Virus Research 190 (2014) 69–74

Contents lists available at ScienceDirect

Virus Research journal homepage: www.elsevier.com/locate/virusres

Transcriptional regulation of gene expression of infectious salmon anaemia virus segment 7 Rimatulhana B. Ramly, Christel M. Olsen, Stine Braaen, Elisabeth F. Hansen, Espen Rimstad ∗ Department of Food Safety and Infection Biology, Faculty of Veterinary Medicine and Biosciences, Norwegian University of Life Sciences (NMBU), P.O. Box 8146 Dep, 0033 Oslo, Norway

a r t i c l e

i n f o

Article history: Received 12 February 2014 Received in revised form 22 May 2014 Accepted 7 July 2014 Available online 16 July 2014 Keywords: Infectious salmon anaemia virus Gene expression of NS and NEP

a b s t r a c t The nuclear replication and gene splicing of orthomyxoviruses are unique among RNA viruses. Segment 7 of infectious salmon anaemia virus (ISAV) is the only segment that undergoes splicing. Two proteins are encoded by this segment, the non-structural antagonist (ISAV-NS) of the innate immune response that is translated from the unspliced collinear transcript, and a nuclear exporting protein (ISAV-NEP) that is translated from the spliced mRNA. Here we report the transcription profiles for these ISAV proteins. The appearance of the spliced ISAV-NEP mRNA was delayed and the relative amount was less but slowly accumulated to 20–30% to that of the collinear NS mRNA. In cells transfected with segment 7 the ratio between spliced and collinear mRNA was approximately 10%. A highly conserved, possible structured RNA, in the region of the 3 splicing site of the segment is speculated as being important for the regulation of the efficiency of the splicing. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Infectious salmon anaemia virus (ISAV) has a genome of eight single-stranded RNA molecules of negative polarity and is the type virus of the genus Isavirus in the family Orthomyxoviridae. It is the etiologic agent of infectious salmon anaemia (ISA) a disease that cause high mortality in aquaculture of Atlantic salmon (Salmo salar). The number of ISA outbreaks has been highly reduced due to improvements in hygienic and management measures. The transcription and replication of ISAV take place in the nucleus of the infected cell (Brinson et al., 2011; Sandvik et al., 2000), where the viral genomic-, complementary- and messenger RNAs are synthesized by the viral transcriptase complex. Like other orthomyxoviruses ISAV mRNAs have capped, heterogeneous 5 -ends and their synthesis is inhibited by ␣-amanitin, a specific inhibitor of the cellular RNA polymerase II due to the need of capped host nuclear RNAs as primers for mRNA synthesis (Sandvik et al., 2000). The nuclear replication requires nuclear export of viral mRNAs, and nuclear import of the viral proteins of the ribonucleoproteins (RNP), i.e. the nucleoprotein (NP) and the viral transcriptase complex, as well as of matrix protein (M), and finally nuclear export of the RNP–M complex. This transport must be temporally and

∗ Corresponding author. Tel.: +47 22964766. E-mail address: [email protected] (E. Rimstad). http://dx.doi.org/10.1016/j.virusres.2014.07.008 0168-1702/© 2014 Elsevier B.V. All rights reserved.

quantitatively well regulated and the nuclear exporting protein (NEP) has been shown to play a vital role in this matter for influenza virus (Boulo et al., 2007). An ISAV protein with properties comparative to those of NEP of influenza viruses is encoded by genomic segment 7 (Ramly et al., 2013), and this segment also encodes the non-structural (NS) protein of ISAV (Garcia-Rosado et al., 2008). ISAV-NS is encoded by a collinear mRNA transcript, whereas ISAVNEP is encoded by the only known spliced mRNA of ISAV (Biering et al., 2002; Kibenge et al., 2007; Mjaaland et al., 1997; Ritchie et al., 2002). The organization of the ISAV genomic segment 7 resembles that of the corresponding segment of the influenza viruses, where the interferon (IFN) antagonist NS1 and NEP are transcribed by the collinear and spliced transcripts, respectively. This indicates a remarkably conservation of gene organization between the piscine ISAV and the avian/mammalian influenza viruses. The 34 kDa ISAV-NS and the 17.5 kDa -NEP share the 22 Nterminal amino acids (Biering et al., 2002; Clouthier et al., 2002; Ritchie et al., 2002). The smaller ISAV-NEP contains leucine-rich nuclear export signals, got trapped in the nucleus when CRM-1 dependent nuclear export was inhibited with Leptomycin B, and found to interact with both NP and M (Rimatulhana et al., 2013). The ISAV-NS has antagonistic effect on transcription of IFN-type I and IFN-type I induced proteins, but does not have the RNA binding properties or the nuclear localization signals of the NS1 proteins of influenza viruses and it localizes mainly perinuclearly in the cytoplasm (Garcia-Rosado et al., 2008; McBeath et al.,

