resistance is only achieved in the presence of vancomycin. Therefore, it may be hypothesized that vancomycin resistance in SCO2594 mutant is dependent on Van expression, although alternative resistance mechanisms cannot be dismissed. Since the resistance phenotype of the mutant seems directly attributable to the absence of SCO2594 activity (most likely an exopolysaccharide phosphotransferase activity), it seems reasonable to speculate that the presence or absence of certain polymers of the cell wall is imperative for vancomycin resistance in S. coelicolor. Consistent with this hypothesis, it has been reported that cell wall anionic polymers have a central role in the normal functioning of the Gram-positive cell envelopes, including binding of phages and antibiotics. Overall, these findings represent new leads for understanding the molecular interactions involved in ­glycopeptide resistance induction. Future perspective The use in clinic of every antibiotic has led to resistance in the targeted bacteria. Interestingly, glycopeptide antibiotics have been an intriguing exception for a long time, which led to their adoption as drugs for last-resort treatments. Therefore, understanding the molecular basis for induction of glycopeptide resistance is important for the proper utilization of antibiotics in the clinic and for the development of new ­semisynthetic derivatives. Acknowledgements The authors thank E Wellington and the STREAM consortium for providing transcriptomic data of the wild type and ΔphoP mutant strains. The authors also thank P Dyson (Swansea University) for providing the insertions to obtain the mutant strains.

Financial & competing interests disclosure This work was supported by grant BIO2010-16094 of the Ministerio de Economía y Competitividad (Spain). S Martín Martín was supported by an FPI grant from the Spanish Government. M Ordóñez Robles was supported by an FPU grant from the Spanish Government. Research in the A Manteca’s laboratory was supported by an ERC

www.futuremedicine.com

619

Research Article  Santos-Beneit, Fernández-Martínez, Rodríguez García et al. Starting Grant (Strp-differentiation 280304). The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter

or materials discussed in the manuscript apart from those disclosed. No writing assistance was utilized in the production of this manuscript.

EXECUTIVE SUMMARY Vancomycin resistance in Streptomyces coelicolor is highly regulated by the inorganic phosphate concentration of the medium ●●

Hong and coworkers reported the first example of vancomycin resistance in a nonpathogenic and nonglycopeptide producing bacterium in S. coelicolor.

●●

Recently, we have found that vancomycin resistance in S. coelicolor is highly reduced with replete inorganic phosphate (Pi) conditions.

●●

SCO2594 is involved in an as yet unknown manner in this regulatory process (disruption of the gene overcomes Pi inhibition of vancomycin resistance).

SCO2594 transcription is negatively regulated by PhoP ●●

PhoP has been shown to regulate many genes in S. coelicolor. PhoP responds to Pi starvation in the medium by activating or repressing its target genes.

●●

SCO2594 is repressed in wild-type strain when Pi is depleted from the medium. On the contrary, transcription is not

●●

Purified PhoP protein binds to the promoter of the SCO2594 gene. SCO2594 is a new member of the Pho regulon in

repressed in its isogenic ΔphoP mutant strain. S. coelicolor.

Disruption of SCO2594 produces important phenotypic alterations in S. coelicolor ●●

The SCO2594::Tn5062 mutant has an impaired growth and a reduced Pi cell wall content. In addition, ultramorphological differences in the cell envelopes are clearly observed in the mutant.

●●

Several genes are up- or down-regulated in the SCO2594::Tn5062 mutant strain. SCO4174 is the most regulated gene (i.e., it is more than 100-times downregulated in the mutant). Disruption of this gene has been related to antibiotic overproduction before, matching with the SCO2594::Tn5062 mutant overproduction phenotype.

●●

Several of the differently transcribed genes in our transcriptomic analyses have been previously shown to be involved in vancomycin resistance in S. coelicolor. Of novelty, we have identified additional genes that could be also involved (i.e., whiB). in vivo incorporation of d-lactate into peptidoglycan precursors of vancomycinresistant enterococci. Antimicrob. Agents Chemother. 36, 867–869 (1992).

References Papers of special note have been highlighted as: • of interest; •• of considerable interest. 1

Arthur M, Reynolds P, Courvalin P. Glycopeptide resistance in enterococci. Trends Microbiol. 4, 401–407 (1996).

2

Chang S, Sievert DM, Hageman JC et al. Infection with vancomycin-resistant Staphylococcus aureus containing the vanA resistance gene. N. Engl. J. Med. 348, 1342–1347 (2003).

