Vol. 174, No. 10

JOURNAL OF BACTERIOLOGY, May 1992, p. 3212-3219 0021-9193/92/103212-08$02.00/0 Copyright X) 1992, American Society for Microbiology

Transcriptional Regulation of the ilv-leu Operon of Bacillus subtilis GRANDONI,l STANLEY A. ZAHLER,2* AND JOSEPH M. CALVO' Section of Biochemistry, Molecular, and Cell Biology, 1 and Section of Genetics and Development,2 University, Ithaca, New York 14853

JERRY A.

Cornell

Received 23 December 1991/Accepted 9 March 1992

tion product were 5' TCAGGACTCAATCCC 3' and 5' TCGTCCGCTCATCGTCTGTGTACATTCGGC 3'. A polymerase chain reaction product which extends from position -8 to +490 of the ilv-leu region was cloned into BamHIPstI-digested pBluescript to yield pFGB1. The primers used to amplify this product were 5' T'TGGATCCTATGAGT TCAACAAAAGATA 3' and 5' GGGCTGCAGGTCCCCAT '1'-'1'TAGTTCCTCC 3'. Isolation of RNA from B. subtilis. A variation of the methods of Shimotsu et al. (11) and Ulmanen et al. (12a) was used to isolate RNA. Cells were grown in minimal medium, and samples were harvested at mid-logarithmic phase by pouring 20 ml of culture over 10 g of crushed ice containing 15 mM NaN3. The mixture was immediately stirred, and the cells were pelleted by centrifugation at 20,000 x g for 1 min. The cells were suspended in 2.5 ml of ice-cold protoplasting buffer (15 mM Tris-Cl [pH 8], 6 mM EDTA, 0.45 M sucrose, 2 mg of lysozyme per ml) and incubated for 10 min on ice. The suspension was poured into 5 ml of phenol-chloroform mixture preheated to 75°C. The phenol-chloroform mixture contained 2.5 ml of RNA extraction buffer (125 mM Tris-Cl [pH 7.5], 0.5 M NaCl, 10 mM EDTA, 0.2% sodium dodecyl sulfate), 2.5 ml of chloroform, and 2.5 ml of phenol saturated with 10 mM Tris-Cl (pH 7.5) and 0.1 mM EDTA (TEsaturated phenol). Incubation at 75°C was continued for 10 min with vortexing every 30 s. The mixture was centrifuged for 30 min at 20,000 x g in a Sorvall SS-34 rotor at 4°C. Three milliliters of the aqueous phase was transferred to a new tube and extracted with 5 ml of water-saturated ether. Nine milliliters of ethanol was added, the mixture was incubated at -75°C overnight, and the precipitate was centrifuged at 20,000 x g at 4°C for 30 min. The resulting pellet was washed with 5 ml of 70% ethanol, dried, and dissolved in 1 ml of ice-cold diethylpyrocarbonate-treated water. NaCl

In Bacillus subtilis, 7 of the 10 genes required for synthesis of leucine, isoleucine, and valine form a single operon called the ilv-leu operon (15). The operon was cloned, and a putative promoter, a leader region, and the genes ilvB, ilvN, and ilvC were sequenced (14). By using transcriptional fusions of the ilv-leu regulatory region to the lacZ gene of Escherichia coli, Vandeyar et al. found that ilv-leu promoter expression was 10-fold higher in cells starved for leucine than in cells grown with excess leucine. Starvation for isoleucine and valine had no such effect (14). In this article, we identify the ilv-leu operon promoter and show that, between the promoter and the first structural gene, there is a 482-bp leader region with a sequence resembling a factorindependent transcription termination site. We demonstrate that most transcription terminates at or near this site in vitro and also in vivo when cells are grown in a medium containing excess leucine.

MATERIALS AND METHODS Bacterial strains and growth conditions. B. subtilis CU4609 (trpC2 leuB16 ilvN::Tn917) was used for leucine limitation experiments. B. subtilis CU1065 (trpC2) was a recipient strain for promoter insertion mutagenesis. E. coli XL1 Blue [recA4 lac endAI gyrA96 thi hsdRl7supE44 relAI (F'proAB lacIq lacZAM15 TnlO)] (Stratagene) was used for plasmid construction. Complex medium was LB broth containing 50 jig of ampicillin per ml when required. Minimal medium contained 0.5% glucose, 1 ,ug of biotin per ml, 20 ,ug of tryptophan per ml, 35 ,ug of isoleucine per ml, 70 ,ug of valine per ml, and a salts mixture to produce final concentrations of, per liter, 2 g of (NH4)2SO4, 13.8 g of K2HPO4 3H20, 6 g of KH2PO4, 0.2 mg of MnCl2 .4H20, 1 g of sodium citrate, and 0.2 g of MgSO4. Cultures were incubated at 37°C and aerated by shaking in baffled flasks. Plasmid construction. A 791-bp polymerase chain reaction product which contained sequences 240 bp upstream and 544 bp downstream of the transcription start site was cloned into pBluescript KS' (Stratagene) to yield pACB1 (see Fig. 1). The primers used to synthesize this polymerase chain reac*

was added to 0.1 M, and the nucleic acids were precipitated with 2.5 ml of ethanol on dry ice for 30 min. The precipitated nucleic acid was pelleted by centrifugation at 20,000 x g for 20 min at 4°C in an SS-34 rotor. The pellets were washed with 70% ethanol, dried, and suspended in 0.5 ml of diethylpyrocarbonate-treated water. The A26J/A280 of RNA prepared in this way was between 2.0 and 2.2, and the yield from 20 ml of cell culture was about 300 p,g. Samples were stored at -75°C for not longer than 2 weeks.

