FULL MANUSCRIPT

JOURNAL OF INTERFERON & CYTOKINE RESEARCH Volume 00, Number 00, 2014 ª Mary Ann Liebert, Inc. DOI: 10.1089/jir.2014.0018

Transcriptional Regulation of Important Cellular Processes in Skeletal Myogenesis Through Interferon-g Katarzyna Grzelkowska-Kowalczyk, Zofia Wicik, Alicja Majewska, Justyna Tokarska, Kamil Grabiec, Marcin Kozłowski, Marta Milewska, and Maciej Błaszczyk

The purpose of the present study was to investigate the effect of interferon (IFN)-g on the transcriptomic profile of differentiating mouse C2C12 myogenic cells. Global gene expression was evaluated using whole mouse genome oligonucleotide microarrays, and the results were validated through real-time PCR. IFN-g (1 ng/mL) increased myoblast proliferation but decreased cell respiration and myosin heavy chain content and slightly decreased the fusion index in differentiating C2C12 cell cultures. The genes upregulated through IFN-g were involved in cell cycle; regulation of cell proliferation; programmed cell death; chemotaxis; and cytokine, growth factor, and peptidase activity, whereas the genes downregulated through IFN-g primarily contributed to the regulation of transcription, cell–cell signaling, nitrogen compound biosynthesis, ser/thr protein kinase signaling, and regulation of the Wnt pathway. In conclusion, IFN-g affects the expression of numerous genes associated with the regulation of several processes in myogenesis. The effects of IFN-g on cellular transcription include (1) alteration of cytokine/growth factor expression, promoting cell proliferation and migration but inhibiting differentiation, (2) impairment of pro-myogenic transcription, (3) disruption of cell adhesion and sarcolemma/cytoskeleton organization, and (4) increased peptidase activity leading to enhanced proteolysis and apoptosis.

myotubes. In previous studies, we showed indirect effects of IFN-g concerning the modification of insulin- and IGF-Idependent protein kinase phosphorylation (GrzelkowskaKowalczyk and Wieteska-Skrzeczyn´ska 2010a, 2010b) and impaired IGF-I-regulated myogenesis, most likely through alterations in local growth factor bioavailability via the modification of IGF binding protein expression (WieteskaSkrzeczyn´ska and others 2011a). Myogenesis is a complex and highly regulated process that involves the proliferation of myoblasts, followed by molecular, biochemical, and morphological modifications, resulting in the formation of multinucleated myotubes (Charge and Rudnicki 2004). Adequate myogenic differentiation requires crosstalk between numerous cellular processes, including cell-cycle withdrawal (De Falco and De Luca 2006), growth factor/cytokine expression (Griffin and others 2010), apoptosis (Tomczak and others 2004), cell– cell and cell–matrix interactions (Osses and others 2009), and protein synthesis and accretion (Yogev and others 2013). The activation of muscle-specific gene expression involves the association of helix-loop-helix myogenic regulatory factors with the MEF2 family of myocyte enhancerbinding factors (Charge and Rudnicki 2004). Microarray experiments facilitate the simultaneous measurement of the expression of multiple genes and the identification of genes and proteins that contribute to the

Introduction

I

nterferon (IFN)-g has been recognized as a pleiotropic cytokine that regulates different immune responses and affects many physiological processes (Wynes and Riches 2003; Hwa and others 2004). This cytokine influences skeletal muscle homeostasis and repair; however, the precise effects of IFN-g remain controversial. In one study, the transient administration of IFN-g improved skeletal muscle healing and limited fibrosis (Foster and others 2003). According to Cheng and others (2008), IFN-g and its receptor are expressed in myogenic cells, and blocking IFN-g receptor signaling reduces cell proliferation and fusion, supporting a role for this cytokine in the formation of new muscle fibers. However, there is also evidence for the procatabolic activity of IFN-g in muscle cells, manifested through the increased expression of ATP-dependent proteolytic pathway elements, such as ubiquitin ligases, atrogin-1/ MAFbx, and muscle-specific ring finger protein 1 (MuRF1) (Smith and others 2007). IFN-g has been reported to exert differential (Smith and others 2007; Wieteska-Skrzeczyn´ska and others 2011b), synergistic (Wesemann and Benveniste 2003; Acharyya and others 2004), and reciprocal modulatory effects (Alvarez and others 2002; Tolosa and others 2005) with the most relevant proinflammatory cytokine, tumor necrosis factor (TNF)-a, in cultures of myogenic cells and

Department of Physiological Sciences, Faculty of Veterinary Medicine, Warsaw University of Life Sciences (SGGW), Warsaw, Poland.

1

2

GRZELKOWSKA-KOWALCZYK ET AL.

regulation of cellular processes. In this study, we used a microarray technique for the comprehensive analysis of IFN-g action on differentiating mouse C2C12 myogenic cells at the transcriptomic level. Global gene expression was evaluated using whole mouse genome oligonucleotide microarrays, and the results were validated through real-time PCR.

a phase-contrast microscope (IX 70; Olympus), and the average number of nuclei in myotubes in 10 random fields was recorded for each dish. The results are presented as fusion index (%) = (number of nuclei in myotubes)/(total number of nuclei in myoblasts and myotubes) · 100, as previously described (Dedieu and others 2002).

Materials and Methods

Immunoblotting

Cell culture

Whole cell lysates were obtained using RIPA (RadioImmunoPrecipitation Assay) buffer supplemented with protease and phosphatase inhibitor cocktail (Sigma-Aldrich). The protein concentration in the lysates was determined using a BCA kit according to the manufacturer’s instructions. Aliquots of cell extracts corresponding to 100 mg of protein were resolved through SDS-polyacrylamide gel electrophoresis, and subsequently, the proteins were transferred to a polyvinylidene fluoride (PVDF) membrane. The membranes were blocked with 5% nonfat dry milk in TBS buffer, incubated with the appropriate primary antibody (obtained from Santa Cruz Biotechnology), washed thrice in TBS containing 0.5% Tween 20 (TBST), and incubated for 1 h with secondary antibody (1:5,000 dilution). The secondary antibody was conjugated with the appropriate IR fluorophores, IRDye 680 or IRDye 800 CW (IR- longerwavelength near-infrared), for the detection of the specific proteins directly on the PVDF membrane using the Odyssey Infrared Imaging System (LI-COR Biosciences). The detection was based on the signal from Near-infrared (NIR) fluorophoreconjugated antibodies. The scan resolution of the instrument was set at 169 mm, and the intensity was set at 4, consistent with the standard protocol. The quantification of the integrated optical density (IOD = optical density · area) was performed using the analysis software provided with the Odyssey scanner (LI-COR Biosciences). The optical density of the band of each studied protein was presented in arbitrary units. This semiquantitative method was used to compare the level of protein of interest between the control and experimental treatments.