70

R.B. Ramly et al. / Virus Research 190 (2014) 69–74

2006). The influenza virus NS1 protein is a multifunctional protein (reviewed in (Hale et al., 2008). The level of the spliced mRNA that encodes NEP, of the influenza A virus has been estimated to be approximately 10–15% of that of unspliced NS1 transcripts (Lamb et al., 1980; Robb et al., 2010). Splicing of influenza virus mRNA is not dependent upon the presence of viral proteins from other genomic segments, indicating that the splicing is performed by the cellular splicing machinery in the nucleus (Lamb and Lai, 1984). The unspliced transcripts are not processed by the splicing machinery and the level of splicing of orthomyxoviral mRNAs must therefore be regulated. Results from early work indicated that the influenza NS1 protein regulated the production of spliced viral mRNA (Inglis and Brown, 1984; Smith and Inglis, 1985). This model was later modified when it was found that the influenza NS1 binds to a subunit of the cleavage and polyadenylation specificity factor (CPSF-30), which is part of the complex that cleaves off the poly-Asignalling region of the pre-mRNA 3 -ends. The NS1 of influenza A virus thus inhibits the CPSF complex from performing 3 -end cleavage and the un-cleaved cellular pre-mRNA remains in the nucleus. (Engelhardt and Fodor, 2006; Nemeroff et al., 1998). Consequently, the nuclear export of cellular mRNAs will be inhibited, but not that of viral mRNAs since the polyadenylation of viral mRNAs is carried out by the PB1 subunit of the viral transcriptase complex (Robertson et al., 1981; Zheng et al., 1999). Abolishing the influenza virus NS1 protein expression by insertion of a stop codon into the NS1 mRNA did not affect splicing, indicating that the NS1 protein does not regulate viral mRNA splicing (Robb et al., 2010). The secondary structure of the NS1 mRNA itself, including a highly conserved RNA pseudoknot structure that encompasses the 3 splice site of the NS1 mRNA in both influenza A and B viruses, has been suggested to be involved in the regulation of the splicing of the NS1 segment of the influenza viruses (Gultyaev and Olsthoorn, 2010). In this work we identified that the presence of the spliced mRNA transcript of the ISAV segment 7 was delayed relative to the collinear transcript, and that the amount of the spliced transcript was lower than the collinear fragment throughout the infection cycle. A hypothesis of a regulatory role of secondary RNA structure at the 3 splicing site is put forward.

2. Materials and methods 2.1. Cell lines and virus The Atlantic salmon kidney (ASK) cell line (Devold et al., 2000) was used to propagate ISAV isolate Glesvaer/2/90 at 15 ◦ C. The EPC cell line, which is of cyprinid origin, was used for transfection assays. Both cell lines were maintained in Leibovitz’s-15 (L-15, Gibco) medium supplemented with 2 mM l-glutamine, 0.04 mM ␤-mercaptoethanol, 0.05 mg/ml gentamycin-sulphate (Gibco) and 10% foetal calf serum (FCS, PAA Laboratories) for propagation of cells, while L-15 medium containing 2% FCS was used for virus production. For inoculation of cells with ISAV, viral supernatant containing 105.25 TCID50 /25 ␮l was used.

2.2. mRNA extraction and cDNA synthesis ASK cells (0.32 × 106 ) in 25 cm2 flasks were infected with 0.5 ml ISAV supernatant (MOI of 11) and incubated at 15 ◦ C. After one hour 4 ml L-15 media with 2% FCS was added to each flask. The mRNA was extracted at 0, 3, 6, 12, 24, 48 and 72 h post infection (hpi) using Micro-FastTrackTM 2.0 kit (Invitrogen) according to the manufacturer’s instructions. The purity and concentration of mRNA was determined spectrophotometrically (Nanodrop, Thermo Scientific). The cDNA was synthesized from 100 ng mRNA

Table 1 Oligonucleotide primers used for cloning of whole segment 7, mRNA for ISAV-NEP and RTqPCR for analyses of the relative amounts of spliced and unspliced mRNAs. Restriction enzyme sites are underlined. Primer name

Nucleotide sequence (5 –3 )

Eco-ISAVs7-F XhoI-ISAVs7-R GS7-F(AcGFP) GS72-R(AcGFP)

GCGAATTCAGCTAAGATTCTCCTTCTAC CTCGAGAGTAAAAATTCTCCTTTTCG GCCTCGAGCTATGGATTTCACCAAAGTGTAT (XhoI) GGCGGTACCTTAATTCTCATTACAAATGTATTTTTC (KpnI) GACGACGAACCTGACGAG CATTCCTGACCATCTCATTGTG ACTTCACGGAAAAGACAAGGTGGC TGATTGACAATGAACCCACTT TGCCCCTCCAGGATGTCTAC CACGGCCCACAGGTACTG AAGGAGAAGCTCTGCTATGTGGCT AAGGTGGTCTCATGGATACCGCAA

ISAV7NSF ISAV7NSR ISAV7NEPF ISAV7NEPR EF1aBFb EF1aBRb EPC␤-actinF: EPC␤-actinR: a b

Efficiencya

1.981 1.992 1.916

Efficiency, E = 10(−1/slope) . Olsvik et al. (2005).

