Comparative Biochemistry and Physiology, Part C 160 (2014) 23–29

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc

Transcriptional expression levels and biochemical markers of oxidative stress in Mytilus galloprovincialis exposed to nickel and heat stress Mohamed Banni a,b,⁎, Attig Hajer b, Suzanna Sforzini a, Caterina Oliveri a, Hamadi Boussetta b, Aldo Viarengo a a b

Department of Environmental and Life Sciences, University of Piemonte Orientale Amedeo Avogadro, Via Bellini 25G, 15100 Alessandria, Italy Laboratory of Biochemistry and Environmental Toxicology, ISA, Chott-Mariem, 4042 Sousse, Tunisia

a r t i c l e

i n f o

Article history: Received 20 August 2013 Received in revised form 16 November 2013 Accepted 18 November 2013 Available online 27 November 2013 Keywords: Heat stress Nickel Gene expression Oxidative stress Mytilus galloprovincialis

a b s t r a c t The present study aims to evaluate transcriptional expression levels and biochemical markers of oxidative stress responses to nickel (Ni) exposure along with heat stress gradient in a mussel (Mytilus galloprovincialis). For this purpose, we investigated the response of oxidative stress markers, metallothionein accumulation and gene expression in digestive gland of mussels exposed to a sublethal concentration of Ni (2.5 μM) along with a temperature gradient (18 °C, 22 °C, and 26 °C) for 24 h and 72 h. Ni digestive gland uptake was evaluated after the exposure periods. Co-exposure to Ni and higher temperature (26 °C) for 72 h significantly decreased the antioxidant enzyme activities termed as catalase (CAT), superoxide dismutase (SOD) and glutathione-S-transferase (GST) and caused a pronounced increase of lipofuscin and neutral lipid (NL) accumulation. Ni-uptake was different with respect to the exposure periods and temperatures in Ni-exposed mussels. Sod, cat, gst, mt-10 and mt20 gene expression levels showed a substantial increased pattern in animals exposed for one day to heat stress compared to the control condition (18 °C). The same pattern but with highest level was registered in animals co-exposed to Ni and temperatures within one day. Three days exposure to 18 °C, 22 °C and 26 °C, resulted in a significant decrease in mRNA abundance of cat, gst and sod and a significant down-regulation of mts targets (22 °C and 26 °C). Our data provide new insights into the importance of the early protective response of oxidative stress related-gene expression and regulation in mussels challenging heat stress and sublethal Ni concentration. © 2013 Elsevier Inc. All rights reserved.

1. Introduction Seasonal cyclic changes are well known to influence mussel's physiology (Banni et al., 2011). Due to their intertidal region habitat, mussels can challenge and sustain seasonal variations in environmental temperature. Indeed, they may be exposed to extreme temperature fluctuations with a wide change in body temperature within a short period of time during hot season (Sokolova, 2004). Moreover, one consequence of the increase of CO2 atmospheric levels, recognized as a major environmental problem at the global level, is climate change; continuous temperature increases may represent an important risk to marine ecosystems, especially coastal areas (Scholze et al., 2006). Recently, many studies attempted to elucidate in heat and heavy metals stressed organisms, using proteomic and transcriptomic approaches, the exact role of genes encoding proteins associated to the stress response such as heat shock proteins, oxidative stress, and translation related genes (Park et al., 2007; Farcy et al., 2009; Lockwood et al., 2010; Negri et al., 2013). Overall, recent studies lead to the hypothesis that the load of reactive oxygen species (ROS) may

⁎ Corresponding author at: Laboratory of Biochemistry and Environmental Toxicology, ISA, Chott-Mariem, 4042 Sousse, Tunisia. Tel.: +216 73 327 544; fax: +216 73 327 591. E-mail address: [email protected] (M. Banni). 1532-0456/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.cbpc.2013.11.005

be an important factor affecting the physiological costs of elevated environmental stress (Kamel et al., 2012; Negri et al., 2013). Indeed, evidence for an important role of oxidative stress related genes during heat stress episodes has been provided (Tomanek and Zuzow, 2010). Higher temperatures are known to enhance reactive oxygen species (ROS) production in the cells (Kefaloyianni et al., 2005; Verlecar et al., 2007) thereby increasing the risk of oxidative alteration. ROS formation and consequent damage are balanced by a range of cellular antioxidant defences including various antioxidant enzymes such as superoxide dismutase (SOD), catalase (Cat), glutathione peroxidase (GPx), as well as low molecular binding proteins such as metallothioneins that function as radical quenchers and as chain-breaking compounds (Livingstone, 2001; Dondero et al., 2005). In the last decades, a growing attention on the ecological and ecotoxicological effects of nickel (Ni) contamination has been considered due to its large industrial application (Papachristou et al., 1993; Kienle et al., 2009; Vandenbrouck et al., 2009). Ni is a metal of high environmental relevance that has been shown to exert long-term toxic effects to aquatic biota such as microorganisms (Bielmyer et al., 2013), invertebrates (Pane et al., 2003), particularly bivalves (Attig et al., 2010; Dondero et al., 2011) and fish (Banni et al., 2010). In addition to the direct production of free radicals, Ni was suspected to cause depletion of the antioxidant enzyme system (Denkhaus and Salnikov, 2002) and therefore it should be considered a pro-oxidant agent.

