RESEARCH LETTER
Transcriptional analysis of different stress response genes in Escherichia coli strains subjected to sodium chloride and lactic acid stress € rg Hummerjohann2 & Taurai Tasara1 Silvio Peng1,2, Roger Stephan1, Jo 1
Institute for Food Safety and Hygiene, Vetsuisse Faculty University of Zurich, Zurich, Switzerland; and 2Agroscope Institute for Food Sciences, Bern, Switzerland
Correspondence: Taurai Tasara, Institute for Food Safety and Hygiene, Vetsuisse Faculty University of Zurich, Winterthurerstrasse 272, CH-8057 Zurich, Switzerland. Tel.: +41 44 635 8651; fax: +41 44 635 8908; e-mail: [email protected] Received 11 August 2014; revised 24 September 2014; accepted 7 October 2014. Final version published online 31 October 2014. DOI: 10.1111/1574-6968.12622
MICROBIOLOGY LETTERS
Editor: S eamus Fanning Keywords gene expression; quantitative RT-PCR; sodium chloride stress; lactic acid stress; raw milk cheese; Shiga toxin-producing Escherichia coli.
Abstract Survival of Escherichia coli in food depends on its ability to adapt against encountered stress typically involving induction of stress response genes. In this study, the transcriptional induction of selected acid (cadA, speF) and salt (kdpA, proP, proW, otsA, betA) stress response genes was investigated among five E. coli strains, including three Shiga toxin-producing strains, exposed to sodium chloride or lactic acid stress. Transcriptional induction upon lactic acid stress exposure was similar in all but one E. coli strain, which lacked the lysine decarboxylase gene cadA. In response to sodium chloride stress exposure, proW and otsA were similarly induced, while significant differences were observed between the E. coli strains in induction of kdpA, proP and betA. The kdpA and betA genes were significantly induced in four and three strains, respectively, whereas one strain did not induce these genes. The proP gene was only induced in two E. coli strains. Interestingly, transcriptional induction differences in response to sodium chloride stress exposure were associated with survival phenotypes observed for the E. coli strains in cheese as the E. coli strain lacking significant induction in three salt stress response genes investigated also survived poorly compared to the other E. coli strains in cheese.
Introduction In food products, Escherichia coli must adapt against various stressors including elevated salt concentrations and organic acids to survive. This adaptation is performed through activation of different cellular response mechanisms that may allow survival and growth in food such as raw milk cheese (Peng et al., 2011). Survival of Shiga toxin-producing E. coli (STEC) in food poses a food safety risk. STEC transmission, although frequently associated with undercooked contaminated meat and meat products, can also occur through other food products including raw milk products, which have in the past been implicated in STEC disease outbreaks (Baylis, 2009; Farrokh et al., 2012). It is thus important to understand the transcriptional induction of stress response genes involved in mechanisms that allow E. coli to survive in food. In a recent study, differences in survival ability among five different E. coli strains were observed during FEMS Microbiol Lett 361 (2014) 131–137
production and ripening of semi-hard raw milk cheese (Peng et al., 2013). Although reasons for such survival differences between strains remain unknown, it was hypothesized that they are in part associated with strain differences in activation of specific stress response genes. In this study, the transcriptional induction of two acid (cadA and speF) and five salt (kdpA, proP, proW, otsA and betA) stress response genes was investigated among five E. coli strains exposed to sodium chloride and lactic acid stress mimicking conditions encountered during production and ripening of foods such as raw milk cheese. The acid stress response genes examined encode lysine (cadA) and ornithine (speF)-dependent decarboxylase enzymes involved in metabolic mechanisms that consume cytoplasmic protons to balance the intracellular pH (Zhao & Houry, 2010). The selected salt stress response genes include kdpA, encoding the binding and translocation subunit KdpA of the Kdp-ATPase system, ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
132
which is a transport system involved in potassium accumulation as part of the initial cellular salt stress response (Ballal et al., 2007). Initial potassium uptake during salt stress adaptation is eventually replaced by compatible solutes. The latter are either imported from external environments or intracellularly synthesized, and in contrast to potassium ions, compatible solutes can be accumulated in high concentrations within bacterial cells without compromising other cellular functions (Wood, 1999). The proP and proW genes encode proteins of the compatible solute–proton symporter ProP and the ProU transport system, respectively. Both transport systems are responsible for the uptake of compatible solutes such as glycine betaine (Wood, 1999). Trehalose is a compatible solute synthesized from glucose molecules by trehalose-6-phosphate synthase (otsA) and trehalose6-phosphate phosphatase (otsB), which was shown to protect microbial cells, including E. coli, against salt and other stress conditions (Elbein et al., 2003). For the intracellular synthesis of glycine betaine, choline is imported and converted to glycine betaine by proteins encoded by the bet genes. The betA gene encodes choline and betaine aldehyde dehydrogenase BetA (Andresen et al., 1988). The aim of this study was to compare the transcriptional induction of this set of seven stress response genes under cheese-related lactic acid and sodium chloride stress conditions among five E. coli strains that previously displayed different survival phenotypes during raw milk cheese production and ripening.
Materials and methods Bacterial strains
The strains used in this study included two generic E. coli (K303 and FAM21843, that were both negative for Shiga toxin (stx) and intimin (eae) genes) and three STEC [K331-4 (stx1, stx2), K356 (stx2) and N09-1208 (stx1, eae)] strains that were previously isolated from cheese or vat milk (Zweifel et al., 2010). Stress exposure and RNA purification
The exposure of E. coli strains to sodium chloride and lactic acid stress conditions was conducted as previously described (Peng et al., 2014). Briefly, single colonies were inoculated into 5 mL Luria–Bertani broth (LB, also called lysogeny broth) and grown for 8 h at 37 °C and 200 r.p.m. The primary cultures were diluted (1 : 100) into 5 mL of LB and grown for 16–18 h at 37 °C and 200 r.p.m to give secondary stationary phase cultures, which were subsequently inoculated (1 : 100) ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