using QuantiTect® Reverse Transcription kit (Qiagen), following the protocol recommended by the manufacturer. 2.3. Real-time quantitative polymerase chain reaction (RTqPCR) Elongation factor 1 alpha (EF1␣) was used as a reference gene to normalize the Ct values (Løvoll et al., 2011; Olsvik et al., 2005). The primers used are listed in Table 1. A volume of cDNA equivalent to 7.5 ng mRNA was used as template in RT qPCR using Brilliant II SYBR® Green QPCR Master Mix (Stratagene). Reactions were carried out in 25 ␮l volumes containing master mix, 3 ␮l cDNA, and 300 nM of each primer for the EF1␣ and NEP genes while for the NS gene 400 nM were used. The RTqPCR assays were performed in triplicates at the following conditions: 95 ◦ C/10 min, 40 cycles of 95 ◦ C/30 s, 60 ◦ C/60 s and 72 ◦ C/30 s. Data were captured using Stratagene MxPro Mx3000P QPCR software. Specificity of RTqPCR primers was confirmed by gel electrophoresis which resulted in a single product with the desired length (EF1␣, 57 bp; ISAV-NS: 129 bp; and ISAV-NEP, 125 bp). In addition, melting curve analysis resulted in single peak for each primer set. Ten-fold serial dilutions of cDNA from ISAV infected ASK cells, equivalent from 10 000 to 1 pg RNA, were made for efficiency (E) calculations according to the equation E = 10(−1/slope) . The transcript levels were normalized to EF1␣ expression. The CT values for ISAV-NS and -NEP transcripts were calculated for each DNA dilution and a plot of log cDNA dilution versus CT was made. The absolute value of the slope for both CT values was 0.02 (Livak and Schmittgen, 2001). 2.4. Cloning in eukaryotic expression vector, in vitro mutagenesis The segment 7 and the spliced NEP fragment of ISAV, the 5 donor splice site of the NS mRNA is at position 84 and the 3 acceptor splice site is at position 611; were individually cloned into the Eco RI/XhoI sites of the pcDNA3.1(+) (Invitrogen) vector. A construct in which the 5 - and 3 -UTRs of segment 7 were not included, but both reading frames, were also generated using the Kpn I/EcoR I sites. The clone pcDNA3.1-s7627A in which C627 (numbering according to GenBank ID HQ259677) was mutated to A627 , whereby a stop codon in the 5 part of the exon 2 of the NEP gene was introduced without changing amino acid sequence of ISAV-NS by site-directed mutagenesis using QuickChange XL Mutagenesis kit (Stratagene). Site-directed mutagenesis was also used to delete the region 542–551, i.e. in the predicted stable secondary RNA structure; the clone was called pcDNA3.1-s7542–551 . The empty EGFP-N1 (Invitrogen) was used as a control in co-transfections. Plasmids were purified using the QIAprep Spin

R.B. Ramly et al. / Virus Research 190 (2014) 69–74

71

Miniprep Kit (Qiagen) and the inserts were sequenced by Sanger sequencing (GATC-Biotech AG, Konstanz, Germany). 2.5. Cell transfection, total RNA extraction and Western blot A total of 4 × 106 EPC cells were transfected with 2 ␮g plasmids in each reaction by electroporation (Amaxa-T-20 program) using Ingenio transfection reagens (Mirus). In co-transfection experiments 0.5 ␮g of each plasmid was used per million cells. Cells were seeded in T-25 flasks and harvested at 24 h post transfection (hpt), lysed in QIAzol and kept at −80 ◦ C freezer before extraction with chloroform followed by total RNA extraction (RNeasy® Mini kit, Qiagen) with DNAse treatment on the column according to the manufacturer’s instructions. Transfected EPC cells for western blot (WB) were harvested 48 hpt. Cells were washed once with cold PBS and harvested by a rubber policeman before centrifugation at 249 × g for 5 min. The cell pellets were lyzed on ice in RIPA buffer (50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 0.5% dodecylcholate) for 30 min, followed by centrifugation at 1150 × g for 5 min. The supernatant were boiled in sample buffer with reducing agent (Biorad) and the proteins were separated by Criterion 12% Bis-Tris PreCast gel (Biorad) using MESrunning buffer. Proteins were electroblotted onto polyvinylidene difluoride (PVDF) membranes (Biorad), and subsequent incubated with PBS with 5% skimmed milk followed by overnight incubation at 8 ◦ C with anti-NS (Garcia-Rosado et al., 2008) and anti-NEP (Rimatulhana et al., 2013) in PBS with 1% skimmed milk. HRP-conjugated secondary antibodies and Amerham ECL Prime WB detection Reagent (GE healthcare) were used for detection and images were captured using Chemidoc XRS (Biorad). 2.6. mRNA structure Sequence data were obtained from the National Center for Biotechnology Information (NCBI). The GenBank IDs AF401077, AF401082, DQ785270, DQ785259, AY044132 and EF523765, that represent both European and American genogroups, were used. Multiple sequence alignments of protein sequences were performed in AlignX (Vector NTI AdvanceTM 11 Package). For prediction of RNA structures the minimum free energy structure algorithm program mFold version 2.3 was used, with default program parameters except temperature, which was set at 15 ◦ C (i.e. in the optimal temperature range of ISAV replication) (Zuker, 2003). For the prediction of potential pseudoknots the program KineFold was used (Xayaphoummine et al., 2005), and for potentially conserved structures the program RNAz predictions was run (Gruber et al., 2010). A positive-sense RNA orientation with a 100-nt window size, 10-nt step size, and with the RNAz program’s default filtering parameters was used. RNAz predicts a classification value, called p-class, to indicate the probability that a given RNA region contains a conserved structure based upon five criteria: minimum predicted free energy (MFE), Z-score (predicted minimum free energy of folding for a native sequence versus random sequence), structure conservation index, average pair wise sequence identity, and number of sequences in the alignment. For this study, RNAz predictions with a p-class of >0.5 were considered structured (Gruber et al., 2010).