24

M. Banni et al. / Comparative Biochemistry and Physiology, Part C 160 (2014) 23–29

The current investigation had two main aims. Firstly, we sought to investigate the Ni loads and to identify the effects of simultaneous changes in temperature and Ni supply on three anti-oxidant stress enzymes; CAT, SOD and GST activities as well as the metallothionein in the digestive gland tissues of mussels. Moreover lipofuscine content as well as neutral lipid accumulation in digestive gland tissues were determined. Secondly, and based on available DNA sequence information for Mytilus galloprovincialis, the expression levels of the following genes were monitored by quantitative reverse-transcription PCR (qRT-PCR): catalase (cat); cytosolic superoxide dismutase (sod), glutathione S-transferase (gst) and metallothionein gene variants (mt-10 and mt20) which are involved in the ROS detoxification although mts are better known for their role in bivalent heavy metal metabolism. 2. Material and methods 2.1. Animals and treatments Specimens of M. galloprovincialis (Lam.), 5–6 cm shell length, were purchased from an aquaculture mussel farm in Bizerte Lagoon (Bizerte, Tunisia) in October 2011. These specimens were transferred to aquaria at a density of 1 animal/L in clean, aerated seawater collected offshore. Experiments were carried out at three temperatures (18 °C, 22 °C and 26 °C). After an acclimation of 6 days, a period of time sufficient to stabilize at control temperature the mussel physiological response (Dondero et al., 2011), groups of mussels were kept in 20 polypropylene plastic vessels (four replicates per treatment) and underwent semistatic exposure to 147 μg/L nickel (NiCl2) for 1 and 3 days. The exposure level represents the EC25 for the effect on digestive gland lysosomal membrane stability (LMS) (mussels were exposed to a range of 0.01–15 mg/L for 96 h) (Dondero et al., 2011). One set of animals was maintained in seawater with no addition of nickel at the three experimental temperatures. Seawater of the desired temperature was renewed every day, and Ni was added together with a commercial algal preparation (30 mg animal− 1 day−1) (Liquifry; Interpret Ltd., Dorking, Surrey, UK). Only female individuals (scored by microscopic inspection of gonad biopsies) were selected for subsequent analysis to avoid gender-based bias in gene expression. After exposure to heat and nickel, DG were rapidly removed, frozen in liquid N2, and stored at − 80 °C for CAT, GST SOD and MTs analysis (n = 10). A second set of tissues was kept at − 20 °C in an RNA-preserving solution (RNA Later; Sigma-Aldrich) for transcriptome analysis (n = 4), and a third set was mounted on aluminum chucks and frozen in super-cooled N-hexane for histochemical determination of neutral lipids and lipofuscine content (n = 10) (Moore, 1988). 2.2. Nickel analysis The content of Ni in the DG fractions was determined by atomic absorption spectrophotometry (AAS) after acid digestion of 0.5 g dry tissues with 4 of 65% HNO3 and 1 mL of 70% HCIO4 for 24 h at 80 °C (Amiard et al., 1987). The residues were diluted in 10 mL of 1 N HNO3. Ni was determined by flame and flameless AAS using a variant spectrophotometer Vectra 250 Plus with ZEEMAN correction. Blanks and reference materials (dogfish liver DOLT-2, NRCC) were assessed through the procedure in the same way as the sample. Our results (21.0 ± 1.1 μg/g dry mass, n = 3) were in good agreement with certified values (20.8 ± 0.5 μg/g dry mass). Levels of Ni are given relative to the dry mass of tissue. Analytical confirmation of nickel concentrations in reconstituted water was performed by flame atomic absorption spectroscopy. 2.3. Biochemical analysis Before biochemical analysis, DGs were homogenized in phosphate buffer (0.1 M, pH 7.5). The homogenate obtained was centrifuged at

9000 g for 25 min at 4 °C for S9 fractions or at 20,000 g for 25 min at 4 °C for S20. S9 fraction was used to carry out CAT (EC 1.11.1.6), SOD (EC 1.15.1.1) and GST (EC 2.5.1.18) analysis. S20 fraction was used for MTs analysis. The quantities of proteins present in S9 and S20 fractions were determined according to the Bradford (1976) method using Coomassie Blue reagent. CAT was determined according to Clairbone's method (1985). Reaction mixture (final volume of 1 mL) contained 0.78 mL 0.1 M phosphate buffer (pH 7.5) and 0.2 mL 0.5 mM H2O2. After 30 s preincubation, the reaction was started by the addition of 0.02 mL of the (S9) solution containing CAT fractions. CAT activity was evaluated by kinetic measurement at 20 °C using a Jenway 6105 spectrophotometer (λ = 240 nm). Results were expressed as μmoles hydrogen peroxide transformed per min and per mg protein. GST activity was measured in DG cytosol by the method of Habig et al. (1974) using 10 μg of cytosolic protein, 1 mM 1-chloro-2,4-dinitrobenzene (CDNB) (Sigma-Aldrich, St Louis, MO, USA) as substrate, and 4 mM glutathione reduced form GSH, in 100 mM sodium phosphate buffer, pH 7.5. GST activity was determined by kinetic measurement at 20 °C using a Jenway 6105 spectrophotometer (λ = 340 nm). Results were expressed as nmoles GSH-CDNB produced per min and per mg protein. The total SOD activity measurement was determined based on the ability of the enzyme to inhibit the reduction of nitro blue tetrazolium (NBT) (Crouch et al., 1981), which was generated by 37.5 mM hydroxylamine in an alkaline solution. The assay was performed in a 0.5 M Na-carbonate buffer (pH 10.2) with 2 mM EDTA and 10 μL aliquot of the supernatant. The reduction of NBT by superoxide anion to blue formazan was measured at 560 nm. The SOD activity was calculated as relative to its ability to inhibit 50% reduction of NBT per min and expressed as U/mg protein. Neutral lipids and lipofuscine tests were determined as indicated by Moore (1988). Cryostat sections (10 μm) were obtained through a Leica cryostat apparatus at −27 °C. The lipid content was assessed by staining tissue sections with the oil-soluble dye, Oil Red-O (ORO) and quantified by digital image analysis. Lipofuscine accumulation was determined by fixing sections in calcium formaldehyde solution for 15 min. After drying in the air, the sections were washed in distilled water and stained in a solution of ferric chloride (1%)/K-ferricyanide (1%) (3/1) and quantified by digital image analysis. Staining intensity was obtained by means of an inverted Axiovert microscope (Zeiss) at 400 × magnification, connected to a digital camera (Axiocam, Zeiss). Digital image analysis was carried out using the Scion Image software package (Scion Corp. Inc.) from 8-bit gray scale images. MTs content was evaluated in DG according to the spectrophotometric method described in Viarengo et al. (1997) based on cysteine residue titration of a partially purified metallothionein extract. MTs protein levels were determined using a spectrophotometric assay for MT using Ellman's reagent (0.4 mM DTNB in 100 mM KH2PO4) at pH 8.5 in a solution containing 2 M NaCl and 1 mM EDTA. Reduced GSH standard solutions were used for calibration (2–100 μM) and data were expressed as μg MT per mg of protein taking into consideration mussel's MT molecular mass and number of cysteine residues. 2.4. Gene expression Total RNA was extracted from female individual gill pieces using acid phenol–chloroform precipitation according to Chomczynski and Sacchi (1987) with TRI-Reagent (Sigma-Aldrich). RNA was further purified by precipitation in the presence of 1.5 M LiCl2, and the quality of each RNA preparation was confirmed by UV spectroscopy and TBE agarose gel electrophoresis in the presence of formamide. Relative mRNA abundances of the mussel genes encoding metallothionein (mt-10 and mt-20) were evaluated with SYBR Green I chemistry (EvaGreen®dye; Bio-Rad Laboratories; Banni et al., 2011; Dondero et al., 2011). The mRNA abundances of the genes encoding catalase, cytosolic