S. Peng et al.
into 25 mL of LB. The tertiary culture was grown (37 °C and 200 r.p.m.) until an OD590 nm = 1.50 0.05 (corresponding to about 109 CFU mL 1 in stationary phase) was reached. Aliquots of 10 mL from tertiary cultures were subsequently centrifuged (5 min at 5000 g). Recovered E. coli cells were resuspended in either (1) regular LB (control); (2) LB acidified to pH 5.2 using lactic acid (Merck AG, Zug, Switzerland); or (3) LB plus 5% (w/v) sodium chloride (Sigma-Aldrich Chemie GmbH, Buchs, Switzerland). After 15 and 60 min of exposure at 37 °C, samples were taken from the different LB variants and RNA was purified as described in Arguedas-Villa et al. (2010). RNA was quantified and quality controlled using the Nanodrop and BioAnalyzer instruments. cDNA synthesis
The QuantiTect reverse transcription kit (Qiagen AG, Hombrechtikon, Switzerland) was used to convert 100 ng of each total RNA sample into cDNA in duplicate. For each RNA sample, a no-reverse transcriptase (noRT) control sample was included. Postreverse transcription, the cDNA and noRT samples were diluted 1 : 10 in RNasefree water. Quantitative real-time PCR
Quantitative real-time PCR was performed using a Light Cycler 480 instrument (Roche Molecular Diagnostics, Rotkreuz, Switzerland). PCR primers used are listed in Table 1. Initially, the optimal primer concentrations and amplification efficiency for each PCR primer pair were determined using genomic DNA templates that were derived from each of the examined E. coli strains. Reactions were performed in 10 lL including QuantiTect SYBR Green PCR master mix (Qiagen; 5 lL), primer mix (2 lL) and genomic DNA or cDNA templates (3 lL). Each sample was assayed in triplicate, while including water and noRT samples as negative controls and the calibrator RNA sample, which was included in every qRT-PCR run and subsequently used to normalize the relative quantification data for run to run variation. Thermocycling conditions were as described by Peng et al. (2014). The 16S rRNA gene (rrsA) previously shown to be the most suitable internal reference gene under the experimental conditions applied in this study (Peng et al., 2014) was used as a normalizer for relative quantification of the analysed stress response genes using the Light Cycler 480 relative quantification software. Transcriptional fold induction of each gene under stress was calculated relative to transcript levels found in corresponding LB control samples that were not subjected to stress. FEMS Microbiol Lett 361 (2014) 131–137
133
Reference
This study This study This study This study This study This study Zhou et al. (2011) This study
Efficiency of qPCR (%)
94.7 93.9 95.6 94.0 89.4 94.2 92.4 92.4 0.25 0.25 0.50 0.50 0.25 0.25 0.25 0.25 123 82 86 90 136 84 105 122 GCTGGCGGAGTTTGATATTCC TGGCTCAGAATATCCACAAACTG TGTGGGCGATGTCAGTGATT ACTGCGTGACGGGATGAA CTGGCTGGACTTCGGTTCTA GGGTTGGGTCAGATGGTACT CTCTTGCCATCGGATGTGCCCA CGCTTCTTCCAGTTTGTACCA Glycine betaine synthesis Lysine decarboxylase Uptake of potassium Trehalose synthesis Uptake of compatible solutes Uptake of compatible solutes 16S ribosomal RNA Ornithine decarboxylase betA cadA kdpA otsA proP proW rrsA speF
AGGGCAGGGTAGAGGGAAA ATCGTCGGCAGCACTTCAA CAGTGCCAGCAGATGAGGAT GCAAATTGCGAAAGAACAAGAAC CCCTAACGGCAGAGCGATAA CGAGGATAATGGCGAGGATCA CCAGTGTGGCTGGTCATCCTCTCA CCGTTACGTGCATCAATACCT
Final primer concentration (lM) Amplicon size (bp) Forward primer Function
Reverse primer
Statistical analysis
Statistical analysis was performed using the IBM SPSS Statistics version 22 (IBM Corp., Armonk, NY) program. Fold induction ratios were normalized by log10 transformation and subsequently analysed by one-way analysis of variance (ANOVA) test including Tukey’s post hoc test. Fold induction change cut-off value of 2.0 (corresponding to 0.301 after log transformation) was applied to define significant up- and downregulation of the stress response genes, respectively.
Results
Gene
Table 1. Primers used in this study. The primers were designed using the
PRIMER3WEB
version 4.0.0 (Untergrasser et al., 2012) and produced by Microsynth AG (Balgach, Switzerland)
Transcriptional analysis of stress response genes in E. coli
FEMS Microbiol Lett 361 (2014) 131–137
Induction of stress response genes under lactic acid stress exposure
Among the acid stress response genes tested, cadA was induced, whereas speF was not induced in response to lactic acid stress exposure (Fig. 1). Four of the five E. coli strains tested displayed similar cadA induction after 15 min of organic acid stress. In all these strains, no induction of this gene was detectable after prolonged lactic acid stress exposure (60 min). Meanwhile, PCR analysis showed that the fifth strain tested, FAM21843, lacks the cadA gene. No cadA amplicons were detected in this strain using primers that flank the cadA gene locus or those used for qPCR that bind within the cadA gene (data not shown). Furthermore, these findings were supported by the lack of lysine decarboxylase activity in this strain in biochemical tests (data not shown). In some, but not all E. coli strains tested, the salt stress response genes otsA and kdpA also showed lactic acid stress-dependent induction. Induction of otsA in FAM21843 and K331-4 was detected after 15 min of lactic acid stress, and kdpA induction in N09-1208 and FAM21843 was detected after 60 min of lactic acid stress. The speF gene as well as all the five salt stress response genes examined showed no significant upregulation, whereas in some strains, they were significantly downregulated in response to lactic acid stress exposure. Induction of stress response genes under sodium chloride stress exposure
Significant sodium chloride stress-dependent kdpA induction was detected after 60 min but not after 15 min of stress exposure in four of the five E. coli strains tested (Fig. 2). The highest kdpA induction was detected in the two generic E. coli strains K303 and FAM21843. Strain K331-4, on the other hand, did not show a significant kdpA induction under the sodium chloride stress conditions applied in this study. The generic E. coli strains
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
134
S. Peng et al.
Fig. 1. Lactic acid stress-dependent fold induction of cadA, speF, kdpA, proP, proW, betA and otsA transcript levels in five E. coli strains. Transcript levels in organisms exposed to lactic acid acidified LB at pH 5.2 and controls exposed to normal LB were determined relative to the rrsA (16S rRNA) reference gene. The fold induction of each gene in response to lactic acid stress was calculated by dividing relative transcript levels in lactic acid stress exposed organisms with those levels of regular LB exposed controls. Results show the log-transformed mean fold inductions and standard deviations based on three independent experiments in which each sample was assayed in duplicate. Same symbols above the bars indicate that no statistically significant differences (P < 0.05) were observed between relative transcript levels of the E. coli strains for the respective gene based on Tukey’s post hoc test. The dotted lines indicate the fold induction change cut-off value 2.0 (corresponding to 0.301 after log transformation) corresponding to the threshold level for significant up- and downregulation of the stress response genes.