Fig. 1. Relative amount of spliced (NEP) and collinear (NS) mRNA transcripts in ISAV infected ASK cells at 3, 6, 12, 24, 48 and 72 h post infection. The gene expression was normalized to salmon EF1␣. The figure shows results of one representative experiment (repeated 5 times).

examined by ten-fold serial dilutions of cDNA from ISAV infected ASK cells. All assays were found to be quantitative within the range demonstrating efficiencies close to 2 (Table 1). ASK cells kept at 15 ◦ C were infected with the Glesvaer strain of ISAV and mRNA was harvested at 0, 3, 6, 12, 24, 48 and 72 h post-infection (hpi). The collinear NS transcript could be detected by RTqPCR as early as 3 hpi, and the accumulated amount increased steadily during the period of sampling (Fig. 1). Detection of the spliced NEP transcript was delayed until 6 hpi with an increase appearing from 12 hpi and onwards. The relative amount of the spliced transcript was always lower than that of the collinear transcript. The ratio between spliced and collinear transcripts was approximately 2% at 6 hpi and gradually increased to 30% at 72 hpi. 3.2. Unspliced NS and spliced NEP mRNA in transfected cells To study if ISAV proteins other than NS and NEP could affect the ratio between spliced and unspliced viral mRNA, the ISAV segment 7 was cloned, i.e. pcDNA3.1-s7, and transfected in EPC cells. The carp cell line EPC was used due to much better transfection efficiency than in cell lines originating from Atlantic salmon. At 24 hpt the relative expression of NEP mRNA was 13% of that of NS mRNA (Fig. 2). Transfection of a pcDNA3.1-s7 construct where the 5 - and 3 -UTRs of segment 7 had been removed showed a ratio between NS and NEP mRNA of 10%, with a tendency of lower relative gene

3. Results 3.1. Unspliced NS and spliced NEP mRNA in ISAV infected cells To analyze the relative amounts of spliced and unspliced ISAV transcripts, mRNA was extracted by oligo(dT) affinity and primers were designed for detection of mRNA for NS and NEP. The efficiency of amplification of the target genes and internal control (EF1␣) was

Fig. 2. Gene expression analysis of NS and NEP transcripts at 24 h post transfection of EPC cells, normalized to carp ␤-actin. s7 = pcDNA3.1-s7; s7-UTR = pcDNA3.1-s7 where 5 - and 3 -UTR of segment 7 were removed, s7627A = pcDNA3.1-s7627A , and cotransfection of pcDNA3.1-s7627A with pcDNA3.1-NEP or pcDNA3.1-EGFP. Results are mean, ±SD, of three independent experiments.

72

R.B. Ramly et al. / Virus Research 190 (2014) 69–74

expression level of NS compared to pcDNA3.1-s7 transfected cells (Fig. 2). After transfection of the pcDNA3.1-s7627A construct, in which a stop codon for NEP was introduced shortly after the 3 acceptor splice site of mRNA, while at the same time keeping the amino acid sequence of NS unchanged, the ratio between the spliced and unspliced mRNAs was 8% (Fig. 2). To investigate the effect of NEP on the transcription of the NS gene of ISAV segment 7, EPC cells were co-transfected with pcDNA3.1-s7627A and pc-DNA3.1-NEP or pEGFP-N1, the latter as a control. At 24 hpt the relative gene expression of NS was reduced with 45% when NEP was delivered in trans, compared to cells co-transfected with EGFP (p = 0.029, Wilcoxons rank-sum test) (Fig. 2). The gene expression level of NS after co-transfection with pcDNA3.1-s7627A and pEGFP-N1 was not significantly different from single transfection with pcDNA3.1-s7627A (Fig. 2). EPC cells were transfected with pcDNA3.1-s7542–551 , where the region 542–551 was deleted, or with pcDNA3.1-s7, to see if modification of the conserved RNA structure in the proximity of the splicing site would influence the ratio between spliced and unspliced viral mRNA transcripts. At 24 hpt the relative expression of NEP mRNA to that of NS mRNA increased from 14% in pcDNA3.1s7 transfected cells to 65% of in pcDNA3.1-s7542–551 transfected cells. 3.3. Expression of NS and NEP in transfected cells Expression of both NEP and NS was demonstrated after western blot of EPC-cells transfected with pcDNA3.1-7 (Fig. 3, Lane 2). After transfection of the clone pcDNA3.1-s7627A only the NS protein could be observed (Fig. 3, Lane 3). Removal of the 5 - and 3 -UTRs did not change this (Fig. 3, Lane 5). After transfection of the clone pcDNA3.1-NEP the NEP protein was found (Fig. 3, Lane 6) The NS and NEP protein from transfected EPC cells had the same molecular weight as those from ISAV infected ASK-cells (Fig. 3, Lane 8). 3.4. Indications for conserved RNA secondary structure The ISAV segment 7 sequences grouped in the two well described American and European ISAV groups (Nylund et al., 2007), with an overall sequence identity of 87.7%. The 5 - and 3 overlapping regions for NS and NEP i.e. nucleotides 22–84 and 611–924 (Fig. 4A and B), were more conserved with sequence identities of 95.5% and 93.4%, respectively. It could be expected that