M. Banni et al. / Comparative Biochemistry and Physiology, Part C 160 (2014) 23–29

2.5. Statistical analysis The results for nickel accumulation, enzymatic activities, MTs and neutral lipid content measurement are presented as the mean ± SD of 10 samples. The Statistica Software, version 6.0, computer software package (StatSoft. Inc. 2002) was used for statistical analysis. The normality of the distribution was tested using the Shapiro–Wilk test. To assess multiple comparisons, a parametric one-way analysis of variance (ANOVA) was performed on data, with a Tukey's test. 3. Results 3.1. Digestive gland Ni-content The content of Ni in M. galloprovincialis DG after the exposure periods is reported in Fig. 1. Ni concentrations were significantly increased in DG of animals exposed for one day to Ni at 18 °C, 22 °C and 26 °C when compared to control condition (Fig. 1). A substantial increase was observed in the Ni loads after 3 days exposure when compared to animals exposed for one day to the same conditions. Interestingly, a

2,5

Control Ni

a,b,c 2

[Ni] µg/g dry weight

superoxide dismutase and glutathione S-transferase were evaluated in multiplex Taqman assays according to Negri et al. (2013). Probes and primer pairs (Table 1) were designed using Beacon Designer v3.0 (Premier Biosoft International, Inc.). All primers and dual-labeled Taqman probes were synthesized by MWG-Biotech GmbH (Germany) and cDNA (25 ng RNA reverse-transcribed to cDNA) was amplified in a CFX384 Real-Time PCR detection system (Bio-Rad Laboratories) with iQTM Multiplex Power mix (Bio-Rad) according to the manufacturer's instructions for the triplex protocol. All multiplex combinations accounted for the following dual fluorescence tags: 6-carboxyfluorescein/Black Hole (BH) 1,6-carboxy-2′,4,4′,5′,7,7′-hexachlorofluorescein/BH1, and Texas Red/ BH2. Briefly, cDNA was amplified in the presence of 1X iQTM Multiplex Power mix, 0.3 μM each primer, and 0.1 μM each probe (Table 1) in a final volume of 10 μL. Relative expression data were geometrically normalized to18S rRNA (L33452), an invariant actin isotype (AJ625116), and ribosomal proteinriboL27 (AJ625928) (Negri et al., 2013), which were selected from a list of genes whose expression did not vary over more than 50 conditions (including toxic treatments, stages of the life cycle, and various tissues). A specific triplex Taqman assay was developed to amplify 0.25 ng of RNA reverse-transcribed to cDNA in the presence of 0.1 μM of each dual-labeled probe (hexachlorofluorescein/BH1 for actin, Texas Red/ BH2 for 18S rRNA and Hex/BH2 for proteinriboL27) and 0.1 μM, 0.4 μM and 0.4 μM of forward and reverse primer, respectively, for 18S rRNA, actin and proteinriboL27 (Table 1). For all Taqman assays, the thermal protocol was as follows: 30 s at 95 °C, followed by 40 cycles of 10 s at 95 °C and 20 s at 60 °C. qRT-PCR was performed with four biological replicates and three technical replicates. For the mt-10 and mt-20 assays, the thermal protocol was as presented by Dondero et al. (2005). Statistical analyses were carried out on the group mean values using a random reallocation test (Pfaffl et al., 2002).

25

a,c 1,5

a,b,c

1

0,5

a,b a

a

0 18°C

22°C

26°C

18°C

24H

22°C

26°C

72H

Fig. 1. Ni accumulation in Mytilus galloprovincialis digestive gland in animals exposed for 24 h and 72 h to Ni (137 μg/L) along with a temperature gradient (18 °C, 22 °C and 26 °C). Data, expressed in μg/g dry mass (n = 10), were analyzed by ANOVA + Tukey's post test. a: Statistically significant differences (P b 0.01) in comparison with control condition (18 °C without Ni supply). b: Statistically significant differences (P b 0.01) in comparison with animals exposed to18 °C/Ni for 24 h. c: Statistically significant differences (P b 0.01) in comparison with animals exposed to the same condition for 24 h.