Corresponding author. 3212

Downloaded from http://jb.asm.org/ on January 19, 2019 by guest

We used primer extension and mutational analysis to identify a promoter upstream of iIvB, the first gene in the ilv-keu operon of Bacilus subtilis. Between the promoter and ilvB, there is a 482-bp leader region which contains a sequence that resembles a factor-independent transcription terminator. In in vitro transcription experiments, 90%o of transcripts initiated at the ilvB promoter ended at a site near this terminator. Primer extension analysis of RNA synthesized in vivo showed that the steady-state level of mRNA upstream of the terminator was twofold higher from cells limited for leucine than it was from cells grown with excess leucine. mRNA downstream of the terminator was 14-fold higher in cells limited for leucine than in cells grown with excess leucine. Measurement of mRNA degradation rates showed that the half-life of ilv-leu mRNA was the same when the cells were grown with or without leucine. These data demonstrate that the ilv-Iu operon is regulated by transcription attenuation.

ilv-leu OPERON OF B. SUBTILIS

VOL. 174, 1992 A. AP|

IIvB

llvN llvC louA

louC leuB louD

-240

. -.

I

.1-4 1

+60

Primer U , +120

, +180

+240 +300 +360 +420

-*PieD

+480

D ~~~~~~~~~~~Primer

_

~_

+540

FIG. 1. Organization of the ilv-leu region. (A) Arrangement of the ilv and leu genes and the ilv-leu leader region. (B) Nucleotide sequence of the 792-bp polymerase chain reaction product cloned into Bluescript to produce pACB1. Heavy overlines, primers used in primer extension experiments to measure transcripts from upstream (primer U) and downstream (primer D) regions of the leader mRNA; open boxes, -10 and -35 regions of the ilv-leu promoter; hatched box, putative start codon for ilvB; dots above the sequence, putative ilvB ribosome-binding site; arrows over the sequence, inverted repeat believed to form the stem and loop of the terminator; vertical arrow at nt +405, 5' endpoint of the cDNA produced from primer D.

MgCl2, 4 mM spermidine, 1 mM dithiothreitol, 50 ,ug of bovine serum albumin per ml, 8 U of RNasin (Promega), 0.2 mM each of ATP, CTP, GTP, and UTP, 0.5 p._g of B. subtilis (sigma A) RNA polymerase, and 10 ,uCi of [ 2P]UTP (Amersham) when products were to be labeled. The samples were incubated for 30 min at 30°C, phenol extracted, and ethanol precipitated with 50 jig of carrier tRNA. The pellets were washed with 70% ethanol, suspended in 40 ,ul of formamide loading buffer, and loaded onto a 4% polyacrylamide gel containing 50% urea. Nucleotide sequence accession number. The GenBank/ EMBL accession number for the ilv-leu sequence presented in this paper is M87009. RESULTS

Transcription in vitro. The organization of genes and the sequence of the leader region of the ilv-leu operon are shown in Fig. 1. To determine whether the potential transcription termination sequence indicated by the inverted arrows in Fig. 1B is recognized by RNA polymerase as a termination signal, we performed transcription in vitro with purified RNA polymerase. The template for this reaction, pACB1, contains a 792-bp fragment of DNA from the ilv-leu upstream region (Fig. 1B). The plasmid was linearized so that a runoff transcript 544 nucleotides (nt) long would be produced if transcription initiated at the putative ilv-leu promoter. Two products were observed from this reaction, and