FAM21843 and K303 also showed a significant proP induction after 15 and 60 min of sodium chloride stress exposure, respectively. In contrast, none of the three STEC strains (K331-4, K356 and N09-1208) examined showed proP induction in response to sodium chloride stress. The induction of proW during sodium chloride stress exposure occurred faster in the strains K331-4, K303 and FAM21843. These strains, in contrast to K356 and N09-1208 strains, already showed induction after 15 min of stress exposure. Nevertheless, all five strains exhibited a significant proW induction after 60 min of sodium chloride stress. The otsA gene was similarly induced in all five strains, while betA was only significantly induced in the strains K356, N09-1208 and FAM21843 after 60 min sodium chloride stress exposure. The K331-4 strain did not show significant betA induction under sodium chloride stress. The K303 strain lacked ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
the betA gene based on PCR analysis using primers that flank the betA locus or that bind within the betA gene (data not shown). In all tested strains, lysine decarboxylase cadA was downregulated by sodium chloride stress, whereas ornithine decarboxylase speF was induced in only one strain (N09-1208) after 60 min of sodium chloride stress exposure.
Discussion Sodium chloride and lactic acid stresses are common stressors encountered by microorganisms in food. The current study compared the transcriptional induction of two acid (cadA and speF) and five salt (kdpA, otsA, proP, proW and betA) stress response genes among five E. coli strains upon exposure to lactic acid or sodium chloride stress conditions that are similar to those that may be FEMS Microbiol Lett 361 (2014) 131–137
Transcriptional analysis of stress response genes in E. coli
135
Fig. 2. Sodium chloride stress-dependent fold induction of cadA, speF, kdpA, proP, proW, betA and otsA transcript levels in five E. coli strains. Transcript levels in organisms exposed to LB with 5% (w/v) additional sodium chloride and controls exposed to normal LB were determined relative to the rrsA (16S rRNA) reference gene. The fold induction of each gene in response to sodium chloride stress was calculated by dividing relative transcript levels in sodium chloride stress exposed organisms with those levels of regular LB exposed controls. Results show the logtransformed mean fold inductions and standard deviations based on three independent experiments in which each sample was assayed in duplicate. Same symbols above the bars indicate that no statistically significant differences (P < 0.05) were observed between relative transcript levels of the E. coli strains for the respective gene based on Tukey’s post hoc test. The dotted lines indicate the fold induction change cut-off value 2.0 (corresponding to 0.301 after log transformation) corresponding to the threshold level for significant up- and downregulation of the stress response genes.
encountered by these organisms in food such as during raw milk cheese production and ripening. The stress exposure was conducted for each stress separately at optimized conditions of E. coli growth to gain insight into the transcriptional induction of the single stress response mechanisms and to compare the five strains to each other under conditions where there is minimal possible influence from other external stress factors. The timescale was selected to analyse the immediate induction in the stress response genes and proteins, which can be rapidly induced upon stress exposure (Weber et al., 2006), while after prolonged stress exposure, the mRNA levels are expected to decline to normal levels. Lactic acid stress invoked similar fold induction of cadA transcripts in four of the five E. coli strains examined. One of the examined strains, FAM21843, lacked the cadA gene, and consequently, lysine decarboxylase enzyme FEMS Microbiol Lett 361 (2014) 131–137
activity encoded by this gene. The survival of FAM21843 in cheese was previously found not to be significantly impaired compared to the other four E. coli strains (Peng et al., 2013). These findings suggest that lysine decarboxylase activity is not mandatory for FAM21843 to survive the cheese production process. However, it cannot be ruled out that FAM21843 possesses other acid stress adaptive mechanisms that compensate for the lack of lysine decarboxylase CadA. The other tested acid stress response gene, speF, was not induced in all five E. coli strains upon lactic acid stress exposure. This could have been due to the fact that the pH of 5.2 applied in this study is lower than the activity optimum of SpeF, which is at pH 6.9 (Zhao & Houry, 2010). Meanwhile, other known acid resistance systems such as the glutamate and arginine decarboxylase systems were deliberately not investigated in this study as they mainly function at a ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
136
lower pH (Zhao & Houry, 2010). Among the five salt stress response genes examined, kdpA and otsA genes were also found to be induced in at least one E. coli strain upon lactic acid stress exposure, while proP, proW and betA were not induced. To our knowledge, the Kdp-ATPase system was not yet shown to take part in acid stress response. The otsA gene takes part in the synthesis of trehalose, which is a stabilizer for proteins and membranes (Elbein et al., 2003). Increased trehalose production may assist in counteracting stress imposed by organic acids such as lactic acid, as these are associated with disruption of membrane integrity and function of various other cellular proteins. However, it remains to be elucidated, if the trehalose synthesis pathway, including otsA, has a beneficial effect on the survival of certain E. coli strains in food with respect to lactic acid stress. The downregulation observed for speF and the majority of the salt stress response genes might be a consequence of these stress response systems being not essential for adaptation to the conditions induced by lactic acid stress. A downregulation of lysine decarboxylase CadA was detected in all four E. coli strains during sodium chloride stress exposure, potentially as this system is not required to counteract salt stress encountered. Ornithine decarboxylase SpeF, on the other hand, was induced in strain N091208, but not in the other four E. coli strains, in response to sodium chloride stress. However, the speF gene is currently not known to directly contribute to salt stress response mechanisms. Its induction may serve to promote the uptake of ornithine from LB, independent of the stress encountered. The initial response of E. coli to sodium chloride stress is the uptake of potassium by the KdpFABC complex, which includes the binding and translocating subunit KdpA. The kdpA induction during sodium chloride stress exposure was higher for the two generic E. coli strains K303 and FAM21843 than that observed in two of the STEC strains K356 and N09-1208. The third STEC strain, K331-4, did not show a significant kdpA induction in response to sodium chloride stress. Interestingly, the kdpA induction pattern observed in response to sodium chloride-based stress among the five E. coli strains reflected their survival phenotypes previously observed during raw milk cheese production (Peng et al., 2013). The two generic E. coli strains K303 and FAM21843 with the highest kdpA inductions survived better than K356 and N09-1208, while strain K331-4 was the worst survivor of all the five E. coli strains. The proP and proW genes encode components of two independent systems responsible for the uptake of compatible solutes. During sodium chloride stress exposure, the two generic E. coli strains exhibited a significant induction in proP, whereas the three STEC strains did not. However, these strains may still have compensated the lack in proP induction by the ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