significant difference in Ni accumulation was observed between animals exposed to 18 °C and 26 °C after 72 h. 3.2. Effects of Ni and heat stress on antioxidant enzymes The antioxidant activities termed as CAT, SOD and GST significantly increased in animals exposed to Ni and/or to heat stress when compared to control animals (Fig. 2). Exposure to Ni along with 26 °C rendered a significant increase in the antioxidant activities after 24 h and a return to control values after 72 h. However the significant increase was maintained after 24 h and 72 h in animals exposed to Ni at 18 °C or 22 °C. 3.3. Effects of Ni and heat stress on neutral lipid accumulation Lipid oxidative alteration was investigated through the evaluation of the DG cell lipofuscine accumulation and neutral lipid content (Fig. 3A and B). The two biomarkers rose significantly in all Ni exposed mussels after 24 h and 72 h while the heat stress alone elicited a significant response only after 72 h. The highest lipofuscine and lipid contents were observed in animals exposed to 26 °C in the presence of Ni. 3.4. Effects of Ni and heat stress on Mts level Total Mts protein content was evaluated in the DG tissues of mussels exposed to Ni and heat stress after 24 h and 72 h (Fig. 4). Our data show that MTs content significantly increased over time in DG tissues of mussels exposed to the heat stress and Ni. The maximum was observed

Table 1 Q-PCR primers and Taqman probes. Gene _ID

Probe

Sense primer

Antisense primer

mt10 (AJ625847) mt-20 (HQ681036.1) CAT (AY580271.1) GST (AF527010.1) SOID (FM177867.1) RiboL27 (AJ625928) Actin (AJ625116) 18S (L33452)

– – ACAGCTTGTCTGCCTGCTCAGCAC ACGCCTGTGTCCCCAAACAAGTGG AGTCGTCACTGTCACTGTCCTCTC TGCGCCATTCAGCACAAGAACTACCT ACGCCAACACCGTCTTGTCTGGTGG ACCACATCCAAGGAAGGCAGCAGGC

GGGCGCCGACTGTAAATGTTC TGTGAAAGTGGCTGCGGA ACAAGGATGGACAGGCATACTAC AACTGACCACTTCAAGAATATGCC TGAAAGGAGATGGTGCTGTTAC AAGCCATGGGCAAATTTATGAAAA GTGTGATGTCATATCCGTAAGGA CGGAGAGGAGCATGAGAAAC

CACGTTGAAGGYCCTGTACACC GTACAGCCACATCCACACGC AATCACGGATGGCATAATCTGGA AGAAAGTCTGCCATTTACAAAGCT CAAACTCGTGAACGTGGAAAC TTTACAATGACTGCTTTACGACCT GCTTGGAGCAAGTGCTGTGA CGTGCCAGGAGTGGGTAATTT

Gene ID, EMBL or NCBI gene identifier; Taqman probe, sense primer and antisense primer sequences. All sequence are given 5′ to 3′. ribo-L27 — ribosomal protein genes; 18S — ribosomal RNA.

200 180

a,b

A

a

a

160

a,b a

a

140

a a

a

Control Ni

c

120

c

100 80 60 40 20

% Neutral lipids Surface Density

M. Banni et al. / Comparative Biochemistry and Physiology, Part C 160 (2014) 23–29

CAT activity (nmole/mn/mg proteins)

26

500 450

A

400

Control

350

Ni

a,b,c a,b

300 250

a,b

200

a,b

18°C

100 50

22°C

26°C

18°C

22°C

18°C

26°C

22°C

26°C

18°C

a,b

B

a,b,c

50

a

a

a

a

Control Ni

a,c a,c

40

c 30 20 10

500

% Lipofuscin Surface Density

SOD activity (U/mg proteins)

24H

60

0

450

B

400

Control

350

Ni

22°C

26°C

18°C

22°C

a,b,c a,b

300 250

a,b

a,b

200

a,b,c a

150 100 50

26°C

18°C

350

C

a,b,c

Control Ni

22°C

26°C

18°C

a,b,c

250

a

a

a

a,b

a,b a

150

c c

22°C

26°C

72H

Fig. 3. Neutral lipid content (A) and lipofuscin accumulation (B) in digestive gland of Mytilus galloprovincialis exposed to Ni and temperature. Mussels were exposed for 24 h and 72 h to Ni (137 μg/L) along with a temperature gradient (18 °C, 22 °C and 26 °C). Data, expressed as % of surface density (n = 10), were analyzed by ANOVA + Tukey's post test. a: Statistically significant differences (P b 0.01) in comparison with control condition (18 °C without Ni supply). b: Statistically significant differences (P b 0.01) in comparison with animals exposed to18 °C/Ni for 24 h. c: Statistically significant differences (P b 0.01) in comparison with animals exposed to the same condition for 24 h.

100 50 0 18°C

22°C

24H

26°C

18°C

22°C

26°C

was performed by real time quantitative PCR on DG transcripts using 18S rRNA, actin and protein-ribo-L27 as reference genes (Figs. 5 and 6). A significant increase in cat, sod, gst transcription was observed after 250

72H

Fig. 2. CAT (A), SOD (B) and GST(C) activities in digestive gland of Mytilus galloprovincialis exposed to Ni and temperature. Mussels were exposed for 24 h and 72 h to Ni (137 μg/L) along with a temperature gradient (18 °C, 22 °C and 26 °C). Data, expressed as nmole/ min/mg proteins for CAT and GST and as U/mg protein for SOD (n = 10), were analyzed by ANOVA + Tukey's post test. a: Statistically significant differences (P b 0.01) in comparison with control condition (18 °C without Ni supply). b: Statistically significant differences (P b 0.01) in comparison with animals exposed to18 °C/Ni for 24 h. c: Statistically significant differences (P b 0.01) in comparison with animals exposed to the same condition for 24 h.

after 72 h exposure. The highest MTs content was registered in animals exposed to Ni at 26 °C after 72 h treatment (219.58 ± 19.86 μg/g wet mass). No significant variation of the MTs content was registered in mussels treated with Ni at the physiological temperature after 24 h, while it was significantly increased after 72 h exposure (119.75 ± 12.42 μg/g wet mass). 3.5. Effects of Ni and heat stress on selected antioxidant related genes mRNA expression Expression analysis of various genes (Cat, Cu/Zn-Sod, Gst, mt-10 and mt-20) encoding antioxidant proteins and metallothionein isoforms

a,b,c Control

MT content (µg/g wet weight)