Downloaded from http://jb.asm.org/ on January 19, 2019 by guest

Primer extension. Fifty micrograms of total cell RNA was mixed with 45 ng of 5' 32P-labeled oligonucleotide primer, ammonium acetate was added to 2.5 M (final concentration), and ethanol was added to precipitate the nucleic acid. The pellet from this precipitation was dissolved in 15 ,ul of reverse transcriptase buffer (50 mM Tris-Cl [pH 8], 5 mM MgCl2, 5 mM dithiothreitol, 50 mM KCI), heated to 80°C for 5 min, and cooled slowly to room temperature. Thirty-one units of avian myeloblastosis virus reverse transcriptase (Molecular Genetic Resources Inc.) was added, along with 370 ,uM deoxynucleoside triphosphates, 4 mM dithiothreitol, and 0.5 U of RNase Block II (Stratagene), to a final volume of 25 ,ul. The reaction mixtures were incubated at 45°C for 30 to 45 min and stopped by the addition of 25 mM EDTA to a final volume of 100 ,ul. The solutions were extracted with TE-saturated phenol and then with water-saturated ether, and nucleic acids were precipitated with ethanol and 2.5 M ammonium acetate. The pellets were washed with 70% ethanol, dried under vacuum, and suspended in formamide loading solution (1 ml of formamide, 1 mg of xylene cyanol, 1 mg of bromophenol blue, 10 mM EDTA). The samples were fractionated by electrophoresis through a 6% polyacrylamide gel containing 50% urea. For quantitation of radioactivity, the gel was dried by heating under vacuum and placed in a Beta-scope gel reader (Betagen) or the autoradiogram from an overnight exposure was used to locate bands, which were excised and placed in scintillation fluid for counting. mRNA decay measurements. Cultures were grown in minimal medium containing either 100 ,ug of leucine or N-acetylleucine per ml. At time zero, rifampin was added to a final concentration of 150 ,ug/ml, and samples were removed at succeeding time intervals. RNA was isolated as described above and used for primer extension. Oligonucleotide-directed mutagenesis and insertion of a chloramphenicol acetyltransferase (CAT) gene into the ilv-leu promoter. Single-stranded, uridine-substituted DNA of pACB1 was obtained by using VCSM13 helper phage as directed in the instructions provided with the Bluescript vector. This DNA was used as template to introduce a BglII site into the -10 region of the ilv-leu promoter by sitedirected mutagenesis (6). The oligonucleotide used for mutagenesis was 5' GFTGAACTCAGATCTCGCCGCT1T'GG 3'. The resulting plasmid was designated pACB3. A 1.5-kb BamHI restriction fragment containing the CAT gene was obtained from pTV54 (provided by Philip Youngman). The CAT gene was ligated into pACB3 which had been digested with BglII and treated with calf intestinal phosphatase. The resulting plasmid, designated pJG1, was linearized with ScaI and transformed into B. subtilis CU1065 (trpC2), and chloramphenicol-resistant colonies were selected. Insertion of the CAT gene into the ilvB promoter region on the B. subtilis chromosome was confirmed by a Southern blotting experiment. Genomic B. subtilis DNA was digested with AccI, and the fragments were transferred to a Hybond N membrane (Amersham). The membrane was probed with the 0.5-kb BglII-BamHI fragment of DNA from pACB3. Transcription in vitro. pACB1 or pFGB1 was linearized with BamHI, which cleaves in the polylinker region immediately downstream of the ilv-leu DNA insert. This linearized plasmid was used as template for transcription in vitro with purified B. subtilis (sigma A) RNA polymerase (11). Purified RNA polymerase was a gift from John Helmann (Cornell University). Twenty-microliter reaction mixtures contained 40 mM Tris-Cl (pH 8.0), 50 mM KCl, 4 mM

3213

J. BACTERIOL.

GRANDONI ET AL.

3214

A

RT

(,,

2

3_3 1 4 FIG. 2. Transcription in vitro and primer extension mapping of MspI-digested pBR322 size standards. Arrows indicate readthe 5' endpoints of the ilv-leu transcript. (A) Transcription in vitro through (RT) and terminated (T) transcripts. (B) Primer extension of performed with purified B. subtilis (sigma A) RNA polymerase. ilv-leu mRNA synthesized in vitro and in vivo. In vitro transcription Products were labeled by including [ 2P]UTP in the transcription reactions (as shown in Fig. 2A) were performed without 32P-labeled reaction. The templates for the reactions were as follows. Lane 1, UTP, and the 405- and 545-nt transcripts were isolated from the pACB1 linearized with BamHI. This plasmid contains the fragment polyacrylamide gel. These RNAs were used as templates for primer of DNA depicted in Fig. 1B cloned into the SmaI site of pBluescript extension with primer U (Fig. 1B). Lane 1, MspI-digested pBR322 KS'. Lane 2, PstI-linearized control plasmid pFGB1. Lane 3, size standards. Lanes 2 and 3, templates were unlabeled 405- and 792-bp fragment of ilv-leu DNA depicted in Fig. 1B. This fragment 545-nt in vitro transcription products, respectively. Lane 4, template was total B. subtilis RNA isolated from leucine-limited cells. was gel purified from a BamHI-EcoRI digest of pACB1. Lane 4,