Fig. 3. Western blot of transfected EPC cells harvested 48 h post transfection. Lane 1: non-transfected cells, Lane 2: pcDNA3.1-s7, Lane 3: pcDNA3.1-s7627A , Lane 4: non-transfected cells, Lane 5: pcDNA3.1-s7 where 5 - and 3 -UTRs of ISAV segment 7 were removed, Lane 6: pcDNA3.1-NEP, Lane 7: ASK cells, Lane 8: ISAV infected ASK-cells. Upper part of blot stained with anti ISAV-NS, lower part: stained with anti ISAV-NEP.

the codon use in the NS downstream of 611 is severely restricted because of overlap with the frameshifted NEP. The region 85–568 on the other hand, i.e. the major part of the spliced out fragment, showed a sequence identity of only 82%. Region 568–629, i.e. upstream and downstream of the 3 splice site at position 611, were completely conserved with 100% sequence identity (Fig. 4 B). The predicted secondary structures by the mfold program included a hairpin structure of region 500–660 with a free energy change (G) of −78.11 kcal/mol at 15 ◦ C. The KineFold program predicted the presence of a pseudoknot structure in the same region. The RNAz predictions for regions 500–600 and 560–660 had Z-scores and p-class indicating secondary structure with values of −1.39, 0.81; and −1.14, 0.62, respectively. RNAz predictions with a p-class of >0.5 are considered structured. 4. Discussion Splicing of nuclear pre-mRNAs is generally an efficient mechanism and is completed before mRNA is exported from the nucleus. It is assumed that RNA pol II transcription and mRNA splicing are coupled processes (Proudfoot et al., 2002). However, only a portion of the ISAV segment 7 transcripts undergoes splicing, similar to other orthomyxoviruses (Biering et al., 2002; Kochs et al., 2000; Lamb and Choppin, 1979). Our results showed that the ratio between spliced and unspliced mRNA from segment 7 was maintained at low levels in ISAV infected fish cells. Results from the RTqPCR showed

Putave pseudoknot

A

500

5’

660

NS 22

NEP

84

611

924

1027

3’

627C/A

B 590 570 580 600 610 620 630 640 (554) 554560 AF401082(401) AATGTCTAGAGGCTTCTACTGACATTTTCCTTGATGAACTTGCTACTGTTGTTACAGGTGGCTTCTTTCCTGTCGGACTCAAAGGTTCCTGGGGAG AF401077(401) AATGTCTAGAGGCTTCTACTGACATTTTCCTTGATGAACTTGCTACTGTTGTTACAGGTGGCTTCTTTCCTGTCGGACTCAAAGGTTCCTGGGGAG EF523765(533) AATGTCTAGAGGCTTCTACTGACATTTTCCTTGATGAACTTGCTACTGTTGTTACAGGTGGCTTCTTTCCTGTCGGACTCAAAGGTTCCTGGGGAG AY044132(554) AGTGTCTGGAAGCCTCTACTGACATTTTCCTTGATGAACTTGCTACTGTTGTTACAGGTGGCTTCTTTCCTGTCGGGCTCAAAGGTTCCTGGGGAG DQ785270(533) AGTGTCTGGAAGCCTCTACTGACATTTTCCTTGATGAACTTGCTACTGTTGTTACAGGTGGCTTCTTTCCTGTCGGGCTCAAAGGTTCCTGGGGAG DQ785259(533) AGTGTCTGGAAGCCTCTACTGACATTTTCCTTGATGAACTTGCTACTGTTGTTACAGGTGGCTTCTTTCCTGTCGGGCTCAAAGGTTCCTGGGGAG Consensus(554) AGTGTCTGGAGGCTTCTACTGACATTTTCCTTGATGAACTTGCTACTGTTGTTACAGGTGGCTTCTTTCCTGTCGGGCTCAAAGGTTCCTGGGGAG Fig. 4. (A) The organization of ISAV genomic segment 7 and transcripts. Two transcripts are found; one is collinear with the viral genomic RNA while the other is spliced. Arrows indicate nucleotide (nt) number, angled line indicate the splicing intron of 527 nt. A pseudoknot structure was predicted in the splicing area. The 627c/a mutation introduces a stop codon in the 5 part of the exon 2 of the NEP without changing amino acid sequence of ISAV-NS. The reading frame upstream of the 5 splice site is identical for NS and NEP, while the splicing results in a frameshift for the C-terminal part of NEP. (B) Multiple sequence alignment of ISAV segment 7. The isolates, GenBank IDs AF401077, AF401082, DQ785270, DQ785259, AY044132 and EF523765, represent both the European and North-American genogroups. The RNA sequence of region 568–629, i.e. upstream and downstream of the 3 splice site at position 611, was completely conserved with 100% sequence identity.