GST activity (nmole/mn/mg proteins)

26°C

72H

24H

200

22°C

0 18°C

300

a

a

150

0

0

70

a,b,c

Ni

200

a,b

a,b a,b

150

a,b

a,b

a,b

a,b

a,c

100

50

0 18°C

22°C

24H

26°C

18°C

22°C

26°C

72H

Fig. 4. Metallothionein protein content in digestive gland of Mytilus galloprovincialis exposed to Ni and temperature. Mussels were exposed for 24 h and 72 h to Ni (137 μg/L) along with a temperature gradient (18 °C, 22 °C and 26 °C). Data, expressed as μg/mg wet mass (n = 10), were analyzed by ANOVA + Tukey's post test. a: Statistically significant differences (P b 0.01) in comparison with control condition (18 °C without Ni supply). b: Statistically significant differences (P b 0.01) in comparison with animals exposed to18 °C/Ni for 24 h. c: Statistically significant differences (P b 0.01) in comparison with animals exposed to the same condition for 24 h.

M. Banni et al. / Comparative Biochemistry and Physiology, Part C 160 (2014) 23–29

7

A

Ni

12

**

5

*

4 3

14

Control

Relative fold expression

Relative fold expression

6

*

*

*

2

*

1

22°C

26°C

18°C

24H

22°C

6

*

*

4

*

*

*

4

Ni

*

*

2

B

12

*

3

22°C

26°C

18°C

24H 14

Control

*

B

5

18°C

Relative fold expression

Relative fold expression

8

26°C

1

*

0

*

**

22°C

26°C

72H Control

*

Ni

10 8

*

*

6 4

*

2 0

18°C

22°C

26°C

18°C

24H

22°C

26°C

C

24H Ni

16 14 12

*

8

*

*

6

*

*

**

*

2 0 18°C

22°C

26°C

22°C

26°C

18°C

*

**

22°C

26°C

72H

Control

*

10

18°C

72H

20

Relative fold expression

10

72H

7

4

Ni

0 18°C

18

Control

A

2

*

0

6

27

18°C

22°C

Fig. 6. QPCR data of mt-10 (A) and mt-20 (B) targets. Gene expression was performed with respect to the reference condition; 18 °C without Ni supply and was normalized against Actin, 18S and Ribo L27. *significantly different from reference condition, *P b 005 threshold cycle random reallocation test according to Pfaffl et al. (2002), n = 4. Mussels were exposed for 24 h and 72 h to Ni (137 μg/L) along with 8 °C temperature increase (18 °C, 22 °C and 26 °C).

(10.21 fold) and at 22 °C (6.64 fold). The DG transcriptional pattern after 72 h exposure was mainly characterized by a substantial decrease in the gene expression of the selected target when compared with the response after 24 h. Moreover, mt-10 and mt-20 were significantly downregulated in animals exposed to 22 °C and 26 °C in the presence of Ni.

26°C

4. Discussion 24H

72H

Fig. 5. QPCR data of cat (A), sod (B) and gst (C) targets. Gene expression was performed respect to the reference condition; 18 °C without Ni supply and was normalized against Actin, 18S and Ribo L27. *significantly different from reference condition, *P b 005 threshold cycle random reallocation test according to Pfaffl et al. (2002), n = 4. Mussels were exposed for 24 h and 72 h to Ni (137 μg/L) along with 8 °C temperature increase (18 °C, 22 °C and 26 °C).

24 h in DG of animals exposed to Ni and/or heat stress when compared to control animals. The maximum expression level was observed in animals exposed to 26 °C with Ni (4.33 fold for cat, 5.69 fold for sod and 14.67 fold for gst). The same pattern, was observed for mt-10 target after 24 h exposure with a maximum expression level obtained in DG of mussels exposed to 26 °C with Ni (5.54 fold when compared to control animals). However, after 24 h exposure, the mt-20 target was only differentially expressed in animals exposed to Ni at the physiological temperature

In this study, we have presented data concerning a set of antioxidant enzyme activities, metallothionein accumulation and their related gene expression in the DG tissues of mussels exposed to Ni and heat stress within 24 h and 72 h. Several environmental stressors can become toxic through the induction of oxidative stress. The effects of Ni on aquatic organisms were largely documented (Kienle et al., 2009; Vandenbrouck et al., 2009; Attig et al., 2010; Dondero et al., 2011), however, and to our knowledge, no studies investigated the effects of heat stress combined to Ni exposure on oxidative stress balance in mussels and the related transcriptional regulation of related genes that may occur in such situation. Our heavy metals analysis clearly showed different degrees of Ni loads in the DG tissues of mussels – metabolically the most active organ – from the different experimental conditions. Our results indicated a significant increase in Ni levels after 24 h exposure. The latter increase was more effective after 72 h. A significant effect of water