Downloaded from http://jb.asm.org/ on January 19, 2019 by guest

T

their sizes were estimated by comparison to DNA size standards (Fig. 2A). The larger one was in the size range m: Q 2 Uexpected for the 544-nt runoff transcript. The smaller tranM m c script was 405 nt, a size expected if transcription terminated E e) within or very near the run of uridines after the inverted < repeat within the leader sequence (Fig. 1B and 2A). Quantitation of the products of transcription showed that about 90% of the radioactivity in these bands was associated with the 405-nt transcript. The same result was obtained when the 622 792-bp EcoRI-BamHl fragment of pACB1 was isolated from an agarose gel and used as a template for transcription in | |_vitro (Fig. 2A, lane 3). A control plasmid, pFGB1, was also 527 X # l lg527 used as a template. This plasmid contains DNA from -8 to +490 relative to the start site of transcription (see below), and thus it does not contain the putative -10 and -35 sequences of the ilv-leu promoter. Neither the terminated nor the read-through transcript was produced from this 403 control plasmid template (Fig. 2A, lane 2). Mapping the 5' end of the ilv-ku message. To map the 5' end of the transcripts produced in vitro, a transcription reaction was performed as described above but without adding labeled UTP. The products of the reaction were 4 1 2 3 electrophoresed in a lane adjacent to a lane containing the labeled reaction mixtures, and the unlabeled transcripts < < corresponding to the 405-nt and the 544-nt transcripts were Z Z < isolated from the gel. These RNAs were subjected to primer z o ; extension by using an oligonucleotide complementary to nt 85 to 115 of the predicted mRNA (Fig. 1B, primer U). The (Z) cDNA produced in this reaction was 115 nt in length when s:=: ~ . the 405-nt RNA or the 544-nt RNA was used (Fig. 2B). either r To compare these results with those from transcription in B. VI vivo, total RNA was isolated from B. subtilis CU4609 grown under conditions of leucine limitation. This RNA was used 2()l . .i.; as a template for primer extension with primer U. The cDNA produced in this reaction corresponded in size to the cDNA produced from RNA made in vitro (Fig. 2B, lane 4). DNA sequencing with primer U was used to map precisely the 5' end of the mRNA produced in vivo (Fig. 3, lanes 1 to 9). This 5' endpoint is 482 bases upstream of the translation start codon of ilvB and is hereafter defined as + 1. Centered at ^ftf gfi positions -10 and -35 in the DNA are sequences that *tig correspond well to those of a sigma A promoter. In vivo steady-state levels of ilv-lu mRNA. Previous results with a lacZ fusion in the ilvN gene indicated that transcrip121 tion of the ilv-leu operon decreased when cells were grown in _ k w>i medium containing leucine. The addition of isoleucine and valine did not have an appreciable effect on expression (17). 11()o We extended these results by measuring the effect of leucine on the steady-state accumulation of ilv-leu mRNA. To determine whether the putative transcription terminator in the mRNA leader region participated in leucine-dependent regulation, primer extension was performed with primers U and D, hybridizing upstream and downstream of the proposed transcription terminator, respectively (Fig. 1B). LeuI E

ilv-leu OPERON OF B. SUBTILIS

VOL. 174, 1992 primer

minutes after suspension

medium

upstream

.Q

5

20

downstream

Q T

5 NT T

-20 Nk

T

cine limitation was induced by growing a leucine auxotroph in minimal medium containing 100 ,g of N-acetyl-leucine per ml as a leucine source. Under these conditions, cultures grew logarithmically but at about one-half the rate of growth with leucine (4b). A culture of B. subtilis CU4609 (trpC2 leuB16 ilvN:: Tn917) was grown in minimal medium containing 100 ,g of leucine per ml. During mid-log phase, a sample was removed (time zero), the remaining culture was divided in half, and the cells were harvested by centrifugation. One half of the cells was suspended in fresh minimal medium containing 100 ,g of leucine per ml, and the other half was suspended in minimal medium containing 100 ,g of N-acetyl-leucine per ml. After 5 and 20 min at 37°C, samples were removed and the RNA isolated from them was used in primer extension experiments. After 5 min of leucine limitation, the level of mRNA upstream of the terminator was twofold higher than that measured in the culture grown with leucine (Fig. 3). This twofold difference in upstream message did not change after 20 min of leucine limitation. The level of mRNA downstream of the terminator increased 14-fold after 5 min of leucine limitation and was still 14-fold after 20 min of leucine limitation. These results indicate that the mRNA downstream of the proposed transcription terminator is highly regulated by leucine, whereas the mRNA upstream of the terminator is only slightly regulated by leucine. On the basis of results obtained with primer U (Fig. 1B and Fig. 3, lanes 1 to 9), we expected the cDNA produced by