S. Peng et al.
other systems involved in uptake and synthesis of compatible solutes such as proW and otsA, which were both significantly induced by all five E. coli strains after 60 min of sodium chloride stress exposure. The betA gene was significantly induced in K356, N09-1208 and FAM21843. Strain K331-4 did not show sodium chloride stress-dependent betA induction, whereas strain K303 lacks the betA gene. Although lacking the betA gene, K303 did not show an impaired survival in raw milk cheese compared to the E. coli strains able to induce betA (Peng et al., 2013). The differences in the transcriptional induction of the salt stress response genes among the five E. coli strains showed some associations with the survival phenotypes previously observed during production and ripening of semi-hard raw milk cheese. In particular, strain K331-4 showed a considerably weaker survival in cheese compared to the other four E. coli strains, correlating with its weaker or absent induction of the salt stress response genes kdpA, proP and betA during sodium chloride stress exposure. Furthermore, the two generic E. coli strains, which survived better than the three STEC strains during raw milk cheese production and ripening, were the only strains significantly inducing proP, indicating that uptake of compatible solutes might be beneficial for E. coli survival in cheese. However, further investigations on the importance of the different salt stress response genes are required to elucidate their contribution alone and in combination to the survival of E. coli in food such as raw milk cheese. In contrast to the salt stress response gene expression, the acid stress response was similar in four of the five E. coli strains assayed. Interestingly, at the pH applied, cadA would be expected to function as the major acid resistance gene. The strain FAM21843, however, lacks the lysine decarboxylase gene and was not significantly impaired in survival during raw milk cheese production. It remains to be elucidated how this strain compensates the lack of lysine decarboxylase activity during lactic acid stress exposure or if this activity is not critical for E. coli survival in food such as raw milk cheese.
References Andresen PA, Kaasen I, Styrvold OB, Boulnois G & Strom AR (1988) Molecular cloning, physical mapping and expression of the bet genes governing the osmoregulatory choline-glycine betaine pathway of Escherichia coli. J Gen Microbiol 134: 1737–1746. Arguedas-Villa C, Stephan R & Tasara T (2010) Evaluation of cold growth and related gene transcription responses associated with Listeria monocytogenes strains of different origins. Food Microbiol 27: 653–660. Ballal A, Basu B & Apte SK (2007) The Kdp-ATPase system and its regulation. J Biosci 32: 559–568.
FEMS Microbiol Lett 361 (2014) 131–137
Transcriptional analysis of stress response genes in E. coli
Baylis C (2009) Raw milk and raw milk cheeses as vehicles for infection by Verocytotoxin-producing Escherichia coli. Int J Dairy Technol 62: 293–307. Elbein AD, Pan YT, Pastuszak I & Carroll D (2003) New insights on trehalose: a multifunctional molecule. Glycobiology 13: 17R–27R. Farrokh C, Jordan K, Auvray F et al. (2012) Review of Shiga-toxin-producing Escherichia coli (STEC) and their significance in dairy production. Int J Food Microbiol 162: 190–212. Peng S, Tasara T, Hummerjohann J & Stephan R (2011) An overview of molecular stress response mechanisms in Escherichia coli contributing to survival of Shiga toxin-producing Escherichia coli during raw milk cheese production. J Food Prot 74: 849–864. Peng S, Hoffmann W, Bockelmann W, Hummerjohann J, Stephan R & Hammer P (2013) Fate of Shiga toxin-producing and generic Escherichia coli during production and ripening of semihard raw milk cheese. J Dairy Sci 96: 815–823. Peng S, Stephan R, Hummerjohann J & Tasara T (2014) Evaluation of three reference genes of Escherichia coli for mRNA expression level normalization in view of salt and
FEMS Microbiol Lett 361 (2014) 131–137
137
organic acid stress exposure in food. FEMS Microbiol Lett 355: 78–82. Untergrasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M & Rozen SG (2012) PRIMER3 – new capabilities and intercases. Nucleic Acids Res 40: e115. Weber A, K€ ogl SA & Jung K (2006) Time-dependent proteome alterations under osmotic stress during aerobic and anaerobic growth in Escherichia coli. J Bacteriol 188: 7165– 7175. Wood JM (1999) Osmosensing by bacteria: signals and membrane-based sensors. Microbiol Mol Biol Rev 63: 230–262. Zhao B & Houry WA (2010) Acid stress response in enteropathogenic gammaproteobacteria: an aptitude for survival. Biochem Cell Biol 88: 301–314. Zhou K, Zhou L, Lim Q, Zou R, Stephanopoulos G & Too HP (2011) Novel reference genes for quantifying transcriptional responses of Escherichia coli to protein overexpression by quantitative PCR. BMC Mol Biol 12: 18. Zweifel C, Giezendanner N, Corti S, Krause G, Beutin L, Danuser J & Stephan R (2010) Characteristics of Shiga toxin-producing Escherichia coli isolated from Swiss raw milk cheese within a 3-year monitoring program. J Food Prot 73: 88–91.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
Transcriptional analysis of different stress response genes in Escherichia coli strains subjected to sodium chloride and lactic acid stress € rg Hummerjohann2 & Taurai Tasara1 Silvio Peng1,2, Roger Stephan1, Jo 1
Institute for Food Safety and Hygiene, Vetsuisse Faculty University of Zurich, Zurich, Switzerland; and 2Agroscope Institute for Food Sciences, Bern, Switzerland
Correspondence: Taurai Tasara, Institute for Food Safety and Hygiene, Vetsuisse Faculty University of Zurich, Winterthurerstrasse 272, CH-8057 Zurich, Switzerland. Tel.: +41 44 635 8651; fax: +41 44 635 8908; e-mail: [email protected] Received 11 August 2014; revised 24 September 2014; accepted 7 October 2014. Final version published online 31 October 2014. DOI: 10.1111/1574-6968.12622
MICROBIOLOGY LETTERS
Editor: S eamus Fanning Keywords gene expression; quantitative RT-PCR; sodium chloride stress; lactic acid stress; raw milk cheese; Shiga toxin-producing Escherichia coli.