R.B. Ramly et al. / Virus Research 190 (2014) 69–74

no temporal peaking of the amount of the spliced NEP transcripts, but a steady increase was observed from 24 to 72 hpi. However, we observed that the relative amount of NEP versus NS transcripts increased during the infection cycle from a small fraction early in the cycle to a more stable ratio at approximately 20–30% from 48 hpi and onwards. Possible explanations for this relative low amount of NEP mRNA could be inefficient splicing due to a weak splice site, as proposed for influenza virus (Chua et al., 2013), or increase in splicing efficiency of viral mRNA during virus infection, as proposed in early studies of influenza virus (Smith and Inglis, 1985; Valcarcel et al., 1991). Increased splicing efficiency is not supported by recent findings of influenza A virus where the ratio of spliced NEP mRNA transcripts was found to remain at a constant 15% of that of the unspliced NS1 mRNA during virus infection (Robb et al., 2010). In fish cell lines transfected with pcDNA3.1-s7, both ISAV-NEP and NS mRNA transcripts were detected, and we found that the ratio was approximately 13%, indicating that no ISAV proteins, except possibly NS and NEP, regulated the splicing process. The relative amount of NS transcripts was significantly reduced when NEP was delivered in trans, i.e. when cells were co-transfected with pcDNA3.1-s7627A and pcDNA3.1-NEP, and this could indicate that NEP has an inhibitory effect on NS gene expression. The slow accumulation of NEP transcripts indicated a delayed inhibition, which is timely as NS antagonize the cellular response to infection that is of major importance early in the viral life cycle, while NEP is vital in orchestrating the nuclear export of the viral RNP later in the viral life cycle (Rimatulhana et al., 2013). In influenza A virus RNP reconstitution assay an additional expression of NEP protein reduced the accumulation of viral mRNA levels in general (Robb et al., 2009), indicating a role for the NEP protein in the switch from viral mRNA transcription to viral genome replication (Perez et al., 2010). We can only speculate as to how ISAV maintains the low levels of spliced NEP transcripts. Our results indicate that regulation of the splicing of viral RNA is performed by functional RNA motifs such as an inefficient splice site or in the secondary structure of the mRNA and not by viral proteins. In general, the amount of specific mRNAs in a cell is determined by rate of transcription and degradation. A commonly used mRNA-degradation pathway is initiated by the removal of the 3 -poly(A) tail, but the 3 -ends of spliced and unspliced transcripts of segment 7 are similar, indicating no difference in susceptibility to this mRNA degradation pathway. Promoters in UTR of eukaryotic mRNA may be important in determining mRNA abundance (Bregman et al., 2011). However, we found no indication for a function for UTRs in this regulation as removal of 5 - and 3 -UTRs did not significantly change the ratio between spliced and unspliced transcripts. The in silico predictions indicated a conserved RNA secondary structure in the proximity of the 3 -splicing site. There was a remarkable difference in the sequence identity of the different parts of the spliced fragment between ISAV isolates, with 100% identity in the area close to the 3 -splicing site, even for the part where only NS is encoded. As RNA viruses often evolve very quickly as a result of the error prone viral RNA polymerases, it can be speculated that the observed lack of sequence polymorphism in this region indicate vital properties. The secondary structures of the unspliced positive strand RNA predicted by mfold had a low free energy, indicating stability. The use of free energy minimization has on average been found to be 73% accurate for predicting base pairs for sequences in domains of fewer than 800 nucleotides (Mathews et al., 2004). Stable secondary structures were supported by KineFold analysis that predicted a pseudoknot structure in this splicing area. The p-class scores by RNAz predictions of the regions 500–600, and 560–660, the latter included the 3 -splicing site at 611, indicated secondary structure of RNA. A highly conserved pseudoknot structure has been identified in the 3 splice site of the NS1 mRNA