The murine myogenic C2C12 cell line (satellite cells from thigh muscle), purchased from the European Collection of Animal Cell Culture (ECACC), was used in this study. These cells undergo proliferation and differentiation in response to growth factors in the extracellular environment; thus, this cell line is a useful model to study the mechanisms controlling myogenesis. Cell cultures were maintained free of contamination at the exponential growth phase in 10% FBS/DMEM (Fetal Bovine Serum/Dulbecco’s modified Eagle’s medium) containing an antibiotic–antimycotic mixture (Life Technologies) in controlled humidified air supplemented with 5% CO2, at 37C. The growth medium was changed every other day. After reaching *40% confluence, the proliferating myoblasts were exposed to IFN-g (1 ng/mL) in 2% FBS/DMEM for 24 h. When the cells reached *80% confluence, myogenic differentiation was induced after switching to a medium containing 2% horse serum supplemented with IFN-g (1 ng/mL). According to a recent study, this cytokine concentration affects IGF-I-dependent myogenesis and IGF-I signaling in C2C12 myoblasts (Wieteska-Skrzeczyn´ska and others 2011a, 2011b). To preserve the characteristics of the C2C12 cell line, the cells were split up to a maximum of 7 times.

Assessment of cell viability and proliferation The viability of the proliferating and differentiating cells was determined using a 3-(4.5-dimethylthiazol-2-yl)-2.5diphenyltetrazolium bromide (MTT) assay. The cells were seeded onto 96-well plates, and after the indicated incubation times, 180 mL of MTT solution (0.5 mg/mL) in phosphate-buffered saline (PBS) was added to each well. The plates were subsequently incubated for 4 h at 37C. The reaction product, that is, precipitated formazan, was solubilized in 100% dimethyl sulfoxide (100 mL/well). A crystal violet (CV) assay was performed to determine the total amount of nuclear DNA (cell proliferation). The cells were cultured in 96-well plates and fixed with 75% and 100% methanol for 20 min. The monolayer was subsequently stained using CV solution (2 mg/mL) for 5 min. The excess unbound dye was removed after washing the plates with water. The bound CV was released after adding 1% sodium dodecyl sulfate (SDS) for 30 min. In both assays, the absorbance was measured on the Infinite 200 PRO Tecan multidetection micro plate reader (TECAN) at a wavelength of 570 nm.

Myoblast fusion Differentiating C2C12 myogenic cells were used for experiments at day 3. To visualize the morphological changes in C2C12 cell cultures, the monolayers were washed twice with ice-cold PBS and fixed with 75% methanol (v/v), followed by Giemsa staining. The images were captured using

Wound healing assay To assess the migration ability of myogenic cells, a woundhealing assay was applied. The cells were seeded onto Petri dishes and subjected to 3-day differentiation in the absence (control) or presence of IFN-g (1 ng/mL). A wound was simulated through a straight scratch using a sterile 100-mL pipette tip. Wound healing was monitored using phasecontrast microscopy (10 · objective), and the images were captured immediately (0 h) and at 6 and 12 h after the mechanical wounding. Migration was measured as a reduction of distance between the wound edges due to the movement of cells into the cell-free zone. The reduction of the average distance between the wound edges was measured (calculated separately for each image, representing a mean of 10 random distances acquired using Olympus Microimage software). The migratory ability was compared between control and IFN-g-treated cells using images with similar initial wound edge distances. The results were presented as the percentage wound healing using the following equation: % wound healing = (1 – average wound distance at examined time point/average wound distance immediately after wounding) · 100, as previously described (Harfouche and Hussain 2006). The results were representative of 3 separate experiments performed in triplicate.

IFN-c AFFECTS THE MYOBLAST TRANSCRIPTOME

Microarray analysis Total RNA was extracted and purified from C2C12 cells on the third day after the induction of differentiation using the Total RNA kit (A&A Biotechnology) according to the manufacturer’s protocol. The isolated RNA samples were dissolved in RNase-free water. The quantity of the isolated RNA was measured using Nano-Drop (NanoDrop Technologies). The RNA samples were treated with DNase I to eliminate DNA contamination and subsequently purified using the RNeasy MiniElute Cleanup Kit (Qiagen). Subsequently, the RNA samples were analyzed on a BioAnalyzer (Agilent) to measure the final RNA quality and integrity. Total RNA (1,000 ng) from each sample was amplified and labeled according to the protocol for Agilent Gene Expression oligo microarrays (Version 5.7, March 2008). The Agilent whole mouse gene expression (Mouse GE 4x44K v2) oligonucleotide microarray slide (containing 4 microarrays; Array ID 026655) was used for the hybridization. Each microarray contained 39,430 oligonucleotide probes. The cRNA from one control sample (labeled with Cyanine-3) and one experimental sample (labeled with Cyanine-5) were hybridized onto each microarray, resulting in the analysis of RNAs from 4 control and 4 experimental cultures on each microarray slide. The hybridized microarrays were scanned on an Agilent G2505C Microarray Scanner, and the slide images were quantified using Feature Extraction Software (Agilent) with default parameters, and to minimize nonbiological variability across arrays, the raw data were first log2 transformed and exported to GeneSpring 12 (Agilent). Total detected entities were filtered according to flags (present, marginal).

Real-time PCR To validate the microarray data, real-time qPCR was performed. Primer sequences for the analyzed genes were used as previously described; alternatively, the mRNA gene sequences were obtained from the NCBI database, and the

Table 1. Gene symbol Tlr3 Irf7 Tgfb2 Fgf7 Hgf 18S rRNA Rpl13a

3

primers were designed using PRIMER3 software (free online access) and validated using Oligo Calculator (free online access) and Primer-Blast (NCBI database). The 18S rRNA and RPl13a genes were used as nonregulated reference genes for the normalization of target gene expression. The primer sequences are listed in Table 1. Quantitative RT-PCR was performed using the fluorogenic LightCycler Fast Strand DNA Master SYBR Green I kit (Roche) and a Light Cycler (Roche). The results were calculated using the 2 - DDCt method (Livak and Schmittgen 2001). The expression changes are shown as the relative upor downregulation normalized to 2 internal reference genes, 18S rRNA and RPl13a. For the normalization of target gene expression, the arithmetic mean of the reference genes was used. The experiment was performed 3 times.

Statistical analyses The results of the MTT and CV tests are representative of 4 separate experiments performed in triplicate (n = 12). The data obtained from the immunoblotting analysis represent 3 separate experiments performed in triplicate (n = 9). The visualization of the morphological changes during myoblast differentiation was performed twice with 5 dishes/treatment. The individual data (n = 10) used for statistical analysis represent average numbers of nuclei observed in myotubes recorded in 10 random fields for each dish. The wound-healing assay was performed thrice in triplicate. The individual data (n = 9) used for statistical analysis represent the average reduction of the cell-free zone, calculated from 10 random distances between the initial wound edges recorded for each image. For each assay, Student’s t-test was used to compare the 2 means (control versus experimental treatment). The analyses were performed using GraphPad Prism 5 (GraphPad Software). Values with P < 0.05 were considered statistically significant. Differential gene expression was statistically analyzed using an unpaired t-test to examine the null hypothesis of no differential expression between the control and experimental group.