Abstract Survival of Escherichia coli in food depends on its ability to adapt against encountered stress typically involving induction of stress response genes. In this study, the transcriptional induction of selected acid (cadA, speF) and salt (kdpA, proP, proW, otsA, betA) stress response genes was investigated among five E. coli strains, including three Shiga toxin-producing strains, exposed to sodium chloride or lactic acid stress. Transcriptional induction upon lactic acid stress exposure was similar in all but one E. coli strain, which lacked the lysine decarboxylase gene cadA. In response to sodium chloride stress exposure, proW and otsA were similarly induced, while significant differences were observed between the E. coli strains in induction of kdpA, proP and betA. The kdpA and betA genes were significantly induced in four and three strains, respectively, whereas one strain did not induce these genes. The proP gene was only induced in two E. coli strains. Interestingly, transcriptional induction differences in response to sodium chloride stress exposure were associated with survival phenotypes observed for the E. coli strains in cheese as the E. coli strain lacking significant induction in three salt stress response genes investigated also survived poorly compared to the other E. coli strains in cheese.
Introduction In food products, Escherichia coli must adapt against various stressors including elevated salt concentrations and organic acids to survive. This adaptation is performed through activation of different cellular response mechanisms that may allow survival and growth in food such as raw milk cheese (Peng et al., 2011). Survival of Shiga toxin-producing E. coli (STEC) in food poses a food safety risk. STEC transmission, although frequently associated with undercooked contaminated meat and meat products, can also occur through other food products including raw milk products, which have in the past been implicated in STEC disease outbreaks (Baylis, 2009; Farrokh et al., 2012). It is thus important to understand the transcriptional induction of stress response genes involved in mechanisms that allow E. coli to survive in food. In a recent study, differences in survival ability among five different E. coli strains were observed during FEMS Microbiol Lett 361 (2014) 131–137
production and ripening of semi-hard raw milk cheese (Peng et al., 2013). Although reasons for such survival differences between strains remain unknown, it was hypothesized that they are in part associated with strain differences in activation of specific stress response genes. In this study, the transcriptional induction of two acid (cadA and speF) and five salt (kdpA, proP, proW, otsA and betA) stress response genes was investigated among five E. coli strains exposed to sodium chloride and lactic acid stress mimicking conditions encountered during production and ripening of foods such as raw milk cheese. The acid stress response genes examined encode lysine (cadA) and ornithine (speF)-dependent decarboxylase enzymes involved in metabolic mechanisms that consume cytoplasmic protons to balance the intracellular pH (Zhao & Houry, 2010). The selected salt stress response genes include kdpA, encoding the binding and translocation subunit KdpA of the Kdp-ATPase system, ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
132
which is a transport system involved in potassium accumulation as part of the initial cellular salt stress response (Ballal et al., 2007). Initial potassium uptake during salt stress adaptation is eventually replaced by compatible solutes. The latter are either imported from external environments or intracellularly synthesized, and in contrast to potassium ions, compatible solutes can be accumulated in high concentrations within bacterial cells without compromising other cellular functions (Wood, 1999). The proP and proW genes encode proteins of the compatible solute–proton symporter ProP and the ProU transport system, respectively. Both transport systems are responsible for the uptake of compatible solutes such as glycine betaine (Wood, 1999). Trehalose is a compatible solute synthesized from glucose molecules by trehalose-6-phosphate synthase (otsA) and trehalose6-phosphate phosphatase (otsB), which was shown to protect microbial cells, including E. coli, against salt and other stress conditions (Elbein et al., 2003). For the intracellular synthesis of glycine betaine, choline is imported and converted to glycine betaine by proteins encoded by the bet genes. The betA gene encodes choline and betaine aldehyde dehydrogenase BetA (Andresen et al., 1988). The aim of this study was to compare the transcriptional induction of this set of seven stress response genes under cheese-related lactic acid and sodium chloride stress conditions among five E. coli strains that previously displayed different survival phenotypes during raw milk cheese production and ripening.
Materials and methods Bacterial strains
The strains used in this study included two generic E. coli (K303 and FAM21843, that were both negative for Shiga toxin (stx) and intimin (eae) genes) and three STEC [K331-4 (stx1, stx2), K356 (stx2) and N09-1208 (stx1, eae)] strains that were previously isolated from cheese or vat milk (Zweifel et al., 2010). Stress exposure and RNA purification
The exposure of E. coli strains to sodium chloride and lactic acid stress conditions was conducted as previously described (Peng et al., 2014). Briefly, single colonies were inoculated into 5 mL Luria–Bertani broth (LB, also called lysogeny broth) and grown for 8 h at 37 °C and 200 r.p.m. The primary cultures were diluted (1 : 100) into 5 mL of LB and grown for 16–18 h at 37 °C and 200 r.p.m to give secondary stationary phase cultures, which were subsequently inoculated (1 : 100) ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