3

Reynolds PE. Structure, biochemistry and mechanism of action of glycopeptide antibiotics. Eur. J. Clin. Microbiol. Infect. Dis. 11, 943–950 (1989).

4

Arthur M, Molinas C, Bugg TDH, Wright GD, Walsh CT, Courvalin P. Evidence for

620

system controls synthesis of depsipeptide peptidoglycan precursors in Enterococcus faecium BM4147. J. Bacteriol. 174, 2582–2591 (1992).

5

Bugg TD, Dutka-Malen S, Arthur M, Courvalin P, Walsh CT. Identification of vancomycin resistance protein VanA as a d-alanine: d-alanine ligase of altered substrate specificity. Biochemistry 30, 2017–2021 (1991).

8

Pootoolal J, Thomas MG, Marshall CG et al. Assembling the glycopeptide antibiotic scaffold: the biosynthesis of A47934 from Streptomyces toyocaensis NRRL15009. Proc. Natl Acad. Sci. USA 99, 8962–8967 (2002).

6

Reynolds PE, Snaith HA, Maguire AJ, Dutka-Malen S, Courvalin P. Analysis of peptidoglycan precursors in vancomycinresistant Enterococcus gallinarum BM4174. Biochem. J. 301, 5–8 (1994).

9

7

Arthur M, Molinas C, Courvalin P. The VanS–VanR two-component regulatory

Hong HJ, Hutchings MI, Neu JM, Wright GD, Paget MSB, Buttner MJ. Characterisation of an inducible vancomycin resistance system in Streptomyces coelicolor reveals a novel gene (vanK ) required for drug resistance. Mol. Microbiol. 52, 1107–1121 (2004).

Future Microbiol. (2014) 9(5)

future science group

Transcriptional response to vancomycin in a vancomycin-resistant S. coelicolor mutant  •• Identification for the first time of vancomycin resistance in a nonpathogenic and nonglycopeptide-producing bacterium. 10 Hong HJ, Hutchings MI, Hill LM, Buttner

MJ. The role of the novel Fem protein VanK in vancomycin resistance in Streptomyces coelicolor. J. Biol. Chem. 280, 13055–13061 (2005). 11 Novotna G, Hill C, Vincent K, Liu C, Hong

HJ. A novel membrane protein, VanJ, conferring resistance to teicoplanin. Antimicrob. Agents Chemother. 56, 1784–1796 (2012). 12 Périchon B, Courvalin P. Glycopeptide

resistance. In: Antibiotic Discovery and Development. Dougherty TJ, Pucci MJ (Eds). Springer, Berlin, Germany, 515–542 (2012). 13 Santos-Beneit F, Martín JF. Vancomycin

resistance in Streptomyces coelicolor is phosphate-dependent but is not mediated by the PhoP regulator. J. Global Antimicrob. Resist. 1, 109–113 (2013). •• This work highlights the importance of the phosphate concentration in vancomycin resistance in both Streptomyces coelicolor and Streptomyces lividans. 14 Martín JF, Santos-Beneit F, Rodríguez-García

A et al. Transcriptomic studies of phosphate control of primary and secondary metabolism in Streptomyces coelicolor. Appl. Microbiol. Biotechnol. 95, 61–75 (2012). •• This article highlights the genes subjected to PhoP-mediated control in Streptomyces coelicolor by transcriptomic analysis. 15 Sola-Landa A, Rodríguez-García A,

Franco-Domínguez E, Martín JF. Binding of PhoP to promoters of phosphate-regulated genes in Streptomyces coelicolor: identification of PHO boxes. Mol. Microbiol. 56, 1373–1385 (2005). 16 Rodríguez-García A, Barreiro C, Santos-

Beneit F, Sola-Landa A, Martín JF. Genomewide transcriptomic and proteomic analysis of the primary response to phosphate limitation in Streptomyces coelicolor M145 and in a ΔphoP mutant. Proteomics 7, 2410–2429 (2007). 17 Santos-Beneit F, Rodríguez-García A,

Franco-Domínguez E, Martín JF. Phosphatedependent regulation of the low- and high-affinity transport systems in the model actinomycete Streptomyces coelicolor. Microbiology 154, 2356–2370 (2008). 18 Santos-Beneit F, Rodríguez-García A, Apel

AK, Martín JF. Phosphate and carbon source regulation of two PhoP-dependent glycerophosphodiester phosphodiesterase genes of Streptomyces coelicolor. Microbiology 155, 1800–1811 (2009).

future science group

19 Santos-Beneit F, Rodríguez-García A,

Sola-Landa A, Martín JF. Cross-talk between two global regulators in Streptomyces: PhoP and AfsR interact in the control of afsS, pstS and phoRP transcription. Mol. Microbiol. 72, 53–68 (2009).