The Primers Used for Real-Time Quantitative Polymerase Chain Reaction

Primer sequence Fr: TTGTCTTCTGCACGAACCTG Rv: CCCGTTCCCAACTTTGTAGA Fr: CACCCCCATCTTCGACTTCA Rv: CCAAAACCCAGGTAGATGGTGTA Fr: TACTGCAGGAGAAGGCAAGC Rv: GGACGGCATGTCGATTTTAT Fr: ATCAAAGGGGTGGAAAGTGA Rv: CCTCCGCTGTGTGTCCATTTA Fr: ACTGACCCAAACATCCGAGTTG Rv: TTCCCATTGCCACGATAACAA Fr: GCATGGCCGTTCTTAGTTGG Rv: TGAACGCCACTTGTCCCTCT Fr: AATGTGGAGAAGAAAATCTGCAA Rv: TCATTTTCAACACTGAAGCTCAA

Optimum annealing temp. (C)

Optimum annealing time (s)

62

6

58

12

Khorooshi and Owens 2010

58

12

Wolf and others 2009

62

6

58

10

Zhang 2010

58

10

Janeke and others 2003

58

10

Designeda

References Hayashi and others 2011

Designeda

a The primers were designed using The PRIMER3 software (free on-line access) and checked using the Oligo Calculator (free on-line access) and The Primer-Blast (NCBI database). The 18S rRNA and the RPl13a genes were used as nonregulated reference genes for normalization of the target gene expression.

4

The statistical significance was set at P £ 0.05. Moreover, the Benjamini–Hochberg FDR (False discovery rate) test, with a £ 0.05 significance level, was employed (Benjamini and Hochberg 1995). All significant changes with fold-change absolute values greater than or equal to 2.0 were selected for ontological analyses. The data obtained from these analyses have been deposited in the NCBI Gene Expression Omnibus and are accessible via GEO Series accession number GSE53392. The Functional Annotation Chart available through the Database for Annotation, Visualization and Integrated Discovery (DAVID) (http://david.abcc.ncifcrf.gov/) was used to analyze gene sets differentially expressed in IFN-g-treated myogenic cells relative to control culture for ontological terms. A common approach was to preselect differentially expressed genes based on differential fold-changes (absolute fold-change value at least 2.0) and/or the P value (P £ 0.05) threshold and to identify the statistically enriched GO groups using Fisher’s exact test (P £ 0.05). All genes significantly altered in the analyses presented herein were analyzed using commercial Pathway Studio software (Agilent).

Results Myogenic cell characteristics Exogenous IFN-g at 1 ng/mL did not affect the respiration of proliferating C2C12 myoblasts, as demonstrated using the MTT test, and slightly but significantly increased the DNA content, as assessed using the CV test (14%, P = 0.012, Fig. 1a). However, this cytokine slightly decreased cell viability in C2C12 cultures on the third day of differentiation (9%,

GRZELKOWSKA-KOWALCZYK ET AL.

P = 0.021, for MTT test and by 8.5%, P = 0.041 for DNA content, Fig. 1b). The fusion index on the third day of differentiation slightly decreased under IFN-g treatment (13%, P = 0.046, Fig. 1c). IFN-g did not alter the cellular level of actin in differentiating myocytes; however, the myosin heavy chain (MyHC) content was decreased (19%, P = 0.0002, Fig. 1d).

Transcriptional profile analysis Fold-change analysis followed by Student’s t-test and Benjamini–Hochberg FDR correction was used to identify 727 transcripts that were significantly altered by IFN-g, with fold-change absolute values greater than or equal to 2.0. IFN-g upregulated 515 transcripts, whereas 212 transcripts were downregulated. The significantly regulated genes were sorted through ontology using the DAVID Functional Annotation Chart. The ontological analysis revealed distinct differences in the molecular signatures of the differentially regulated genes between control and IFN-g-treated cell cultures. A total of 381 upregulated and 175 downregulated genes were annotated for Mus musculus. The most significant pathway in which the genes upregulated through IFN-g were involved was the immune response (n = 71, GO:0006955, P = 5.03E-35). This result was not unexpected, and further presentation and discussion of the results is focused on other pathways enriched in IFN-g-regulated genes associated with, broadly speaking, myogenic differentiation. The analysis of other upregulated genes revealed their involvement in biological processes, such as the cell cycle (GO:0007049, P = 4.31E-02), regulation of cell proliferation (GO:0042127, P = 1.22E-02), programmed cell death

FIG. 1. The characteristics of the C2C12 myogenic cells used in the study. Cell respiration (MTT assay) and DNA content (crystal violet test) in mouse C2C12 myogenic cells exposed to IFN-g (1 ng/mL) during 24 h of proliferation (a) and 3 days of differentiation (b). The results represent the means – SE, with n = 12/treatment condition. (c) Representative phase-contrast images (magnification · 100) of C2C12 myogenic cells on the third day of differentiation in the absence (Ctrl) and presence of IFN-g. The fusion index values represent the means – SE, with n = 10/treatment condition. (d) Cellular content of actin and myosin heavy chain (MyHC) in mouse C2C12 myogenic cells subjected to 3-day differentiation in the presence of IFN-g. The blots are representative of 3 separate experiments performed in triplicate. The results represent the means – SE, with n = 9/treatment condition. *Significantly different versus appropriate control value (P < 0.05).

IFN-c AFFECTS THE MYOBLAST TRANSCRIPTOME

(GO:0012501, P = 1.10E-02), inflammatory response (GO:000 6954, p = 7.38E-04), vasculature development (GO:0001944, P = 4.03E-02), regulation of cytokine production (GO:000 1817, P = 9.86E-03), transmembrane receptor protein tyrosine kinase signaling pathways (GO:0007169, P = 2.47E-02), and chemotaxis (GO:0006935, P = 7.13E-03) (Fig. 2). The analysis of the downregulated genes revealed their involvement in biological processes such as the regulation of transcription (GO:0045449, P = 1.38E-02), cell–cell signaling (GO:0007267, P = 6.50E-03), nitrogen compound biosynthesis (GO:0044271, P = 8.05E-03), transmembrane receptor protein ser/thr protein kinase signaling pathways (GO:0007178, P = 2.14E-02), and regulation of the Wnt receptor signaling pathway (GO:0030111, P = 3.52E-02). The genes upregulated by IFN-g were primarily associated with the extracellular region (GO:0005576, P = 1.74E-05), plasma membrane part (GO:0044459, P = 5.09E-04), condensed chromosome (GO:0000793, P = 4.35E-03), and proteasome complex (GO:0000502, P = 1.83E-02), whereas the downregulated genes were associated with the cytoskeleton (GO:0005856, P = 4.52E-04) and sarcolemma (GO:0042383, P = 3.96E-03) (Fig. 3). IFN-g-upregulated genes were mainly involved in purine nucleotide binding (GO:0017076, P = 8.53E-07), peptidase activity (GO:0008283, P = 4.93E-02), cytokine activity (GO:0005125, P = 7.54E-03), and growth factor activity (GO:0008083, P = 3.12E-02), whereas genes associated with calcium ion binding (GO:0005509, P = 4.49E-02) were downregulated (Fig. 4).