S. Peng et al.
into 25 mL of LB. The tertiary culture was grown (37 °C and 200 r.p.m.) until an OD590 nm = 1.50 0.05 (corresponding to about 109 CFU mL 1 in stationary phase) was reached. Aliquots of 10 mL from tertiary cultures were subsequently centrifuged (5 min at 5000 g). Recovered E. coli cells were resuspended in either (1) regular LB (control); (2) LB acidified to pH 5.2 using lactic acid (Merck AG, Zug, Switzerland); or (3) LB plus 5% (w/v) sodium chloride (Sigma-Aldrich Chemie GmbH, Buchs, Switzerland). After 15 and 60 min of exposure at 37 °C, samples were taken from the different LB variants and RNA was purified as described in Arguedas-Villa et al. (2010). RNA was quantified and quality controlled using the Nanodrop and BioAnalyzer instruments. cDNA synthesis
The QuantiTect reverse transcription kit (Qiagen AG, Hombrechtikon, Switzerland) was used to convert 100 ng of each total RNA sample into cDNA in duplicate. For each RNA sample, a no-reverse transcriptase (noRT) control sample was included. Postreverse transcription, the cDNA and noRT samples were diluted 1 : 10 in RNasefree water. Quantitative real-time PCR
Quantitative real-time PCR was performed using a Light Cycler 480 instrument (Roche Molecular Diagnostics, Rotkreuz, Switzerland). PCR primers used are listed in Table 1. Initially, the optimal primer concentrations and amplification efficiency for each PCR primer pair were determined using genomic DNA templates that were derived from each of the examined E. coli strains. Reactions were performed in 10 lL including QuantiTect SYBR Green PCR master mix (Qiagen; 5 lL), primer mix (2 lL) and genomic DNA or cDNA templates (3 lL). Each sample was assayed in triplicate, while including water and noRT samples as negative controls and the calibrator RNA sample, which was included in every qRT-PCR run and subsequently used to normalize the relative quantification data for run to run variation. Thermocycling conditions were as described by Peng et al. (2014). The 16S rRNA gene (rrsA) previously shown to be the most suitable internal reference gene under the experimental conditions applied in this study (Peng et al., 2014) was used as a normalizer for relative quantification of the analysed stress response genes using the Light Cycler 480 relative quantification software. Transcriptional fold induction of each gene under stress was calculated relative to transcript levels found in corresponding LB control samples that were not subjected to stress. FEMS Microbiol Lett 361 (2014) 131–137
133
Reference
This study This study This study This study This study This study Zhou et al. (2011) This study
Efficiency of qPCR (%)
94.7 93.9 95.6 94.0 89.4 94.2 92.4 92.4 0.25 0.25 0.50 0.50 0.25 0.25 0.25 0.25 123 82 86 90 136 84 105 122 GCTGGCGGAGTTTGATATTCC TGGCTCAGAATATCCACAAACTG TGTGGGCGATGTCAGTGATT ACTGCGTGACGGGATGAA CTGGCTGGACTTCGGTTCTA GGGTTGGGTCAGATGGTACT CTCTTGCCATCGGATGTGCCCA CGCTTCTTCCAGTTTGTACCA Glycine betaine synthesis Lysine decarboxylase Uptake of potassium Trehalose synthesis Uptake of compatible solutes Uptake of compatible solutes 16S ribosomal RNA Ornithine decarboxylase betA cadA kdpA otsA proP proW rrsA speF
AGGGCAGGGTAGAGGGAAA ATCGTCGGCAGCACTTCAA CAGTGCCAGCAGATGAGGAT GCAAATTGCGAAAGAACAAGAAC CCCTAACGGCAGAGCGATAA CGAGGATAATGGCGAGGATCA CCAGTGTGGCTGGTCATCCTCTCA CCGTTACGTGCATCAATACCT
Final primer concentration (lM) Amplicon size (bp) Forward primer Function
Reverse primer
Statistical analysis
Statistical analysis was performed using the IBM SPSS Statistics version 22 (IBM Corp., Armonk, NY) program. Fold induction ratios were normalized by log10 transformation and subsequently analysed by one-way analysis of variance (ANOVA) test including Tukey’s post hoc test. Fold induction change cut-off value of 2.0 (corresponding to 0.301 after log transformation) was applied to define significant up- and downregulation of the stress response genes, respectively.
Results
Gene
Table 1. Primers used in this study. The primers were designed using the
PRIMER3WEB
version 4.0.0 (Untergrasser et al., 2012) and produced by Microsynth AG (Balgach, Switzerland)
Transcriptional analysis of stress response genes in E. coli
FEMS Microbiol Lett 361 (2014) 131–137
Induction of stress response genes under lactic acid stress exposure
Among the acid stress response genes tested, cadA was induced, whereas speF was not induced in response to lactic acid stress exposure (Fig. 1). Four of the five E. coli strains tested displayed similar cadA induction after 15 min of organic acid stress. In all these strains, no induction of this gene was detectable after prolonged lactic acid stress exposure (60 min). Meanwhile, PCR analysis showed that the fifth strain tested, FAM21843, lacks the cadA gene. No cadA amplicons were detected in this strain using primers that flank the cadA gene locus or those used for qPCR that bind within the cadA gene (data not shown). Furthermore, these findings were supported by the lack of lysine decarboxylase activity in this strain in biochemical tests (data not shown). In some, but not all E. coli strains tested, the salt stress response genes otsA and kdpA also showed lactic acid stress-dependent induction. Induction of otsA in FAM21843 and K331-4 was detected after 15 min of lactic acid stress, and kdpA induction in N09-1208 and FAM21843 was detected after 60 min of lactic acid stress. The speF gene as well as all the five salt stress response genes examined showed no significant upregulation, whereas in some strains, they were significantly downregulated in response to lactic acid stress exposure. Induction of stress response genes under sodium chloride stress exposure
Significant sodium chloride stress-dependent kdpA induction was detected after 60 min but not after 15 min of stress exposure in four of the five E. coli strains tested (Fig. 2). The highest kdpA induction was detected in the two generic E. coli strains K303 and FAM21843. Strain K331-4, on the other hand, did not show a significant kdpA induction under the sodium chloride stress conditions applied in this study. The generic E. coli strains
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
134
S. Peng et al.
Fig. 1. Lactic acid stress-dependent fold induction of cadA, speF, kdpA, proP, proW, betA and otsA transcript levels in five E. coli strains. Transcript levels in organisms exposed to lactic acid acidified LB at pH 5.2 and controls exposed to normal LB were determined relative to the rrsA (16S rRNA) reference gene. The fold induction of each gene in response to lactic acid stress was calculated by dividing relative transcript levels in lactic acid stress exposed organisms with those levels of regular LB exposed controls. Results show the log-transformed mean fold inductions and standard deviations based on three independent experiments in which each sample was assayed in duplicate. Same symbols above the bars indicate that no statistically significant differences (P < 0.05) were observed between relative transcript levels of the E. coli strains for the respective gene based on Tukey’s post hoc test. The dotted lines indicate the fold induction change cut-off value 2.0 (corresponding to 0.301 after log transformation) corresponding to the threshold level for significant up- and downregulation of the stress response genes.