28

M. Banni et al. / Comparative Biochemistry and Physiology, Part C 160 (2014) 23–29

temperature was noted particularly in mussels exposed to 26 °C. Several studies suggested that metal accumulation in mollusks is dose and time dependent (Das and Jana, 1999; Attig et al., 2010; Negri et al., 2013). Our data showed a significant decrease of Ni loads in animals exposed to 26 °C when compared to mussels exposed to the lowest temperatures (18 °C and 22 °C). This reduction could be considered as a strategy to reduce the negative effect of the metal accumulation at elevated temperatures or just a negative effect of environmental stressors on the filtration rate of mussels. Exposure to Ni and heat stress clearly increased the activities of CAT, SOD and GST and rendered a significant increase in lipofuscine and neutral lipid accumulation after just 24 h. Interestingly, the gene expression analysis of the anti-oxidative stress genes (cat, sod, gst) in animals exposed to Ni and/or heat stress within 24 h, showed a marked upregulation pattern. The significant increase of the antioxidant activities was maintained after 72 h except for mussels exposed to Ni at 26 °C. The latter treatment exhibited the highest NL accumulation. It is well known that heat stress can cause a physiological disorder in animals, which directly affects the metabolism, resulting in the accumulation of ROS (Rajagopal et al., 2005a, 2005b; Verlecar et al., 2007). In addition to the direct production of free radicals, Ni was suspected to cause depletion of the antioxidant enzyme system (Denkhaus and Salnikov, 2002). Indeed Ni was reported to produce low but measurable levels of free radicals in CHO cells (Huang et al., 1994). Attig et al. (2010) reported a significant increase in the anti-oxidative stress enzymes in mussels exposed to sublethal Ni concentrations. Like other organisms, mussels can control the increasing levels of ROS in their tissues activating the cellular antioxidative defence system, composed of both enzymatic as well as non-enzymatic components. Enzymatic pathway consists of producing protective ROS-scavenging enzymes such as SOD and CAT which convert superoxide anions (O-2) into H2O2 and then into H2O and O2 (Halliwell and Gutteridge, 1999; Atli et al., 2006; Ruas et al., 2008). Thus, it is possible that in the present work, the early increase in the transcription of the anti-oxidative stress genes would contribute to the elimination of ROS from the cell induced by heat stress and Ni exposure. After 72 h exposure to Ni and/or heat stress, the antioxidant enzyme system was maintained as for 24 h except in animals exposed to 26 °C + Ni where it decreased, thus indicating a significant cytotoxicity due to the combination of the two stressors. However, the related gene expression pattern manifested a clear return to lower and in some cases to control values, suggesting a transcriptional gene expression regulation in the DG tissues of mussels exposed to the environmental stressors. Exposure to 22 °C and 26 °C was also responsible for the significant increase of MTs content in the DG tissues of animals within 24 h and 72 h. Moreover co-exposure to Ni and heat stress rendered the highest increase of the MTs content when compared to all conditions. Correlation between Ni exposure and MTs induction and to a lesser extent between heat stress and MT induction is controversial. Indeed, no correlation between MT and Ni concentrations in mussels exposed to Ni in field and laboratory conditions was reported by Amiard et al. (2008), However, Dondero et al. (2011) and Attig et al. (2010) demonstrated that mussels exposed to Ni displayed a significant increase of mt10 mRNA abundance and a significant increase of the metalloprotein, indicating that Ni ions behave in the same way as copper (Dondero et al., 2005). Moreover, Ni ions may bind to sulfhydryl groups of proteins (Costa et al., 1994) and MT induction by Ni was reported not only in vertebrates such as the cod Eleginus nawaga (Eriksen et al., 1991) but also in the copepod Tigriopus brevicornis (Barka et al., 2001). In terms of gene expression our data provided clues about the occurrence of a significant up-regulation of the mt-10 cognate in mussels exposed to Ni and/or heat stress and an up-regulation of the mt-20 target in mussels exposed to Ni at 18 °C and 22 °C within 24 h. However, after 72 h exposure, only mt-10 isoform was maintained up-regulated (18 °C + Ni). This may suggest an early stress response in terms of

Mts gene expression regulation. Although MT genes are primarily controlled at the level of transcription (Thiele, 1992), so that their mRNA levels display a remarkable increase following heavy metal exposure, the most common practice to utilize this parameter in biomonitoring programs has been the evaluation of the total MT protein content from a partially purified cytosolic extract (Tohyama et al., 1996; Viarengo et al., 1997). From data obtained in the present work it appears clearly that Mt gene expression does not rely directly on intracellular concentration of Ni but probably on the oxidative stress status of the cell as observed for heat stressed mussels. Therefore, it is of interest to establish the relation between Mts gene expression levels and the oxidative stress status of the DG cells. The higher induction of the mt-10 and mt-20 cognates in Ni and/or heat-treated animals could be attributed to the presence of both metal and ROS in the cells (Viarengo et al., 1999; Dondero et al., 2005). Indeed the metal transcription factor 1 (MTF-1), functioning as a sensor of intracellular Zn, is responsible for both basal and Zn/Cu mediated expression of MT-1 in mammalian (Sadhu and Gedamu, 1988). This transcription factor may function in mussels as a sensor of the redox state of the cell, triggering a rapid and specific response to the presence of unbuffered, highly electrophilic heavy metals or oxidants (Dondero et al., 2005). Similar results to the general early response in DG tissues of mussels exposed to Ni and temperature increase were reported in HepG2 cells exposed to sublethal Cu concentrations (Muller et al., 2007). Indeed authors of the later report identified two clusters of upregulated genes over time, an “early” cluster that comprised Mts genes and antioxidant genes and a “late” cluster, highly enriched in genes involved in proteasomal degradation. Moreover, Hsiao and Stapleton (2009) indicated that the early molecular events that occur in primary rat hepatocytes exposed to cadmium at a concentration of 4 μM are mostly characterized by changes in gene expression of proteins involved in transcriptional regulation, and heat shock protein expression, homeostasis and antioxidant capacity. 5. Conclusion The present study provided clues about the occurrence of an early gene expression regulation of antioxidant genes as well as Mts in Ni and heat stress exposed mussels. The related enzymatic activities and protein accumulations were maintained over time except for higher temperatures. Cat, sod, gst, mt-10 and mt-20 can be considered as part of the Ni and heat stress-early responsive genes prior to increases in measurable cytotoxic parameters. Teasing apart the mechanisms of gene expression changes in antioxidant related genes in such a way gives us a better understanding of the early cellular events associated with this sensing and protective response that occurs upon initial Ni and heat stress exposure. Further investigations on associated biological process such as protein folding and proteolysis are needed to establish clear picture of the cell response in the case of metal and heat stress exposure. Acknowledgments This work was supported by funds from Theme 6 of the EC Seventh Framework Program through the Marine Ecosystem Evolution in a Changing Environment Collaborative Project (Grant No. MEECE 212085) and by funds from the Ministry of Scientific Research and Technology, Tunisia (Unité de Recherche en Biochimie et Toxicologie Environnementale), ISA Chott-Mariem. References Amiard, J.C., Pineau, A., Boiteau, H.-L., Metayer, C., Amiard-Triquet, C., 1987. Application de la spectrométrie d'absorption atomique Zeeman aux dosages de huit éléments traces (Ag, Cd, Cr, Cu, Mn, Ni, Pb et Se) dans les matrices biologiques solides. Water Res. 21, 693–697.