IFN-c-regulated genes in differentiating myogenic cells Cytokine/growth factor expression and signaling. Treatment of C2C12 myoblasts with IFN-g during the early stages of differentiation resulted in the marked upregulation of genes encoding cytokines (Table 2) and growth factors (Table 3).

FIG. 2. Gene ontology groups–biological processes enriched in the differentially expressed genes in mouse C2C12 myogenic cells exposed to IFN-g for 3 days. The analysis was performed using a Functional Annotation Chart (DAVID). The results were sorted based on the P value (cutoff £ 0.05) and the number of genes involved in each biological process. The absolute fold-change cutoff was set at 2.0.

5

FIG. 3. Gene ontology groups–cellular components enriched in the differentially expressed genes in mouse C2C12 myogenic cells exposed to IFN-g for 3 days. The analysis was performed using a Functional Annotation Chart (DAVID). The results were sorted based on the P value (cutoff £ 0.05) and the number of genes involved in each group. The absolute fold-change cutoff was set at 2.0.

Some of the genes assigned to the categories mentioned above (Cxcl10, Il15, Ccl2, Fgf7, Figf, Csf1, Vegfc, and Tgfb1) were involved in chemotaxis, the inflammatory response and the regulation of cell proliferation (Fig. 2). Peptidase activity. The proteasome system is an important mechanism for the maintenance of cellular homeostasis during differentiation and the remodeling of skeletal muscle (Pizon and others 2013). The exposure of differentiating myoblasts to IFN-g resulted in the upregulation of genes associated with cellular proteolytic pathways (Table 4), including marked increases in the expression levels of Psmb8, Psmb9, Usp18, Psmb10, and Psme2, which are assigned to the proteasome complex, and CtsS. Moreover, in C2C12 cells treated with IFN-g, stimulation of the expression of the apoptosis-associated Casp1, Casp7, and Casp8 genes was observed.

FIG. 4. Gene ontology groups–molecular function enriched in the differentially expressed genes in mouse C2C12 myogenic cells exposed to IFN-g for 3 days. The analysis was performed using a Functional Annotation Chart (DAVID). The results were sorted based on the P value (cutoff £ 0.05) and the number of genes involved in each group. The absolute fold-change cutoff was set at 2.0.

6

GRZELKOWSKA-KOWALCZYK ET AL.

Table 2.

IFN-g-Regulated Genes Associated with Cytokine Activity (Biological Processes GO:0005125)

No

Fold-change

Gene ID

Description

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12.

67.9 25.6 15.46 12.42 9.82 6.68 5.37 4.35 3.34 3.09 2.27 2.04

Cxcl10 Cxcl9 Cxcl5 Ccl8 Cxcl1 Il15 Ccl7 Ccl2 Spp1 Cxcl16 Ccl9 Csf1

Chemokine (C-X-C motif) ligand 10, mRNA [NM_021274] Chemokine (C-X-C motif) ligand 9, mRNA [NM_008599] Chemokine (C-X-C motif) ligand 5, mRNA [NM_009141] Chemokine (C-C motif) ligand 8, mRNA [NM_021443] Chemokine (C-X-C motif) ligand 1, mRNA [NM_008176] Interleukin 15, mRNA [NM_008357] Chemokine (C-C motif) ligand 7, mRNA [NM_013654] Chemokine (C-C motif) ligand 2, mRNA [NM_011333] Secreted phosphoprotein 1, transcript variant 5, mRNA [NM_001204233] Chemokine (C-X-C motif) ligand 16, mRNA [NM_023158] Chemokine (C-C motif) ligand 9, mRNA [NM_011338] Colony stimulating factor 1 (macrophage), transcript variant 1, mRNA [NM_007778]

The analysis was performed using a Functional Annotation Chart (DAVID). The absolute fold-change cutoff was set at 2.0, P value £ 0.05. IFN, interferon.

Cytoskeleton and sarcolemma. Adequate myoblast fusion requires the redistribution of cell membrane components and the reorganization of the cytoskeleton. IFN-g downregulated 19 genes associated with the cytoskeleton and 4 genes encoding components of the sarcolemma (Fig. 3). One of genes was a-sarcoglycan (dystrophin-associated glycoprotein), or Sgca (fold-change = - 2.01), which encodes a protein product that forms a complex on the sarcolemma surface (Anastasi and others 2004). Moreover, IFN-g decreased the expression of the cadherins Cdk20 (fold-change = - 3.73) and Cdk23 (foldchange = - 2.16); myosin heavy polypeptide 4, Myh4 (foldchange = - 2.64); mitofusin, Mfn2 (fold-change = - 2.64); and the L-type voltage-dependent calcium channel a1S subunit (fold-change = - 2.05).

Network analysis Gene Spring analysis software was used to analyze the microarray dataset in the context of the gene network in myogenesis. This network contains several highly connected nodes, and 10 of the most highly connected genes are listed in Table 5. Interestingly, only Stat1 and Gsk3b showed an absolute fold-change exceeding 2.0, whereas the majority of key genes were altered through IFN-g with absolute fold-change values below 2.0; therefore, these genes were not included in the DAVID analysis presented herein (Tables 2–4). The pro-

Table 3.

tein products of these highly connected genes serve as growth factors, cytokines, and signaling molecules, such as membrane receptors, protein kinases, and transcription factors.

Validation of microarray data by quantitative real-time PCR To validate the microarray data, we randomly selected 5 genes significantly regulated by IFN-g with an absolute fold-change of at least 2.0 (Table 6). Real-time PCR analysis showed expression pattern changes that were similar to those observed in the microarray analysis, confirming the upregulation of Tlr3, Irf7, Hgf, and Fgf7 and the downregulation of Tgfb2. Interestingly, these genes might play a role in IFN-g-regulated initiation of differentiation, as their expression did not significantly change in proliferating myoblasts exposed to this cytokine (Table 6).

Wound healing and cell migration IFN-g increased the migration of C2C12 myogenic cells subjected to 3-day differentiation (Fig. 5). A marked cytokine-dependent enhancement in migratory ability was observed at 6 and 12 h of wound healing (100%, P = 0.0008 and 42%, P = 0.001, above the control value at 6 and 12 h, respectively).

IFN-g-Regulated Genes Associated with Growth Factor Activity (Biological Processes GO:0008083)

No

Fold-change

Gene ID

Description

1. 2. 3. 4. 5. 6. 7. 8. 9.

9.82 4.84 3.29 2.66 2.46 2.04 2.01 2.00 - 3.09

Cxcl1 Nov Hgf Fgf7 Figf Csf1 Vegfc Ctgf Tgfb2

Chemokine (C-X-C motif) ligand 1, mRNA [NM_008176] Nephroblastoma overexpressed gene, mRNA [NM_010930] Hepatocyte growth factor, mRNA [NM_010427] Fibroblast growth factor 7 (, mRNA [NM_008008] C-fos induced growth factor, mRNA [NM_010216] Colony stimulating factor 1 (macrophage), transcript variant 1, mRNA [NM_007778] Vascular endothelial growth factor C, mRNA [NM_009506] Connective tissue growth factor, mRNA [NM_010217] Transforming growth factor, beta 2, mRNA [NM_009367]

The analysis was performed using a Functional Annotation Chart (DAVID). The absolute fold-change cutoff was set at 2.0, P value £ 0.05.