FAM21843 and K303 also showed a significant proP induction after 15 and 60 min of sodium chloride stress exposure, respectively. In contrast, none of the three STEC strains (K331-4, K356 and N09-1208) examined showed proP induction in response to sodium chloride stress. The induction of proW during sodium chloride stress exposure occurred faster in the strains K331-4, K303 and FAM21843. These strains, in contrast to K356 and N09-1208 strains, already showed induction after 15 min of stress exposure. Nevertheless, all five strains exhibited a significant proW induction after 60 min of sodium chloride stress. The otsA gene was similarly induced in all five strains, while betA was only significantly induced in the strains K356, N09-1208 and FAM21843 after 60 min sodium chloride stress exposure. The K331-4 strain did not show significant betA induction under sodium chloride stress. The K303 strain lacked ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
the betA gene based on PCR analysis using primers that flank the betA locus or that bind within the betA gene (data not shown). In all tested strains, lysine decarboxylase cadA was downregulated by sodium chloride stress, whereas ornithine decarboxylase speF was induced in only one strain (N09-1208) after 60 min of sodium chloride stress exposure.
Discussion Sodium chloride and lactic acid stresses are common stressors encountered by microorganisms in food. The current study compared the transcriptional induction of two acid (cadA and speF) and five salt (kdpA, otsA, proP, proW and betA) stress response genes among five E. coli strains upon exposure to lactic acid or sodium chloride stress conditions that are similar to those that may be FEMS Microbiol Lett 361 (2014) 131–137
Transcriptional analysis of stress response genes in E. coli
135
Fig. 2. Sodium chloride stress-dependent fold induction of cadA, speF, kdpA, proP, proW, betA and otsA transcript levels in five E. coli strains. Transcript levels in organisms exposed to LB with 5% (w/v) additional sodium chloride and controls exposed to normal LB were determined relative to the rrsA (16S rRNA) reference gene. The fold induction of each gene in response to sodium chloride stress was calculated by dividing relative transcript levels in sodium chloride stress exposed organisms with those levels of regular LB exposed controls. Results show the logtransformed mean fold inductions and standard deviations based on three independent experiments in which each sample was assayed in duplicate. Same symbols above the bars indicate that no statistically significant differences (P < 0.05) were observed between relative transcript levels of the E. coli strains for the respective gene based on Tukey’s post hoc test. The dotted lines indicate the fold induction change cut-off value 2.0 (corresponding to 0.301 after log transformation) corresponding to the threshold level for significant up- and downregulation of the stress response genes.
encountered by these organisms in food such as during raw milk cheese production and ripening. The stress exposure was conducted for each stress separately at optimized conditions of E. coli growth to gain insight into the transcriptional induction of the single stress response mechanisms and to compare the five strains to each other under conditions where there is minimal possible influence from other external stress factors. The timescale was selected to analyse the immediate induction in the stress response genes and proteins, which can be rapidly induced upon stress exposure (Weber et al., 2006), while after prolonged stress exposure, the mRNA levels are expected to decline to normal levels. Lactic acid stress invoked similar fold induction of cadA transcripts in four of the five E. coli strains examined. One of the examined strains, FAM21843, lacked the cadA gene, and consequently, lysine decarboxylase enzyme FEMS Microbiol Lett 361 (2014) 131–137
activity encoded by this gene. The survival of FAM21843 in cheese was previously found not to be significantly impaired compared to the other four E. coli strains (Peng et al., 2013). These findings suggest that lysine decarboxylase activity is not mandatory for FAM21843 to survive the cheese production process. However, it cannot be ruled out that FAM21843 possesses other acid stress adaptive mechanisms that compensate for the lack of lysine decarboxylase CadA. The other tested acid stress response gene, speF, was not induced in all five E. coli strains upon lactic acid stress exposure. This could have been due to the fact that the pH of 5.2 applied in this study is lower than the activity optimum of SpeF, which is at pH 6.9 (Zhao & Houry, 2010). Meanwhile, other known acid resistance systems such as the glutamate and arginine decarboxylase systems were deliberately not investigated in this study as they mainly function at a ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
136
lower pH (Zhao & Houry, 2010). Among the five salt stress response genes examined, kdpA and otsA genes were also found to be induced in at least one E. coli strain upon lactic acid stress exposure, while proP, proW and betA were not induced. To our knowledge, the Kdp-ATPase system was not yet shown to take part in acid stress response. The otsA gene takes part in the synthesis of trehalose, which is a stabilizer for proteins and membranes (Elbein et al., 2003). Increased trehalose production may assist in counteracting stress imposed by organic acids such as lactic acid, as these are associated with disruption of membrane integrity and function of various other cellular proteins. However, it remains to be elucidated, if the trehalose synthesis pathway, including otsA, has a beneficial effect on the survival of certain E. coli strains in food with respect to lactic acid stress. The downregulation observed for speF and the majority of the salt stress response genes might be a consequence of these stress response systems being not essential for adaptation to the conditions induced by lactic acid stress. A downregulation of lysine decarboxylase CadA was detected in all four E. coli strains during sodium chloride stress exposure, potentially as this system is not required to counteract salt stress encountered. Ornithine decarboxylase SpeF, on the other hand, was induced in strain N091208, but not in the other four E. coli strains, in response to sodium chloride stress. However, the speF gene is currently not known to directly contribute to salt stress response mechanisms. Its induction may serve to promote the uptake of ornithine from LB, independent of the stress encountered. The initial response of E. coli to sodium chloride stress is the uptake of potassium by the KdpFABC complex, which includes the binding and translocating subunit KdpA. The kdpA induction during sodium chloride stress exposure was higher for the two generic E. coli strains K303 and FAM21843 than that observed in two of the STEC strains K356 and N09-1208. The third STEC strain, K331-4, did not show a significant kdpA induction in response to sodium chloride stress. Interestingly, the kdpA induction pattern observed in response to sodium chloride-based stress among the five E. coli strains reflected their survival phenotypes previously observed during raw milk cheese production (Peng et al., 2013). The two generic E. coli strains K303 and FAM21843 with the highest kdpA inductions survived better than K356 and N09-1208, while strain K331-4 was the worst survivor of all the five E. coli strains. The proP and proW genes encode components of two independent systems responsible for the uptake of compatible solutes. During sodium chloride stress exposure, the two generic E. coli strains exhibited a significant induction in proP, whereas the three STEC strains did not. However, these strains may still have compensated the lack in proP induction by the ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