primer D to be 544 nt in length, which would indicate a 5' endpoint at position +1. Instead, the extension product when primer D was used was only 147 nt in length (Fig. 3, lanes 10 to 18). DNA sequencing lanes adjacent to the primer extension lane established that the cDNA obtained from primer D corresponded to an mRNA having a 5' endpoint at position +405 (Fig. 1B). We considered three ways in which this unexpected primer D extension product might have arisen. (i) A promoter exists just upstream of position +405, and the 5' endpoint mapping at position +405 resulted from transcripts initiated at that position. (ii) Transcription initiated at position +1 and the 5' endpoint mapping to position +405 resulted from cleavage at that position by nucleases. (iii) Reverse transcription from primer D stopped before reaching the 5' end of transcripts, and therefore these results do not establish the 5' endpoint of transcripts. With respect to possibility (iii), it may be noted that there is a potentially strong secondary RNA structure immediately upstream of position +405 (see Fig. 6; AG0 predicted to be -35 kcal/mol [1 cal = 4.184 J]) (4). Results presented below demonstrate that there is no additional promoter between positions +1 and +540. Furthermore, we show that the extension of primer D by reverse transcriptase is indeed blocked at position +405 when a T3 RNA polymerase-generated RNA is used as a template. The ilv-leu leader region contains no additional promoters. To determine whether there is more than a single promoter upstream of ilvB, we inactivated the putative promoter and searched for transcripts that might arise from promoters within the leader region. Inactivation of the ilv-leu promoter was achieved by introducing a BglII site within the -10 region by site-directed mutagenesis and then by inserting a CAT gene into the BglII site. The resulting plasmid was linearized and used to transform B. subtilis CU1065 (trpC2) to chloramphenicol resistance. Southern blot analysis confirmed that the ilv-leu promoter region contained an insertion of the CAT gene as expected (data not shown). The resulting strain required leucine, isoleucine, and valine for growth, whereas the parent was prototrophic for these amino acids. RNA isolated from the mutant strain was used as a template in primer extension experiments with primer U and primer D as described above. Neither of these primers produced a

detectable cDNA product in this reaction regardless of whether cells were grown with excess or limiting leucine (data not shown). These results suggest that no additional transcription start points are present within the ilv-leu leader region. Therefore, the observed 5' endpoint at position +405 must be due either to nuclease action or to incomplete primer extension. If the latter hypothesis is correct, then the same cDNA products of primer D extension would be expected when either RNA synthesized in vivo or RNA synthesized in vitro is used as the template. To test this hypothesis, we synthesized leader RNA in vitro from ilv-leu DNA cloned into a Bluescript vector downstream of a promoter recognized by T3 RNA polymerase. The resulting product included mRNA sequences extending from the T3 promoter within the vector to position +869 of the ilv-leu DNA. Reverse transcription from primer D produced identical products from RNA templates made in vitro and in vivo, as judged by electrophoresis (Fig. 4B). These results show that, even with a full-length template, reverse transcriptase did not continue past position +405 when primer D was extended. The results of primer extension with primer D made us question whether the 5' endpoint mapped with the upstream primer was a true endpoint or the result of inhibition of reverse transcriptase by a secondary structure.

Downloaded from http://jb.asm.org/ on January 19, 2019 by guest

I 4 v 1U 11 12 13 14 15 16 17 18 7/ FIG. 3. In vivo steady-state levels of ilv-leu mRNA upstream and downstream of the transcription terminator. Cells were grown in minimal medium containing leucine and at time zero were transferred into similar medium containing either leucine (L) or N-acetyl leucine (N). RNA was isolated at 0, 5, and 20 min after the transfer to fresh medium. Lanes: 1 to 5, primer extension with the upstream primer (primer U, Fig. 1B); 6 to 9, DNA sequencing reactions, for A, C, G, and T, respectively, with primer U; 10 to 14, primer extension with the downstream primer (primer D, Fig. 1B); 15 to 18, DNA sequencing reactions, for A, C, G, and T, respectively, primer D.

3215

3216

J. BACTERIOL.

GRANDONI ET AL.

A PT3

Bam HI

pilV-leu

--A.-

I

-oG-

m

-I-ilvBl

L primer U

B.

o

mRNA

1- 147 nt-I cDNA primer D

43S nt

in

RNA

in vivo

primer

U D U D U D

vitro

None2

403

201

147 122

110

1 2 3 4 5 6 7 8 FIG. 4. Incomplete extension of primer D with in vitro synthesized mRNA as template. (A) In vitro transcription with phage T3 RNA polymerase. Labels on right side of figure: DNA, BamHIlinearized pACB1 template; mRNA, mRNA predicted from transcription in vitro; cDNA, products obtained by primer extension of in vitro synthesized mRNA. (B) Primer extension products from in vitro synthesized mRNA were compared with those produced from total RNA isolated from B. subtilis. Lanes 1 and 2, extension of primer U and D, respectively, with total B. subtilis RNA as template. Lanes 3 and 4, extension of primers U and D, respectively, with mRNA synthesized in vitro with T3 RNA polymerase as template. Lanes 5 and 6, the same as lanes 3 and 4 except that the in vitro transcription reaction did not include T3 RNA polymerase. Lane 7, products of transcription in vitro of pACB1 by T3 RNA polymerase. [32P]UTP was included to visualize transcripts. Lane 8, MspI-digested pBR322 size standards. Arrow indicates location of 435-nt cDNA produced when primer U was used in primer extension of mRNA produced in vitro with T3 RNA polymerase (lane 3).