•

MC et al. A transposon insertion single-gene knockout library and new ordered cosmid library for the model organism Streptomyces coelicolor A3(2). Antonie Van Leeuwenhoek 99, 515–522 (2011). 30 Santos-Beneit F, Rodríguez-García A, Martín

JF. Identification of different promoters in the absA1–absA2 two-component system, a negative regulator of antibiotic production in Streptomyces coelicolor. Mol. Genet. Genomics 288, 39–48 (2013).

21 Santos-Beneit F, Barriuso-Iglesias M,

Fernández-Martínez LT et al. The RNA polymerase omega factor RpoZ is regulated by PhoP and has an important role in antibiotic biosynthesis and morphological differentiation in Streptomyces coelicolor. Appl. Environ. Microbiol. 77, 7586–7794 (2011). 22 Santos-Beneit F, Rodríguez-García A, Martín

JF. Overlapping binding of PhoP and AfsR to the promoter region of glnR in Streptomyces coelicolor. Microbiol. Res. 167, 532–535 (2012). 23 Martín JF, Sola-Landa A, Santos-Beneit F,

31 Meredith TC, Swoboda JG, Walker S.

Late-stage polyribitol phosphate wall teichoic acid biosynthesis in Staphylococcus aureus. J. Bacteriol. 190, 3046–3056 (2008). 32 Lanzetta PA, Álvarez LJ, Reinach PS, Candia

OA. Improved assay for nanomole amounts of inorganic-Pi. Anal. Biochem. 100, 95–97 (1979). 33 Yagüe P, Rodríguez-García A, López-García

MT et al. Transcriptomic analysis of Streptomyces coelicolor differentiation in solid sporulating cultures: first compartmentalized and second multinucleated mycelia have different and distinctive transcriptomes. PLoS ONE 8, e60665 (2013).

Fernández-Martínez LT, Prieto C, RodríguezGarcía A. Cross-talk of global nutritional regulators in the control of primary and secondary metabolism in Streptomyces. Microb. Biotechnol. 4, 165–174 (2011). 24 Fernández-Martínez LT, Santos-Beneit F,

Martín JF. Is PhoR–PhoP partner fidelity strict? PhoR is required for the activation of the pho regulon in Streptomyces coelicolor. Mol. Genet. Genomics 287, 565–573 (2012).

34 Kleinschnitz EM, Latus A, Sigle S, Maldener

I, Wohlleben W, Muth G. Genetic analysis of SCO2997, encoding a TagF homologue, indicates a role for wall teichoic acids in sporulation of Streptomyces coelicolor A3(2). J. Bacteriol. 193, 6080–6085 (2011).

25 Allenby NE, Laing E, Bucca G, Kierzek AM,

Smith CP. Diverse control of metabolism and other cellular processes in Streptomyces coelicolor by the PhoP transcription factor: genome-wide identification of in vivo targets. Nucleic Acids Res. 40, 9543–9556 (2012).

35 Hutchings MI, Hong HJ, Buttner MJ. The

vancomycin resistance VanRS two-component signal transduction system of Streptomyces coelicolor. Mol. Microbiol. 59, 923–935 (2006). 36 Kieser T, Bibb MJ, Buttner MJ, Chater

KF, Hopwood DA. Practical Streptomyces Genetics. The John Innes Foundation, Norwich, UK (2000).

26 Nieselt K, Battke F, Herbig A et al. The

dynamic architecture of the metabolic switch in Streptomyces coelicolor. BMC Genomics 11, 10–19 (2010).

37 Geiman DE, Raghunand TR, Agarwal N,

Bishai WR. Differential gene expression in response to exposure to antimycobacterial agents and other stress conditions among seven Mycobacterium tuberculosis whiB-like genes. Antimicrob. Agents Chemother. 50, 2836–2841 (2006).

27 Thomas L, Hodgson DA, Wentzel A et al.

Metabolic switches and adaptations deduced from the proteomes of Streptomyces coelicolor wild type and phoP mutant grown in batch culture. Mol. Cell Proteomics. 11, M111.013797 (2012). 28 Hong HJ, Paget MS, Buttner MJ. A

signal transduction system in Streptomyces coelicolor that activates the expression of a putative cell wall glycan operon in response to vancomycin and other cell wall-specific antibiotics. Mol. Microbiol. 44, 1199–1211 (2002).