IFN-c AFFECTS THE MYOBLAST TRANSCRIPTOME

7

Table 4. IFN-g-Regulated Genes Associated with Peptidase Activity (Molecular Function GO:0008233) FoldNo change Gene ID 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 14. 15. 16. 17. 18. 19. 20.

31.33 27.28 19.75 20.90 15.25 14.73 12.78 12.41 9.98 6.29 4.81 3.43 3.11 2.93 2.58 2.41 2.36 2.18 2.04

Psmb8 Psmb9 Usp18 Ctss CfB C1s Erap1 Gm5077 C1ra Psmb10 Casp1 Casp7 Psme2 C1rb Naalad2 Cops5 Lap3 Casp8 Plat

Description Proteasome subunit, beta type 8 (large multifunctional peptidase 7) mRNA [NM_010724] Proteasome subunit, beta type 9 (large multifunctional peptidase 2) mRNA [NM_013585] Ubiquitin-specific peptidase 18 mRNA [NM_011909] Cathepsin S mRNA [NM_021281] Complement factor B transcript variant 1 mRNA [NM_008198] Complement component 1, s subcomponent transcript variant 1, mRNA [NM_144938] Endoplasmic reticulum aminopeptidase 1 mRNA [NM_030711] Predicted gene 5077 mRNA [NM_173864] Complement component 1, r subcomponent A mRNA [NM_023143] Proteasome subunit, beta type 10 mRNA [NM_013640] Caspase 1 mRNA [NM_009807] Caspase 7 mRNA [NM_007611] Proteasome 28 subunit, beta transcript variant 1, mRNA [NM_011190] Complement component 1, r subcomponent B mRNA [NM_001113356] N-acetylated alpha-linked acidic dipeptidase 2 mRNA [NM_028279] Constitutive photomorphogenic homolog, subunit 5 (Arabidopsis thaliana) mRNA [NM_013715] Leucine aminopeptidase 3 mRNA [NM_024434] Caspase 8 transcript variant 1, mRNA [NM_009812] Plasminogen activator, tissue mRNA [NM_008872]

The analysis was performed using a Functional Annotation Chart (DAVID). The absolute fold-change cutoff was set at 2.0, value £ 0.05.

Discussion IFN-g has been implicated in muscle wasting and hypercatabolism, but the evidence supporting this claim is primarily indirect (Madihally and others 2002). However, the role of the inflammatory cytokines TNF-a and IFN-g in skeletal muscle regeneration has recently become evident (Chen and others 2007; Cheng and others 2008). The data obtained from this study indicate that IFN-g has beneficial effects on myoblast proliferation, although it inhibits early myogenesis, manifested through a decrease in MyHC protein content in mouse C2C12 myogenic cells. Regarding the rather slight decrease in the fusion index under IFN-g treatment, a difference between control and cytokine-treated cells was observed on the third day of differentiation, that is, at the onset of fusion, and it is likely that this effect will become more evident in prolonged experiments. In a previous study concerning the potential IFN-g-IGF-I interaction in myogenesis, IFN-g did not modify myoblast fusion on the third day; however, a significant decrease in the fusion index

on the fifth day of differentiation and inhibition of MyoD and myogenin were observed (Wieteska-Skrzeczyn´ska and others 2011b). Herein, we report that IFN-g affects several pathways involved in the regulation of myogenesis, particularly during the switch between proliferation and differentiation, which is important for determining the number of myoblasts triggering the myogenic program.

Exogenous IFN-g increases the expression of genes encoding cytokines and growth factors associated with migration and proliferation IFN-g altered the expression of several genes exhibiting cytokine and growth factor activities (Tables 2 and 3). These cytokines, chemokines, and growth factors are positive regulators of proliferation and motility in several cell types, and a role for these factors in muscle cells has also been described. For example Cxcl10 (also named IP-10), an IFNg-inducible 10-kDa protein, showed elevated expression

Table 5. The List of the Most Highly Connected Genes Differentially Expressed in Mouse C2C12 Myogenic Cell Subjected to 3-Day Differentiation in the Presence of IFN-g (P value £ 0.05) No Upregulated 1. 2. 3. 4. 5. 6. 7. Downregulated 8. 9. 10.

Fold-change

Gene ID

Description

34.2 1.72 1.70 1.64 1.57 1.41 1.33

Stat1 Fas Ctnnb1 NfkB1 Il10 Tnf Ppar-g

Signal transducer and activator of transcription 1 Fas (TNF receptor superfamily member 6) Catenin (cadherin associated protein), beta 1 Nuclear factor of kappa light polypeptide 1 Interleukin 10 Tumor necrosis factor Peroxisome proliferator activated receptor gamma

- 1.61 - 1.84 - 2.28

Igf1 Jun Gsk3b

Insulin-like growth factor 1 Jun oncogene Glycogen synthase kinase 3 beta

8

GRZELKOWSKA-KOWALCZYK ET AL.

Table 6. The Expression of Randomly Selected Genes Assessed by Real-Time qPCR in Mouse C2C12 Myogenic Cells Treated with IFN-g (1 ng/ml) During Proliferation (‘‘Prolif.’’) and Differentiation (‘‘Diff.’’). the Expression Changes are Shown as Relative Up- or Downregulation Normalized by 2 Internal Reference Genes (18S rRNA and Rpl13a) Gene name

Real-time qPCR prolif.

cDNA microarray diff.

Real-time qPCR diff.

Irf7 Tlr3 Hgf Fgf7 Tgfb2

1.38 – 0.24 1.24 – 0.17 1.22 – 0.15 0.99 – 0.11 1.06 – 0.03

9.76 7.03 3.29 2.66 - 3.09

57.22 – 0.72a 3.93 – 0.27a 4.72 – 0.34a 3.70 – 0.22a 0.38 – 0.04a

The data from 3 separate experiments were used to calculate the means – SE. a Significantly different versus appropriate control value (P < 0.001). qPCR, quantitative polymerase chain reaction.

(*68-fold) under cytokine treatment (Table 2). Recently, the enhanced expression of Cxcl10, mediated through Stat1 and NfkB pathways, has been described in human fetal skeletal muscle cells stimulated with IFN-g and TNF-a (Crescioli and others 2012). The results of this study are consistent with the observations of Ge and others (2013), who reported the expression of Cxcl9 and Cxcl10 in differentiating C2C12 myoblasts. Interestingly, these 2 chemokines play opposing roles in the regulation of myogenesis: Cxcl9 is required for the initiation of differentiation, whereas Cxcl10 inhibits this process. The pro-myogenic role of Ccl8 and antimyogenic role of Ccl9 were also described in the same study (Ge and others 2013). Both factors were upregulated in the present study (Table 2), suggesting the redundancy and antagonism of chemokines involved in the regulation of muscle cell differentiation. IFN-g-treated myogenic cells manifested increased migratory ability (Fig. 5), consistent with the enhanced expression of genes involved in the reg-

FIG. 5. Wound-healing assay using mouse C2C12 myogenic cells subjected to 3-day differentiation in the absence (Ctrl) or presence of IFN-g (1 ng/mL). (a) Representative images of cell migration at 0, 6, and 12 h after mechanical wounding using a sterile 100-mL pipette tip are shown. The arrows indicate the initial wound edges (0 h). (b) The results are shown as the percentage of wound healing measured for the indicated times and represent the means, with n = 9/treatment condition. *Significantly different versus the control value at the same time point (P < 0.05).

ulation of cell motility. Moreover, IFN-g significantly upregulated the expression of Csf1, Spp1, and HGF, resembling the effect of proinflammatory cytokines during the early stages of muscle regeneration in response to injury (Uaesoontrachoon and others 2008; Hara and others 2011; Toth and others 2012).