73

in both influenza A and B viruses (Gultyaev and Olsthoorn, 2010). When the secondary RNA structure in ISAV segment 7 was modified by deletion of 10 nucleotides, i.e. pcDNA3.1-s7542–551 , we observed that the relative expression of NEP mRNA to that of NS increased compared to the expression pattern of non-modified RNA. This further indicated that stable secondary RNA structures in the genomic segment 7 of ISAV could be involved control of viral RNA splicing. Different, and somewhat contradictory, control mechanisms of influenza NS1 transcripts have been proposed. By in trans expression it was found that NS1 specifically down regulated nuclear export of its own mRNA through NS1 RNA-binding activity (AlonsoCaplen et al., 1992; Garaigorta and Ortin, 2007). On the other hand, it was found that NS1 inhibits the splicing of cellular pre-mRNAs but does not affect the splicing of viral NS1 mRNA (Lu et al., 1994), and this was recently corroborated by other studies (Robb et al., 2010). ISAV-NS, however, does not bind RNA and does not have nuclear localization signals but have predominantly a perinuclear localization (Garcia-Rosado et al., 2008; McBeath et al., 2006), indicating that interaction with the cellular splicing machinery or viral mRNA in the nucleus is prohibited. Although ISAV is evolutionary remote to the influenza viruses and the most recent common ancestor of the genera of orthomyxoviruses may be dated back millions of years, there are many similarities between ISAV and the influenza viruses regarding interactions with their host cells. The use of structured RNA for transcriptional regulation of viral gene expression may be an example of a conserved function. Acknowledgements Financial support for this work was provided by grant 183196/S40 from Research Council of Norway and A1948172 from Public Service Department of Malaysia. References Alonso-Caplen, F.V., Nemeroff, M.E., Qiu, Y., Krug, R.M., 1992. Nucleocytoplasmic transport: the influenza virus NS1 protein regulates the transport of spliced NS2 mRNA and its precursor NS1 mRNA. Genes Dev. 6, 255–267. Biering, E., Falk, K., Hoel, E., Thevarajan, J., Joerink, M., Nylund, A., Endresen, C., Krossøy, B., 2002. Segment 8 encodes a structural protein of infectious salmon anaemia virus (ISAV); the co-linear transcript from Segment 7 probably encodes a non-structural or minor structural protein. Dis. Aquat. Organ. 49, 117–122. Boulo, S., Akarsu, H., Ruigrok, R.W.H., Baudin, F., 2007. Nuclear traffic of influenza virus proteins and ribonucleoprotein complexes. Virus Res. 124, 12–21. Bregman, A., Avraham-Kelbert, M., Barkai, O., Duek, L., Guterman, A., Choder, M., 2011. Promoter elements regulate cytoplasmic mRNA decay. Cell 147, 1473–1483. Brinson, R.G., Szakal, A.L., Marino, J.P., 2011. Structural characterization of the viral and cRNA panhandle motifs from the infectious salmon anemia virus. J. Virol. 85, 13398–13408. Chua, M.A., Schmid, S., Perez, J.T., Langlois, R.A., Tenoever, B.R., 2013. Influenza a virus utilizes suboptimal splicing to coordinate the timing of infection. Cell Rep. 3, 23–29. Clouthier, S.C., Rector, T., Brown, N.E., Anderson, E.D., 2002. Genomic organization of infectious salmon anaemia virus. J. Gen. Virol. 83, 421–428. Devold, M., Krossøy, B., Aspehaug, V., Nylund, A., 2000. Use of RT-PCR for diagnosis of infectious salmon anaemia virus (ISAV) in carrier sea trout Salmo trutta after experimental infection. Dis. Aquat. Organ. 40, 9–18. Engelhardt, O.G., Fodor, E., 2006. Functional association between viral and cellular transcription during influenza virus infection. Rev. Med. Virol. 16, 329–345. Garaigorta, U., Ortin, J., 2007. Mutation analysis of a recombinant NS replicon shows that influenza virus NS1 protein blocks the splicing and nucleo-cytoplasmic transport of its own viral mRNA. Nucleic Acids Res. 35, 4573–4582. Garcia-Rosado, E., Markussen, T., Kileng, O., Baekkevold, E.S., Robertsen, B., Mjaaland, S., Rimstad, E., 2008. Molecular and functional characterization of two infectious salmon anaemia virus (ISAV) proteins with type I interferon antagonizing activity. Virus Res. 133, 228–238. Gruber, A.R., Findeiss, S., Washietl, S., Hofacker, I.L., Stadler, P.F., 2010. RNAZ 2.0: improved noncoding RNA detection. Pac. Symp. Biocomput. 15, 69–79. Gultyaev, A.P., Olsthoorn, R.C., 2010. A family of non-classical pseudoknots in influenza A and B viruses. RNA Biol. 7, 125–129.