Figure 4B shows that, when primer U was used with the in vitro synthesized RNA, reverse transcriptase extended through the ilv-leu + 1 site and continued to the T3 promoter start site, yielding a cDNA product of 435 nt (Fig. 4B, lane 3). This indicates that the 5' end of the ilv-leu RNA that mapped to position +1 with primer U (Fig. 4B, lane 1) is not

DISCUSSION Primer extension with mRNA from wild-type cells as a template identified the start site of transcription of the ilv-leu operon, designated +1 (Fig. 2). The following several lines of evidence indicate that the RNA endpoint at +1 resulted from transcription initiation directed by the ilv-leu promoter. (i) Disruption of the -10 region of the putative promoter in an otherwise wild-type background yielded a strain that required leucine, isoleucine, and valine for growth. No ilv-leu mRNA was detected by primer extension of RNA from this strain. (ii) In vitro transcription of an ilv-leu template with purified B. subtilis RNA polymerase yielded transcripts having the same 5' endpoint as those observed for RNA synthesized in vivo (Fig. 2B). (iii) Primer extension experiments did not suggest promoters upstream of the one we have identified and showed that the 5' endpoint at +1 is not due to inhibition of reverse transcriptase. Taken together, these results indicate that the ilv-leu transcription start point is located 482 bp upstream of the coding region for ilvB and that there are no other promoters within the leader

region. Quantitative primer extension was used to measure the in vivo steady-state levels of ilv-leu mRNA upstream and downstream of the putative point of transcription termination within the leader region. mRNA levels in cultures that were grown under conditions of leucine limitation were compared with those in cultures grown in excess leucine. Leucine limitation led to a 14-fold increase in steady-state mRNA levels downstream of the transcription terminator. In contrast, leucine limitation induced about a twofold increase in ilv-leu mRNA levels upstream of the terminator (Fig. 3). We also showed that the leucine-dependent differences in ilv-leu mRNA levels were not due to differences in message stability. We conclude, therefore, that these differences in mRNA levels must have been due to changes in rates of synthesis (Fig. 5). All of our results taken together lead to the following assessment. There is only a single ilv-leu promoter upstream of ilvB. We presume that the twofold decrease in the rate of synthesis of promoter-proximal RNA that is dependent upon leucine is due to a corresponding decrease in the rate of

Downloaded from http://jb.asm.org/ on January 19, 2019 by guest

622

due to inhibition of reverse transcriptase by a secondary structure. The 5' endpoint observed with primer D can be explained without postulating either transcription initiation or RNA processing. However, we cannot exclude the possibility that processing occurs at position +405 or further upstream in vivo. The half-life of ilv-leu mRNA. The 14-fold derepression in mRNA level measured with the downstream primer could result from a decrease in the degradation rate of ilv-leu mRNA in cells limited for leucine. We tested this by measuring the half-life of mRNA decay. Leucine auxotrophic strain CU4609 was cultured in minimal medium with leucine or with N-acetyl-leucine. At time zero, rifampin was added to prevent further mRNA synthesis and RNA was isolated from samples removed during the next 2 min. These RNAs were used as templates for primer extension employing primers U and D. Figure 5 shows the results of this analysis. The rates of decay of mRNA upstream and downstream of the transcription attenuation site were similar (half-life = 0.5 min versus 1 min, respectively). More importantly, these rates of mRNA decay were not affected by leucine limitation.

ilv-leu OPERON OF B. SUBTILIS

VOL. 174, 1992

3217

A + N-ace.-.I tyI leucine

medium

+ leucine

1|9

upstream

primer

Time after rif. addition 0

0.5

1.0

1.5

2

3

4

As

i

downstream

upstream

downstream n

iS

7

8

nAA

1. A)

I5

0

11

12

13 14 15 16

0A5

1A0 1iS

(mm.)

5

6

9 10

B Oa 1 c co .0 :

13; 4._ &W

:w1

1

0

2

Time (min) FIG. 5. Decay of ilv-leu mRNA from the leader region. Strain CU4609 was grown in medium containing either leucine or N-acetyl-leucine. Rifampin was added to the culture at time zero. Total RNA was isolated from cells at the times indicated after rifampin addition, and primer extension was performed with primers U and D. (A) Autoradiogram of primer extension gel. Lanes: 1 to 4 and 9 to 12, primer extension with primer U; 5 to 8 and 13 to 16, primer extension with primer D. (B) Quantitation of radioactivity in primer extension gel by use of a Betascope gel reader. Open symbols, RNA from cells grown with leucine; closed symbols, RNA from cells grown with N-acetyl-leucine; squares, extension from primer U; triangles, extension from primer D.