An interesting relationship between glycopeptide resistance and cell wall stress is reported in Streptomyces coelicolor.

29 Fernández-Martínez LT, Del Sol R, Evans

20 Santos-Beneit F, Rodríguez-García A, Martín

JF. Complex transcriptional control of the antibiotic regulator afsS in Streptomyces: PhoP and AfsR are overlapping, competitive activators. J. Bacteriol. 193, 2242–2251 (2011).

Research Article

•

Implication of whiB-like genes in cell wall stress and antibiotic resistance in Mycobacterium tuberculosis.

38 Hesketh A, Hill C, Mokhtar J et al.

Genome-wide dynamics of a bacterial response to antibiotics that target the cell envelope. BMC Genomics 12, 226 (2011).

www.futuremedicine.com

621

Research Article  Santos-Beneit, Fernández-Martínez, Rodríguez García et al. •• This work has used the novel approach of identifying common and unique transcriptional changes following the treatment of Streptomyces coelicolor with three antibiotics that target cell wall biosynthesis (including vancomycin). 39 Charaniya S, Mehra S, Lian W, Jayapal KP,

Karypis G, Hu W-S. Transcriptome dynamics-based operon prediction and verification in Streptomyces coelicolor. Nucleic Acids Res. 35, 7222–7236 (2007). 40 Pott AS, Dahl C. Sirohaem sulfite

reductase and other proteins encoded by genes at the dsr locus of Chromatium vinosum are involved in the oxidation of intracellular sulfur. Microbiology 144, 1881–1894 (1998). 41 Sprusansky O, Zhou L, Jordan S, White J,

Westpheling J. Identification of three new genes involved in morphogenesis and antibiotic production in Streptomyces coelicolor. J. Bacteriol. 185, 6147–6157 (2003). 42 He H, Zahrt TC. Identification and

characterization of a regulatory sequence recognized by Mycobacterium tuberculosis persistence regulator MprA. J. Bacteriol. 187, 202–212 (2005).

622

43 Pang X, Vu P, Byrd TF et al. Evidence for

complex interactions of stress-associated regulons in an mprAB deletion mutant of Mycobacterium tuberculosis. Microbiology 153, 1229–1242 (2007). 44 White MJ, He H, Penoske RM, Twining SS,

Zahrt TC. PepD participates in the mycobacterial stress response mediated through MprAB and SigE. J. Bacteriol. 192, 1498–1510 (2010). 45 He H, Hovey R, Kane J, Singh V, Zahrt TC.

MprAB is a stress-responsive two-component system that directly regulates expression of sigma factors SigB and SigE in Mycobacterium tuberculosis. J. Bacteriol. 188, 2134–2143 (2006). 46 Demirev AV, Lee JS, Sedai BR, Ivanov IG,

Nam DH. Identification and characterization of acetyl-CoA carboxylase gene cluster in Streptomyces toxytricini. J. Microbiol. 47, 473–478 (2009). 47 Zhang YX, Denoya CD, Skinner DD et al.

Genes encoding acyl-CoA dehydrogenase (AcdH) homologues from Streptomyces coelicolor and Streptomyces avermitilis provide insights into the metabolism of small branched-chain fatty acids and macrolide antibiotic production. Microbiology 145, 2323–2334 (1999).

Future Microbiol. (2014) 9(5)

48 Sola-Landa A, Rodríguez-García A, Apel AK,

Martín JF. Target genes and structure of the direct repeats in the DNA binding sequences of the response regulator PhoP in Streptomyces coelicolor. Nucleic Acids Res. 36, 1358–1368 (2008). 49 Sperisen P, Schmid CD, Bucher P, Zilian O.

Stealth proteins: in silico identification of a novel protein family rendering bacterial pathogens invisible to host immune defense. PLoS Comput. Biol. 1, e63 (2005). 50 McCallum N, Spehar G, Bischoff M,

Berger-Bächi B. Strain dependence of the cell wall-damage induced stimulon in Staphylococcus aureus. Biochim. Biophys. Acta. 1760, 1475–1481 (2006). 51 Provvedi R, Boldrin F, Falciani F, Palù G,

Manganelli R. Global transcriptional response to vancomycin in Mycobacterium tuberculosis. Microbiology 155, 1093–1102 (2009). 52 Bisicchia P, Bui NK, Aldridge C, Vollmer W,

Devine KM. Acquisition of VanB-type vancomycin resistance by Bacillus subtilis: the impact on gene expression, cell wall composition and morphology. Mol. Microbiol. 81, 157–178 (2011).

future science group