M. Banni et al. / Comparative Biochemistry and Physiology, Part C 160 (2014) 23–29 Amiard, J.C., Journel, R., Bacheley, H., 2008. Influence of field and experimental exposure of mussels (Mytilus sp.) to nickel and vanadium on metallothionein concentration. Comp. Biochem. Physiol. C 147, 378–385. Atli, G., Alptekin, O., Tukel, S., Canli, M., 2006. Response of catalase activity to Ag2+, Cd2+, Cr2+, Cu2+ and Zn2+ in five tissues of freshwater fish Oreochromis niloticus. Comp. Biochem. Physiol. C 143, 218–224. Attig, H., Dagnino, A., Negri, A., Jebali, J., Boussetta, H., Viarengo, A., Dondero, F., Banni, M., 2010. Uptake and biochemical responses of mussels Mytilus galloprovincialis exposed to sublethal nickel concentrations. Ecotoxicol. Environ. Saf. 73 (7), 1712–1719. Banni, M., Messaoudi, I., Said, L., El Heni, J., Kerkeni, A., Said, K., 2010. Metallothionein gene expression in liver of rats exposed to cadmium and supplemented with zinc and selenium. Arch. Environ. Contam. Toxicol. 59 (3), 513–519. Banni, M., Negri, A., Mignone, F., Boussetta, H., Viarengo, A., Dondero, F., 2011. Gene expression rhythms in the mussel Mytilus galloprovincialis (Lam.) across an annual cycle. PLoS One 6 (5), e18904. Barka, S., Pavillon, J.F., Amiard, J.C., 2001. Influence of different essential and non-essential metals on MTLP levels in the copepod Tigriopus brevicornis. Comp. Biochem. Physiol. C 128, 479–493. Bielmyer, G.K., DeCarlo, C., Morris, C., Carrigan, T., 2013. The influence of salinity on acute nickel toxicity to the two euryhaline fish species, Fundulus heteroclitus and Kryptolebias marmoratus. Environ. Toxicol. Chem. 32 (6), 1354–1359. Bradford, M., 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162, 156–169. Claiborne, A., 1985. Catalase activity. In: Greenwald, R.A. (Ed.), CRC Handbook of Methods in Oxygen Radical Research. CRC Press, Florida, pp. 283–294. Costa, M., Zhuang, Z., Huang, X., Cosentino, S., Klein, C.B., Salnikov, K., 1994. Molecular mechanisms of nickel carcinogenesis. Sci. Total Environ. 148, 191–199. Crouch, R.K., Gandy, S.C., Kinsey, G., 1981. The inhibition of islet superoxide dismutase by diabetogenic drugs. Diabetes 30, 235–241. Das, S., Jana, B.B., 1999. Dose-dependent uptake and Eichhornia-induced elimination of cadmium in various organs of the freshwater mussel, Lamellidens marginalis (Linn.). Ecol. Eng. 12, 207–229. Denkhaus, E., Salnikov, K., 2002. Nickel essentiality, toxicity, and carcinogenicity. Crit. Rev. Oncol./Hematol. 42, 35–56. Dondero, F., Piacentini, L., Banni, M., Rebelo, M., Burlando, B., Viarengo, A., 2005. Quantitative PCR analysis of two molluscan metallothionein genes unveils differential expression and regulation. Gene 345, 259–270. Dondero, F., Banni, M., Negri, A., Boatti, L., Dagnino, A., Viarengo, A., 2011. Interactions of a pesticide/heavy metal mixture in marine bivalves: a transcriptomic assessment. BMC Genomics 12, 195. Eriksen, K.D.H., Andersen, T., Stenersen, J., 1991. Iso-metallothionein in cod induced by cadmium, zinc and nickel. Proceedings of the 12th Annual Conference on Physiological and Biochemical Approaches to the Toxicological Assessment of Environmental Pollution. Farcy, E., Voiseux, C., Lebel, J.M., Fiévet, B., 2009. Transcriptional expression levels of cell stress marker genes in the Pacific oyster Crassostrea gigas exposed to acute thermal stress. Cell Stress Chaperones 14, 371–380. Habig, W.H., Pabst, M.J., Jakoby, W.B., 1974. Glutathione S-transferases, the first step in mercapturic acid formation. J. Biol. Chem. 249, 7130–7139. Halliwell, B., Gutteridge, J.M.C., 1999. Free Radicals in Biology and Medicine. Clarendon Press, Oxford. Hsiao, C.J., Stapleton, S.R., 2009. Early sensing and gene expression profiling under a low dose of cadmium exposure. Biochimie 91, 329–343. Huang, X., Zhuang, Z., Frenkel, K., Klein, C.B., Costa, M., 1994. The role of nickel and nickel-mediated reactive oxygen species in the mechanism of nickel carcinogenesis. Environ. Health Perspect. 102 (Suppl. 3), 281–284. Kamel, N., Attig, H., Dagnino, A., Boussetta, H., Banni, M., 2012. Increased temperatures affect oxidative stress markers and detoxification response to benzo[a]pyrene exposure in mussel Mytilus galloprovincialis. Arch. Environ. Contam. Toxicol. 63 (4), 534–543. Kefaloyianni, E., Gourgou, E., Ferle, V., Kotsakis, E., Gaitanaki, C., Beis, I., 2005. Acute thermal stress and various heavy metals induce tissue-specific pro- or anti-apoptotic events via the p38-MAPK signal transduction pathway in Mytilus galloprovincialis (Lam.). J. Exp. Biol. 208 (Pt 23), 4427–4436.