Exogenous IFN-c decreases the expression of genes associated with myotube differentiation and growth The TGF-b superfamily comprises proteins generally considered as negative regulators of myogenic differentiation (Schabort and others 2009), and these proteins show elevated expression in catabolic states (Wieteska-Skrzeczyn´ska and others 2009; Lokireddy and others 2012). However, Henningsen and others (2010) recently demonstrated a marked increase in the secretion of TGF-b1, -b2, and -b3 during myogenesis, consistent with a previous study describing strong TGF-b2 immunoreactivity in fusing satellite cells and newly formed myotubes (McLennan and Koishi 1997). In this study, TGF-b2 expression was downregulated by IFN-g (Table 3), likely contributing to the cytokine-mediated impairment of myogenesis. The network analysis revealed alterations in several highly connected genes in myocytes treated with IFN-g. The effect of this cytokine on these genes was rather moderate (the absolute fold-change value did not reach 2.0); however, considering the biological significance of their protein products in numerous biological processes, the observed expression modification might contribute to the impairment of myogenesis. Tnf was one of the most highly connected genes altered by IFN-g treatment. These results suggested that the numerous effects of IFN-g could occur through TNF activation. Nevertheless, although this hypothesis requires further study, this idea is consistent with the observations of de Rossi and others (2000), who showed that TNF-a is expressed in myoblasts exclusively after treatment with proinflammatory cytokines. These results indicate the contribution of myoblasts in the crosstalk

IFN-c AFFECTS THE MYOBLAST TRANSCRIPTOME

9

FIG. 6. Proposed schematic representation of the effect of IFN-g on myogenic cells. The schema was designed on the basis of the network of interactions of key genes modified by IFN-g and the contribution of these genes to biological processes in skeletal muscle cells. To simplify the picture, the reciprocal interactions among particular genes were omitted. The gene symbols in bold indicate the differentially expressed genes with an absolute fold-change of at least 2.0. The red color indicates IFN-g-mediated upregulation, while the blue color indicates downregulation./, activation, x, inhibition. The solid lines indicate stimulation, and the dashed lines indicate impaired stimulation. The gray arrows indicate total stimulation or impairment of particular processes resulting from gene regulation and the activity of upstream pathways. between inflammatory cells that infiltrate muscle tissue, leading to chronic inflammation. Several studies have reported the inhibition of the myogenic effect of IGF-I through proinflammatory cytokines (O’Connor and others 2008; Wieteska-Skrzeczyn´ska and others 2011b), whereas other studies have provided contrary evidence, that is, synergism with the IGF-I system in controlling myoblast number and differentiation (Al-Shanti and others 2008) or increasing growth factor bioavailability (Grabiec and others 2013). Based on the results obtained from this study, IFN-g moderately but significantly decreased Igf1 expression (Table 5) in differentiating myogenic cells, indicating that cytokine-growth factor interactions control myogenesis at the transcriptional level. Nuclear factor-kB (upregulated by IFN-g, Table 5) is a cellular mediator that activates the transcription of several targets, such as IL-6, TNF-a, and Ccl2, leading to enhanced inflammation (Shoelson and others 2007). A negative role for NF-kB in myogenesis has previously been described using both in vivo and in vitro models (Wang and others 2007; Bakkar and others 2008). The inhibition of myogenesis in the presence of IFN-g could be manifested through the increased expression of PPARg, a transcription factor that regulates adipogenesis (Table 5). Indeed, the inflammatory microenvironment impairs skeletal muscle development through the inhibition of stem cell differentiation into myocytes, promoting the differentiation of these cells into adipocytes (reviewed in Du and others 2010). Interestingly, the expression of Ctnnb1, b-catenin 1 subunit, was slightly but significantly elevated in myocytes treated with IFN-g (Table 5), and this observation is in apparent discrepancy with several studies indicating that the Wnt/b-catenin pathway is essential for early myogenesis (reviewed in Du and others 2010). Notably, (1) the canonical Wnt signaling pathway was, indeed, downregulated in this

study (Fig. 2), and (2) the pro-myogenic action of b-catenin requires binding to the TCF/LEF transcription factor (Tong and others 2009), indicating post-transcriptional regulation. Therefore, it is likely that the IFN-g-dependent enhanced expression of b-catenin observed in this study contributes to increased myogenic cell proliferation (Fig. 1), consistent with the results of a previous study (Otto and others 2008). However, this increase is not sufficient to support myogenic differentiation, which is dependent on other signaling components associated with the Wnt pathway. One of these components, Gsk3b (Table 5), plays a role in numerous cellular processes, including glycogen synthesis, protein synthesis, gene transcription (Henriksen 2010), and myogenesis (Mancinelli and others 2012). Kerkela and others (2008) showed that terminal cardiomyocyte differentiation was substantially suppressed in Gsk3b ( - / - ) embryoid bodies in mice. The combined treatment of C2C12 myotubes with TNF-a and IFN-g induced a reduction in GSK-3b phosphorylation, indicating the importance of this protein in transmitting the atrophy signal (Sheriff and others 2012). Based on these results, we concluded that IFN-g affects the expression of numerous genes associated with regulation of several processes in myogenesis (Fig. 6). The effects of IFN-g on cellular transcription include (1) alteration of cytokine/ growth factor expression, promoting cell proliferation and migration but inhibiting differentiation, (2) impairment of promyogenic transcription, (3) disruption of cell adhesion and sarcolemma/cytoskeleton organization, and (4) increased peptidase activity leading to enhanced proteolysis and apoptosis.

Acknowledgment This study was supported through funding from the Department of Physiological Sciences, Faculty of Veterinary Medicine, Warsaw University of Life Sciences (SGGW).

10

Author Disclosure Statement The authors K. Grzelkowska-Kowalczyk, Z. Wicik, A. Majewska, J. Tokarska, K. Grabiec, M. Koz1owski, M. Milewska, and M. B1aszczyk declare that no competing financial interests exist.