74

R.B. Ramly et al. / Virus Research 190 (2014) 69–74

Hale, B.G., Randall, R.E., Ortin, J., Jackson, D., 2008. The multifunctional NS1 protein of influenza A viruses. J Gen. Virol. 89, 2359–2376. Inglis, S.C., Brown, C.M., 1984. Differences in the control of virus mRNA splicing during permissive or abortive infection with influenza A (fowl plague) virus. J. Gen. Virol. 65, 153–164. Kibenge, F.S.B., Xu, H.T., Kibenge, M.J.T., Qian, B., Joseph, T., 2007 34. Characterization of gene expression on genomic segment 7 of infectious salmon anaemia virus. Virol. J. 4, 34. Kochs, G., Weber, F., Gruber, S., Delvendahl, A., Leitz, C., Haller, O., 2000. Thogoto virus matrix protein is encoded by a spliced mRNA. J. Virol. 74, 10785–10789. Lamb, R.A., Choppin, P.W., 1979. Segment 8 of the influenza virus genome is unique in coding for two polypeptides. Proc. Natl. Acad. Sci. U.S.A. 76, 4908–4912. Lamb, R.A., Choppin, P.W., Chanock, R.M., Lai, C.J., 1980. Mapping of the two overlapping genes for polypeptides NS1 and NS2 on RNA segment 8 of influenza virus genome. Proc. Natl. Acad. Sci. U.S.A. 77, 1857–1861. Lamb, R.A., Lai, C.J., 1984. Expression of unspliced NS1 mRNA, spliced NS2 mRNA, and a spliced chimera mRNA from cloned influenza virus NS DNA in an SV40 vector. Virology 135, 139–147. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25, 402–408. Løvoll, M., Austbo, L., Jorgensen, J., Rimstad, E., Frost, P., 2011. Transcription of reference genes used for quantitative RT-PCR in Atlantic salmon is affected by viral infection. Vet. Res. 42, 8. Lu, Y., Qian, X.Y., Krug, R.M., 1994. The influenza virus NS1 protein: a novel inhibitor of pre-mRNA splicing. Genes Dev. 8, 1817–1828. Mathews, D.H., Disney, M.D., Childs, J.L., Schroeder, S.J., Zuker, M., Turner, D.H., 2004. Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure. Proc. Natl. Acad. Sci. U.S.A. 101, 7287–7292. McBeath, A.J.A., Collet, B., Paley, R., Duraffour, S., Aspehaug, V., Biering, E., Secombes, C.J., Snow, M., 2006. Identification of an interferon antagonist protein encoded by segment 7 of infectious salmon anaemia virus. Virus Res. 115, 176–184. Mjaaland, S., Rimstad, E., Falk, K., Dannevig, B.H., 1997. Genomic characterization of the virus causing infectious salmon anemia in Atlantic salmon (Salmo salar L.): an orthomyxo-like virus in a teleost. J. Virol. 71, 7681–7686. Nemeroff, M.E., Barabino, S.M., Li, Y., Keller, W., Krug, R.M., 1998. Influenza virus NS1 protein interacts with the cellular 30 kDa subunit of CPSF and inhibits 3 end formation of cellular pre-mRNAs. Mol. Cell 1, 991–1000.

Nylund, A., Plarre, H., Karlsen, M., Fridell, F., Ottem, K.F., Bratland, A., Saether, P.A., 2007. Transmission of infectious salmon anaemia virus (ISAV) in farmed populations of Atlantic salmon (Salmo salar). Arch. Virol. 152,151–179. Olsvik, P., Lie, K., Jordal, A.E., Nilsen, T., Hordvik, I., 2005. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon. BMC Mol. Biol. 6, 21. Perez, J.T., Varble, A., Sachidanandam, R., Zlatev, I., Manoharan, M., Garcia-Sastre, A., tenOever, B.R., 2010. Influenza A virus-generated small RNAs regulate the switch from transcription to replication. Proc. Natl. Acad. Sci. U.S.A. 107,11525–11530. Proudfoot, N.J., Furger, A., Dye, M.J., 2002. Integrating rnRNA processing with transcription. Cell 108, 501–512. Ramly, R.B., Olsen, C.M., Braaen, S., Rimstad, E., 2013. Infectious salmon anemia virus export protein is encoded by a spliced gene product of genomic segment 7. Virus Res. 177, 1–10. Ritchie, R.J., Bardiot, A., Melville, K., Griffiths, S., Cunningham, C.O., Snow, M., 2002. Identification and characterisation of the genomic segment 7 of the infectious salmon anaemia virus genome. Virus Res. 84, 161–170. Robb, N.C., Jackson, D., Verde, F.A.T., Fodor, E., 2010. Splicing of influenza A virus NS1 mRNA is independent of the viral NS1 protein. J. Gen. Virol. 91, 2331–2340. Robb, N.C., Smith, M., Verde, F.A.T., Fodor, E., 2009. NS2/NEP protein regulates transcription and replication of the influenza virus RNA genome. J. Gen. Virol. 90, 1398–1407. Robertson, J.O.S.S., Schubert, M., Lazzarini, R.A., 1981. Polyadenylation sites for influenza virus mRNA. J. Virol. 38, 157–163. Sandvik, T., Rimstad, E., Mjaaland, S., 2000. The viral RNA 3 - and 5 -end structure and mRNA transcription of infectious salmon anaemia virus resemble those of influenza viruses. Arch. Virol. 145, 1659–1669. Smith, D.B., Inglis, S.C., 1985. Regulated production of an influenza virus spliced mRNA mediated by virus-specific products. EMBO J. 4, 2313–2319. Valcarcel, J., Portela, A., Ortin, J., 1991. Regulated M1 mRNA splicing in influenza virus-infected cells. J. Gen. Virol. 72 (6), 1301–1308. Xayaphoummine, A., Bucher, T., Isambert, H., 2005. Kinefold web server for RNA/DNA folding path and structure prediction including pseudoknots and knots. Nucleic Acids Res. 33, W605–W610. Zheng, H., Lee, H.A., Palese, P., Garcia-Sastre, A., 1999. Influenza A virus RNA polymerase has the ability to stutter at the polyadenylation site of a viral RNA template during RNA replication. J. Virol. 73, 5240–5243. Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406–3415.