S. Peng et al.
other systems involved in uptake and synthesis of compatible solutes such as proW and otsA, which were both significantly induced by all five E. coli strains after 60 min of sodium chloride stress exposure. The betA gene was significantly induced in K356, N09-1208 and FAM21843. Strain K331-4 did not show sodium chloride stress-dependent betA induction, whereas strain K303 lacks the betA gene. Although lacking the betA gene, K303 did not show an impaired survival in raw milk cheese compared to the E. coli strains able to induce betA (Peng et al., 2013). The differences in the transcriptional induction of the salt stress response genes among the five E. coli strains showed some associations with the survival phenotypes previously observed during production and ripening of semi-hard raw milk cheese. In particular, strain K331-4 showed a considerably weaker survival in cheese compared to the other four E. coli strains, correlating with its weaker or absent induction of the salt stress response genes kdpA, proP and betA during sodium chloride stress exposure. Furthermore, the two generic E. coli strains, which survived better than the three STEC strains during raw milk cheese production and ripening, were the only strains significantly inducing proP, indicating that uptake of compatible solutes might be beneficial for E. coli survival in cheese. However, further investigations on the importance of the different salt stress response genes are required to elucidate their contribution alone and in combination to the survival of E. coli in food such as raw milk cheese. In contrast to the salt stress response gene expression, the acid stress response was similar in four of the five E. coli strains assayed. Interestingly, at the pH applied, cadA would be expected to function as the major acid resistance gene. The strain FAM21843, however, lacks the lysine decarboxylase gene and was not significantly impaired in survival during raw milk cheese production. It remains to be elucidated how this strain compensates the lack of lysine decarboxylase activity during lactic acid stress exposure or if this activity is not critical for E. coli survival in food such as raw milk cheese.
References Andresen PA, Kaasen I, Styrvold OB, Boulnois G & Strom AR (1988) Molecular cloning, physical mapping and expression of the bet genes governing the osmoregulatory choline-glycine betaine pathway of Escherichia coli. J Gen Microbiol 134: 1737–1746. Arguedas-Villa C, Stephan R & Tasara T (2010) Evaluation of cold growth and related gene transcription responses associated with Listeria monocytogenes strains of different origins. Food Microbiol 27: 653–660. Ballal A, Basu B & Apte SK (2007) The Kdp-ATPase system and its regulation. J Biosci 32: 559–568.
FEMS Microbiol Lett 361 (2014) 131–137
Transcriptional analysis of stress response genes in E. coli
Baylis C (2009) Raw milk and raw milk cheeses as vehicles for infection by Verocytotoxin-producing Escherichia coli. Int J Dairy Technol 62: 293–307. Elbein AD, Pan YT, Pastuszak I & Carroll D (2003) New insights on trehalose: a multifunctional molecule. Glycobiology 13: 17R–27R. Farrokh C, Jordan K, Auvray F et al. (2012) Review of Shiga-toxin-producing Escherichia coli (STEC) and their significance in dairy production. Int J Food Microbiol 162: 190–212. Peng S, Tasara T, Hummerjohann J & Stephan R (2011) An overview of molecular stress response mechanisms in Escherichia coli contributing to survival of Shiga toxin-producing Escherichia coli during raw milk cheese production. J Food Prot 74: 849–864. Peng S, Hoffmann W, Bockelmann W, Hummerjohann J, Stephan R & Hammer P (2013) Fate of Shiga toxin-producing and generic Escherichia coli during production and ripening of semihard raw milk cheese. J Dairy Sci 96: 815–823. Peng S, Stephan R, Hummerjohann J & Tasara T (2014) Evaluation of three reference genes of Escherichia coli for mRNA expression level normalization in view of salt and
FEMS Microbiol Lett 361 (2014) 131–137
137
organic acid stress exposure in food. FEMS Microbiol Lett 355: 78–82. Untergrasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M & Rozen SG (2012) PRIMER3 – new capabilities and intercases. Nucleic Acids Res 40: e115. Weber A, K€ ogl SA & Jung K (2006) Time-dependent proteome alterations under osmotic stress during aerobic and anaerobic growth in Escherichia coli. J Bacteriol 188: 7165– 7175. Wood JM (1999) Osmosensing by bacteria: signals and membrane-based sensors. Microbiol Mol Biol Rev 63: 230–262. Zhao B & Houry WA (2010) Acid stress response in enteropathogenic gammaproteobacteria: an aptitude for survival. Biochem Cell Biol 88: 301–314. Zhou K, Zhou L, Lim Q, Zou R, Stephanopoulos G & Too HP (2011) Novel reference genes for quantifying transcriptional responses of Escherichia coli to protein overexpression by quantitative PCR. BMC Mol Biol 12: 18. Zweifel C, Giezendanner N, Corti S, Krause G, Beutin L, Danuser J & Stephan R (2010) Characteristics of Shiga toxin-producing Escherichia coli isolated from Swiss raw milk cheese within a 3-year monitoring program. J Food Prot 73: 88–91.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