References Acharyya S, Ladner KJ, Nelsen LL, Damrauer J, Reiser PJ, Swoap S, Guttridge DC. 2004. Cancer cachexia is regulated by selective targeting of skeletal muscle gene products. J Clin Invest 114:370–378. Al-Shanti N, Saini A, Faulkner SH, Stewart CE. 2008. Beneficial synergistic interactions of TNF-alpha and IL-6 in C2 skeletal myoblasts–potential cross-talk with IGF system. Growth Factors 26:61–73. Alvarez B, Quinn LS, Busquets S, Lopez-Soriano FJ, Argiles JM. 2002. TNF-alpha modulates cytokine and cytokine receptors in C2C12 myotubes. Cancer Lett 175:181–185. Anastasi G, Cutroneo G, Rizzo G, Arco A, Santoro G, Bramanti P, Vitetta AG, Pisani A, Trimarchi F, Favaloro A. 2004. Sarcoglycan and integrin localization in normal human skeletal muscle: a confocal laser scanning microscope study. Eur J Histochem 48:245–252. Bakkar N, Wang J, Ladner KJ, Wang H, Dahlman JM, Carathers M, Acharyya S, Rudnicki MA, Hollenbach AD, Guttridge DC. 2008. IKK/NFkappaB regulates skeletal myogenesis via a signaling switch to inhibit differentiation and promote mitochondrial biogenesis. J Cell Biol 180:787–802. Benjamini Y, Hochberg Y. 1995. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J Roy Statist Soc Ser B (Methodological) 57:289–300. Charge SB, Rudnicki MA. 2004. Cellular and molecular regulation of muscle regeneration. Physiol Rev 84:209–238. Chen SE, Jin B, Li YP. 2007. TNF-alpha regulates myogenesis and muscle regeneration by activating p38 MAPK. Am J Physiol Cell Physiol 292:C1660–C1671. Cheng M, Nguyen MH, Fantuzzi G, Koh TJ. 2008. Endogenous interferon-g is required for efficient skeletal muscle regeneration. Am J Physiol 294:1183–1191. Crescioli C, Sottili M, Bonini P, Cosmi L, Chiarugi P, Romagnani P, Vannelli GB, Coletti M, Isidori AM, Serio M, Lenzi A, Di Luigi L. 2012. Inflammatory response in human skeletal muscle cells: CXCL10 as a potential therapeutic target. Eur J Cell Biol 91:139–149. Dedieu S, Maze`res G, Cottin P, Brustis JJ. 2002. Involvement of myogenic regulator factors during fusion in the cell line C2C12. Int J Dev Biol 46:235–241. De Falco M, De Luca A. 2006. Involvement of cdks and cyclins in muscle differentiation. Eur J Histochem 50:19–24. De Rossi M, Bernasconi P, Baggi F, de Waal Malefyt R, Mantegazza R. 2000. Cytokines and chemokines are both expressed by human myoblasts: possible relevance for the immune pathogenesis of muscle inflammation. Int Immunol 12:1329–1335. Du M, Yan X, Tong JF, Zhao J, Zhu MJ. 2010. Maternal obesity, inflammation, and skeletal muscle development. Biol Reprod 82:4–12. Foster W, Li Y, Usas A, Somogyi G, Huard J. 2003. Gamma interferon as an antifibrosis agent in skeletal muscle. J Orthop Res 21:798–804. Ge Y, Waldemer RJ, Nalluri R, Nuzzi PD, Chen J. 2013. RNAi screen reveals potentially novel role of cytokines in myoblast differentiation. PLoS One 8(7):e68068.

GRZELKOWSKA-KOWALCZYK ET AL.

Grabiec K, Tokarska J, Milewska M, B1aszczyk M, Gajewska M, Grzelkowska-Kowalczyk K. 2013. Interleukin-1ß stimulates early myogenesis of mouse C2C12 myoblasts: the impact on myogenic regulatory factors, extracellular matrix components, IGF binding proteins and protein kinases. Pol J Vet Sci 16:255–264. Griffin CA, Apponi LH, Long KK, Pavlath GK. 2010. Chemokine expression and control of muscle cell migration during myogenesis J Cell Sci 123:3052–3060. Grzelkowska-Kowalczyk K, Wieteska-Skrzeczyn´ska W. 2010a. Treatment with IFN-g prevents insulin-dependent PKB, p70S6k phosphorylation and protein synthesis in C2C12 myogenic cells. Cell Biol Int 34:117–124. Grzelkowska-Kowalczyk K, Wieteska-Skrzeczyn´ska W. 2010b. Treatment with TNF-a and IFN-g alters the activation of Ser/Thr protein kinases and the metabolic response to IGF-I in mouse C2C12 myogenic cells. Cell Mol Biol Lett 15:13–31. Hara M, Yuasa S, Shimoji K, Onizuka T, Hayashiji N, Ohno Y, Arai T, Hattori F, Kaneda R, Kimura K, Makino S, Sano M, Fukuda K. 2011. G-CSF influences mouse skeletal muscle development and regeneration by stimulating myoblast proliferation J Exp Med 208:715–727. Harfouche R, Hussain SN. 2006. Signaling and regulation of endothelial cell survival by angiopoietin-2. Am J Physiol Heart Circ Physiol 291:H1635–H1645. Hayashi H, Kohno T, Yasui K, Mukota H, Kimura T, Duncan GS, Nakashima T, Yamamoto K, Katayama I, Ma Y, Chua KJ, Suematsu T, Shimokawa I, Akira S, Kubo Y, Mak TW, Matsuyama T. 2011. Characterization of dsRNA-induced pancreatitis model reveals there gulatory role of IFN regulatory factor 2 (Irf2) in trypsinogen5 gene transcription. Proc Natl Acad Sci U S A 108:18766–18771. Henningsen J, Rigbolt KT, Blagoev B, Pedersen BK, Kratchmarova I. 2010. Dynamics of the skeletal muscle secretome during muscle differentiation. Mol Cell Proteom 9:2482–2496. Henriksen EJ. 2010. Dysregulation of glycogen synthase kinase-3 in skeletal muscle and the etiology of insulin resistance and type 2 diabetes. Curr Diabetes Rev 6:285–293. Hwa V, Little B, Kofoed EM, Rosenfeld RG. 2004. Transcriptional regulation of insulin-like growth factor-I by interferon-g requires STAT-5b. J Biol Chem 279:2728–2736. Janeke G, Siefken W, Carstensen S, Springmann G, Bleck O, Steinhart H, Hoger P, Wittern KP, Wenck H, Stab F, Sauermann G, Schreiner V, Doering T. 2003. Role of taurine accumulation in keratinocyte hydration. J Invest Dermatol 121:354–361. Kerkela R, Kockeritz L, Macaulay K, Zhou J, Doble BW, Beahm C, Greytak S, Woulfe K, Trivedi CM, Woodgett JR, Epstein JA, Force T, Huggins GS. 2008. Deletion of GSK-3beta in mice leads to hypertrophic cardiomyopathy secondary to cardiomyoblast hyperproliferation. J Clin Invest 118:3609–3618. Khorooshi R, Owens T. 2010. Injury-induced type I IFN signaling regulates inflammatory responses in the central nervous system. J Immunol 185:1258–1264. Livak KJ, Schmittgen TD. 2001. Analyzis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) method. Methods 25:402–408. Lokireddy S, Wijesoma IW, Bonala S, Wei M, Sze SK, McFarlane C, Kambadur R, Sharma M. 2012. Myostatin is a novel tumoral factor that induces cancer cachexia. Biochem J 446:23–36. Madihally SV, Toner M, Yarmush ML, Mitchell RN. 2002. Interferon gamma modulates trauma-induced muscle wasting and immune dysfunction. Ann Surg 236:649–657.