initiation of transcription from that promoter. Whether this twofold decrease reflects a specific regulatory mechanism (for example, an operator-repressor interaction) remains to be determined. The 14-fold decrease in the rate of synthesis of promoter-distal RNA must be due primarily to transcription attenuation. Thus, in comparison with a condition of leucine excess, a leucine limitation leads to a twofold increase in the rate of transcription initiation at the ilv-leu promoter and a sevenfold increase in the rate with which RNA polymerases continue transcription beyond the attenuator site. This view is strongly supported by the results of in vitro

transcription experiments (Fig. 2A). Ninety percent of transcripts generated by purified B. subtilis RNA polymerase had a 3' endpoint at position +405, corresponding to transcripts terminated near the base of a prominent stem-andloop structure within the leader region (Fig. 6). The DNA corresponding to this stem-and-loop region has features that are similar to known factor-independent transcription termination sites. These include a GC-rich stem structure of considerable stability (26 bp; calculated AG = -35 kcal/ mol), followed by a stretch of T residues in the nontranscribed strand. It should be noted, however, that the overall length of this stem-loop structure is considerably greater

Downloaded from http://jb.asm.org/ on January 19, 2019 by guest

1

3218

J. BACTERIOL.

GRANDONI ET AL. u u

A

G

370 A C

G Uc

A U

C

C U

G C

G C 380

G G

G A 360 U G U

A

U

U

U

U C

G U

C

G

C

G C G 350 U G U A U A U G C C G A A

340

A A

G 330

UACCGCGGA

G

400

G C U U U U AU

A

U

A

U

410

AUUGAAU

FIG. 6. Potential transcription terminator structure within ilv-leu leader mRNA. Numbering is the same as that shown in Fig. 1.

than those that are known or postulated for other systems (26 versus 12 bp) (1). In considering models of transcription termination, a prominent role is assigned to the formation of a GC-rich RNA stem that competes with the RNA-DNA hybrid within the transcription complex (16). The stem-andloop structure shown in Fig. 6 contains such a GC-rich region and, in addition, two regions of rather weak base pairing between nt 355 and 389. Mutational analysis suggests that the pairing in all three regions is important for normal regulation (4a). In E. coli and Salmonella typhimunium, operons involved in branched-chain amino acid biosynthesis, including ilv GMEDA, ilvBN, and leuABCD, are controlled by transcription attenuation mechanisms (5, 8, 10). In each of these cases, most transcription initiated in vitro at the promoter is terminated at an attenuator site located upstream of the structural genes of the operon. The leader RNA that results from this transcription contains signals that potentially serve for translation initiation and termination and, in addition, tandem arrays of "control" codons that are known to play an important role in the mechanism (7). For example, the leu operons of E. coli and S. typhimunum have four tandem leucine codons within the leu leader (5). In vivo, during coupled transcription and translation of the leader region, a stem-and-loop structure formed by the newly transcribed leader RNA is postulated to cause RNA polymerase to pause and to facilitate coupling between the polymerase and the ribosome. As coupled transcription and translation continues, the leader RNA can potentially fold into two different secondary structures, one favoring transcription termination and the other favoring transcription read-through (7). Which of these secondary structures is formed is thought to depend upon the relative positions of ribosomes and RNA polymerase during coupled transcription and translation.

ACKNOWLEDGMENTS We thank John Helmann for providing purified RNA polymerase, Debra Aker-Willins for advice on primer extensions, Ronald Gary for work on in vitro transcription experiments, Patricia Grandoni for help with computational analysis, Philip Youngman for providing pTV54, and Jeffrey Roberts and Donald Holzchu for critical reading of the manuscript. This work was supported by grant GM43979 from the National Institutes of Health to S.A.Z. REFERENCES 1. Brendel, V., G. H. Hamm, and E. N. Trifonov. 1986. Termina-

tors of transcription with RNA polymerase from Escherichia coli: what they look like and how to find them. J. Biomol. Struct. Dyn. 2:705-723. 2. Debarbouille, M., M. Arnaud, A. Fouet, A. Klier, and G. Rapoport. 1990. The sacT gene regulating the sacPA operon in Bacillus subtilis shares strong homology with transcriptional

Downloaded from http://jb.asm.org/ on January 19, 2019 by guest

C

390

G G

Is the B. subtilis ilv-leu operon controlled by a mechanism similar to that described above? In vitro, most transcription initiated at the ilv-leu promoter is terminated at an attenuator site, giving rise to a 405-nt leader RNA (Fig. 2A). The prominent stem-and-loop structure in the leader that presumably contributes to termination is shown in Fig. 6. A computer search for other potential secondary structures (GCG PAIR program) identified many potential stem-andloop structures (4). Two of these stem-and-loop structures may be analogous to the protector and antiterminator structures believed to participate in attenuation control of E. coli amino acid biosynthetic operons. Additional analysis of the ilv-leu leader RNA revealed an open reading frame that begins with a GUG codon at nt +249 and extends to nt +317. This reading frame contains three leucine codons, two of which are tandem. It is, therefore, possible that the ilv-leu operon of B. subtilis is regulated by an attenuation mechanism similar to that used for the E. coli leucine operon. Preliminary results of translational fusion of lacZ with this open reading frame indicated that translation of this open reading frame does not occur (Sa). In B. subtilis, there are several examples of operons that are regulated by attenuation. In the biosynthetic operons pur, pyr, and t-p and the sugar utilization operons sacB and sacPA, the mechanism of attenuation is believed to be independent of ribosomes (2, 3, 9, 11, 12). For the B. subtilis thp operon, the primary outcome of transcription in vitro is read-through, and the consequence of a mutation in an unlinked regulatory gene is constitutive expression of the trp operon (11). Thus, the default state for this operon is read-through and the regulatory element is believed to act negatively to prevent read-through. We have presented evidence that regulation of the ilv-leu operon of B. subtilis differs from that just described in that the default state of ilv-leu is transcription termination. Presumably, when the ilv-leu operon is expressed at a high level, a regulatory element acts positively to increase the amount of readthrough beyond the terminator. Whether this regulatory factor is the ribosome or some other factOr remains to be established. The molecular details of the transcription attenuation mechanism for the ilv-leu operon have yet to be determined. The only unlinked mutation affecting ilv-leu expression characterized to date was located in leuS, which encodes a leucine tRNA synthetase (13). This result implies that either leucyl tRNA synthetase is directly involved in the regulatory mechanism or that it is indirectly involved by attaching leucine to its cognate tRNA.