29

Kienle, C., Kohler, H.R., Gerhardt, A., 2009. Behavioural and developmental toxicity of chlorpyrifos and nickel chloride to zebrafish (Danio rerio) embryos and larvae. Ecotoxicol. Environ. Saf. 72, 1740–1747. Livingstone, D.R., 2001. Contaminant-stimulated reactive oxygen species production and oxidative damage in aquatic organisms. Mar. Pollut. Bull. 42, 656–666. Lockwood, B.L., Sanders, J.G., Somero, G.N., 2010. Transcriptomic responses to heat stress in invasive and native blue mussels (genus Mytilus): molecular correlates of invasive success. J. Exp. Biol. 213, 3548–3558. Moore, M.N., 1988. Cytochemical responses of the lysosomal system and NADPH ferri-hemoprotein reductase in molluscan digestive cells to environmental and experimental exposure to xenobiotics. Mar. Ecol. Prog. Ser. 46, 81–89. Muller, P., van Bakel, H., van de Sluis, B., Holstege, F., Wijmenga, C., Klomp, L.W., 2007. Gene expression profiling of liver cells after copper overload in vivo and in vitro reveals new copper-regulated genes. J. Biol. Inorg. Chem. 12 (4), 495–507. Negri, A., Oliveri, C., Sforzini, S., Mignione, F., Viarengo, A., Banni, M., 2013. Transcriptional response of the mussel Mytilus galloprovincialis (Lam.) following exposure to heat stress and copper. PLos One. http://dx.doi.org/10.1371/journal.pone.0066802. Pane, E.F., Smith, C., McGeer, J.C., Wood, C.M., 2003. Mechanism of acute and chronic waterborne nickel toxicity in the freshwater cladoceran Daphni magna. Environ. Sci. Technol. 37, 4382–4389. Papachristou, P., Haralambous, K.J., Loizidou, N., Spyrellis, N., 1993. Studies on the nickel removal from aqueous solutions. J. Environ. Sci. Health A 28 (1), 135–142. Park, H., Ahn, I.Y., Lee, H.E., 2007. Expression of heat shock protein 70 in the thermally stressed Antarctic clam Laternula elliptica. Cell Stress Chaperones 12 (3), 275–282. Pfaffl, M.W., Horgan, G.W., Dempfle, L., 2002. Relative expression software tool (REST) for groupwise comparison and statistical analysis of relative expression results in realtime PCR. Nucleic Acids Res. 30, e36. Rajagopal, S., van der Velde, G., van der Gaag, M., Jenner, H.A., 2005a. Factors influencing the upper temperature tolerances of three mussel species in a brackish water canal: size, season and laboratory protocols. Biofouling 21 (2), 87–97. Rajagopal, S., Van der Gaag, M., Van der Velde, G., Jenner, H.A., 2005b. Upper temperature tolerances of exotic brackish-water mussel, Mytilopsis leucophaeata (Conrad): an experimental study. Mar. Environ. Res. 60, 512–530. Ruas, C.B.G., Carvalho, CdS, De Araujo, H.S.S., Espindola, E.L.G., Fernandes, M.N., 2008. Oxidative stress biomarkers of exposure in the blood of cichlid species from a metal-contaminated river. Ecotoxicol. Environ. Saf. 71, 86–93. Sadhu, C., Gedamu, L., 1988. Regulation of human metallothionein (MT) genes. Differential expression of MTI-F, MTI-G, and MTII-A genes in the hepatoblastoma cell line (HepG2). J. Biol. Chem. 263, 2679–2684. Scholze, M., Knorr, W., Arnell, N.W., Prentice, I.C., 2006. A climate-change risk analysis for world ecosystems. Proc. Natl. Acad. Sci. U. S. A. 103 (35), 13116–13120. Sokolova, I.M., 2004. Cadmium effects on mitochondrial function are enhanced by elevated temperatures in a marine poikilotherm, Crassostrea virginica Gmelin (Bivalvia: Ostreidae). J. Exp. Biol. 207, 2639–2648. Thiele, D.J., 1992. Metal regulated transcription in eukaryotes. Nucleic Acid Res. 20, 1183–1191. Tohyama, C., Satoh, M., Kodama, N., Nishimura, H., Choo, A., Michalska, A., Kanayama, Y., Naganuma, A., 1996. Reduced retention of cadmium in the liver of metallothioneinnull mice. Environ. Toxicol. Pharmacol. 1, 213–216. Tomanek, L., Zuzow, M.J., 2010. The proteomic response of the mussel congeners Mytilus galloprovincialis and M. trossulus to acute heat stress: implications for thermal tolerance limits and metabolic costs of thermal stress. J. Exp. Biol. 213, 3559–3574. Vandenbrouck, T., Soetaert, A., Van der Ven, K., Blust, R., De Coen, W., 2009. Nickel and binary metal mixture responses in Daphnia magna: molecular fingerprints and (sub) organismal effects. Aquat. Toxicol. 92 (1), 18–29. Verlecar, X.N., Jena, K.B., Chainy, G.B., 2007. Biochemical markers of oxidative stress in Perna viridis exposed to mercury and temperature. Chem. Biol. Interact. 167 (3), 219–226. Viarengo, A., Ponzano, E., Dondero, F., Fabbri, R., 1997. A simple spectrophotometric method for metallothionein evaluation in marine organisms: an application to Mediterranean and Antarctic molluscs. Mar. Environ. Res. 44, 69–84. Viarengo, A., Burlando, B., Cavaletto, M., Marchi, B., Ponzano, E., Blasco, J., 1999. Role of metallothionein against oxidative stress in the mussel Mytilus galloprovincialis. Am. J. Physiol. 277, 1612–1619.