IFN-c AFFECTS THE MYOBLAST TRANSCRIPTOME

Mancinelli R, Pietrangelo T, Burnstock G, Fano G, Fulle S. 2012. Transcriptional profile of GTP-mediated differentiation of C2C12 skeletal muscle cells. Purinergic Signal 8:207–221. McLennan IS, Koishi K. 1997. Cellular localisation of transforming growth factor-beta2 and -beta 3 (Tgf-b2, Tgf-b3) in damaged and regenerating skeletal muscles. Dev Dyn 208: 278–289. O’Connor JC, McCusker RH, Strle K, Johnson RW, Dantzer R, Kelley KW. 2008. Regulation of IGF-I function by proinflammatory cytokines: at the interface of immunology and endocrinology. Cell Immunol 252:91–110. Osses N, Casar JC, Brandan E. 2009. Inhibition of extracellular matrix assembly induces the expression of osteogenic markers in skeletal muscle cells by a BMP-2 independent mechanism. BMC Cell Biol 10:73. Otto A, Schmidt C, Luke G, Allen S, Valasek P, Muntoni F, Lawrence-Watt D, Patel K. 2008. Canonical Wnt signalling induces satellite-cell proliferation during adult skeletal muscle regeneration. J Cell Sci 121:2939–2950. Pizon V, Rybina S, Gerbal F, Delort F, Vicart P, Baldacci G, Karsenti E. 2013. MURF2B, a novel LC3-binding protein, participates with MURF2A in the switch between autophagy and ubiquitin proteasome system during differentiation of C2C12 muscle cells. PLoS One 8:e76140. Schabort EJ, van der Merwe M, Loos B, Moore FP, Niesler CU. 2009. TGF-beta delay skeletal muscle progenitor cell differentiation in an isoform-independent manner. Exp Cell Res 315:373–384. Sheriff S, Kadeer N, Joshi R, Friend LA, James JH, Balasubramaniam A. 2012. Des-acyl ghrelin exhibits pro-anabolic and anti-catabolic effects on C2C12 myotubes exposed to cytokines and reduces burn-induced muscle proteolysis in rats. Mol Cell Endocrinol 351:286–295. Shoelson SE, Herrero L, Naaz A. 2007. Obesity, inflammation, and insulin resistance. Gastroenterology 13:2169–2180. Smith MA, Moylan JS, Smith JD, Li W, Reid MB. 2007. IFNgamma does not mimic the catabolic effects of TNF-alpha. Am J Physiol Cell Physiol 293:C1947–C1952. Tolosa L, Morla M, Iglesias A, Busquets X, Llado J, Olmos G. 2005. IFN-gamma prevents TNF-alpha-induced apoptosis in C2C12 myotubes through down-regulation of TNF-R2 and increased NF-kappaB activity. Cell Signal 17:1333–1342. Tomczak KK, Marinescu VD, Ranomi MF, Sanoudou D, Montanaro F, Han M, Kunkel LM, Kohane IS, Beggs AH. 2004. Expression profiling and identification of novel genes involved in myogenic differentiation. FASEB J 18:403–405. Tong JF, Yang X, Zhu MJ, Ford SP, Nathanielsz PW, Du M. 2009. Maternal obesity downregulates myogenesis and bcatenin signaling in fetal skeletal muscle. Am J Physiol Endocrinol Metab 296:E917–E924. Toth KG, McKay BR, De Lisio M, Little JP, Tarnopolsky MA, Parise G. 2012. IL-6 induced STAT3 signalling is associated with the proliferation of human muscle satellite cells following acute muscle damage. PLoS One 6:e17392.

11

Uaesoontrachoon K, Yoo HJ, Tudor EM, Pike RN, Mackie EJ, Pagel CN. 2008. Osteopontin and skeletal muscle myoblasts: association with muscle regeneration and regulation of myoblast function in vitro. Int J Biochem Cell Biol 40:2303–2314. Wang H, Hertlein E, Bakkar N, Sun H, Acharyya S, Wang J, Carathers M, Davuluri R, Guttridge DC. 2007. NF-kappaB regulation of YY1 inhibits skeletal myogenesis through transcriptional silencing of myofibrillar genes. Mol Cell Biol 27:4374–4387. Wesemann DR, Benveniste EN. 2003. Stat-1 alpha and IFNgamma as modulators of TNF-alpha signaling in macrophages: regulation of functional implications of the TNF receptor 1:Stat-1 alpha complex. J Immunol 171:5313–5319. Wieteska-Skrzeczyn´ska W, Grzelkowska-Kowalczyk K, Jank M, Maciejewski H. 2009. Transcriptional dysregulation of skeletal muscle protein metabolism in streptozotocin-diabetic mice. J Physiol Pharmacol 60 (Suppl. 1):19–36. Wieteska-Skrzeczyn´ska W, Grzelkowska-Kowalczyk K, Rejmak E. 2011a. Growth factor and cytokine interactions in myogenesis. Part II. Expression of IGF binding proteins and protein kinases essential for myogenesis in mouse C2C12 myogenic cells exposed to TNF-a and IFN-g. Pol J Vet Sci 14:425–431. Wieteska-Skrzeczyn´ska W, Grzelkowska-Kowalczyk K, Tokarska J, Grabiec K. 2011b. Growth factor and cytokine interactions in myogenesis. Part I. The effect of TNF-a and IFN-g on IGF-I-dependent differentiation in mouse C2C12 myogenic cells. Pol J Vet Sci 14:417–424. Wolf LV, Yang Y, Wang J, Xie Q, Braunger B, Tamm ER, Zavadil J, Cvekl A. 2009. Identification of Pax-6-dependent gene regulatory networks in the mouse lens. PLoS One 4:e4159. Wynes MW, Riches DW. 2003. Induction of macrofage insulinlike growth factor-I expression by the Th2 cytokines IL-4 and IL-13. J Immunol 171:3550–3559. Zhang X. 2010. Hepatocyte growth factor system in the mouse uterus: variation across the estrous cycle and regulation by 17beta-estradiol and progesterone. Biol Reprod 82:1037–1048. Yogev O, Williams VC, Hinits Y, Hughes SM. 2013. eIF4EBP3L acts as a gatekeeper of TORC1 in activity-dependent muscle growth by specifically regulating Mef2ca translational initiation. PLoS Biol 11:e1001679.

Address correspondence to: Dr. Katarzyna Grzelkowska-Kowalczyk Department of Physiological Sciences Faculty of Veterinary Medicine Warsaw University of Life Sciences (SGGW) Nowoursynowska 159 Warsaw 02-776 Poland E-mail: [email protected] Received 24 January 2014/Accepted 16 July 2014