VOL. 174, 1992

3219

10. Searles, L. L., S. R. Wessler, and J. M. Calvo. 1983. Transcription attenuation is the major mechanism by which the leu operon of Salmonella typhimunum is controlled. J. Mol. Biol. 163:377-394. 11. Shimotsu, H., M. I. Kuroda, C. Yanofsky, and D. J. Henner. 1986. A novel form of transcription attenuation regulates expression of the Bacillus subtilis tryptophan operon. J. Bacteriol. 166:461-471. 12. Steinmetz, M., D. Le Coq, and S. Aymerich. 1989. Induction of saccharolytic enzymes by sucrose in Bacillus subtilis: evidence for two partially interchangeable regulatory pathways. J. Bacteriol. 171:1519-1523. 12a.Ulmanen, I., K. Lundstrom, P. Lehtovaara, M. Sarvas, M. Rhohonen, and I. Palva. 1985. Transcription and translation of foreign genes in Bacillus subtilis by the aid of a secretion vector. J. Bacteriol. 162:176-182. 13. Vander Horn, P. B., and S. A. Zahler. Cloning and nucleotide sequence of the leucyl-tRNA synthetase gene of Bacillus subtilis. Submitted for publication. 14. Vandeyar, M. A., J. A. Grandoni, J. A. Rafael, and S. A. Zahler. Unpublished data. 15. Ward, J. B., and S. A. Zahler. 1973. Genetic studies of leucine biosynthesis in Bacillus subtilis. J. Bacteriol. 116:719-726. 16. Yager, T. D., and P. H. von Hippel. 1991. A thermodynamic analysis of RNA transcript elongation and termination in Escherichia coli. Biochemistry 30:1097-1118. 17. Zahler, S. A., N. Najimudin, D. S. Kessler, and M. A. Vandeyar. 1990. Acetolactate synthesis by Bacillus subtilis, p. 25-32. In Z. Barak, D. Chipman, and J. V. Schloss (ed.), Biosynthesis of branched chain amino acids. VCH Verlagsgesellschaft mbH, Weinheim, Germany.

Downloaded from http://jb.asm.org/ on January 19, 2019 by guest

antiterminators. J. Bacteriol. 172:3966-3973. 3. Ebbole, D. J., and H. Zalkin. 1987. Cloning and characterization of a 12-gene cluster from Bacillus subtilis encoding nine enzymes for de novo purine nucleotide synthesis. J. Biol. Chem. 262:8274-8287. 4. Freier, S. M., R. Kierzek, J. A. Jaeger, N. Sugimoto, M. H. Caruthers, T. Neilson, and D. H. Turner. 1986. Improved free-energy parameters for predictions of RNA duplex stability. Proc. Natl. Acad. Sci. USA 83:9373-9377. 4a.Fulmer, S. Unpublished results. 4b.Garrity, D. (Cornell University). Unpublished results. 5. Gemmill, R. M., S. R. Wessler, E. B. Keller, and J. M. Calvo. 1979. The leucine operon of Salmonella typhimurium is controlled by an attenuation mechanism. Proc. Natl. Acad. Sci. USA 76:4941-4945. Sa.Grandoni, J. Unpublished results. 6. Kunkel, T. A. 1985. Rapid and efficient site specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488-492. 7. Landick, R., and C. Yanofsky. 1987. Transcription attenuation, p. 1276-1301. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium, vol. 2. American Society for Microbiology, Washington, D.C. 8. Lawther, R. P., and G. W. Hatfield. 1980. Multivalent translational control of transcription termination at the attenuator of the ilvGEDA operon of Escherichia coli K-12. Proc. Natl. Acad. Sci. USA 77:1862-1866. 9. Quinn, C. L., B. T. Stephenson, and R. L. Switzer. 1991. Functional organization and nucleotide sequence of the Bacillus subtilis pyrimidine biosynthetic operon. J. Biol. Chem. 266: 9113-9127.

ilv-leu OPERON OF B. SUBTILIS