Vol. 11, No. 11

MOLECULAR AND CELLULAR BIOLOGY, Nov. 1991, p. 5631-5638 0270-7306/91/115631-08$02.00/0 Copyright © 1991, American Society for Microbiology

Transcriptional Activation through ETS Domain Binding Sites in the Cytochrome c Oxidase Subunit IV Gene JOSEPH V. VIRBASIUS AND RICHARD C. SCARPULLA* Department of Cell, Molecular and Structural Biology, Northwestern University Medical School, 303 East Chicago Avenue, Chicago, Illinois 60611 Received 8 May 1991/Accepted 26 August 1991

A mutational analysis of the rat cytochrome c oxidase subunit IV (RC04) promoter region revealed the of a major control element consisting of a tandemly repeated pair of binding sites for a nuclear factor from HeLa cells. This factor was designated NRF-2 (nuclear respiratory factor 2) because a functional recognition site was also found in the human ATP synthase n-subunit gene. Deletion or site-directed point mutations of the NRF-2 binding sites in the RC04 promoter resulted in substantial loss of transcriptional activity, and synthetic oligomers of the NRF-2 binding sites from both genes stimulated a heterologous promoter when cloned in cis. NRF-2 binding and transcriptional activation required a purine-rich core sequence, GGAA. This motif is characteristic of the recognition site for a family of activators referred to as ETS domain proteins because of the similarity within their DNA-binding domains to the ets-1 proto-oncogene product. NRF-2 recognized an authentic Ets-1 site within the Moloney murine sarcoma virus long terminal repeat, and this site was able to compete for NRF-2 binding to the RC04 promoter sequence. In addition, a single polypeptide of 55 kDa was detected following cross-linking of a partially purified NRF-2 fraction to RC04, the human ATP synthase 0 subunit, or Moloney murine sarcoma virus binding sites. However, in contrast to Ets-1, which appears to be exclusive to lymphoid tissues, NRF-2 has the broad tissue distribution expected of a regulator of respiratory chain expression. presence

also shown to be present within the human ATP synthase ,-subunit (p-ATPS) gene, another NRF-1-independent respiratory gene. The essential features of NRF-2 recognition of these sites are identical to those of the ETS domain proteins (17), a family of sequence-specific transcriptional activators characterized by a novel DNA-binding motif (the ETS domain). Members of this family include the ets-J protooncogene, as well as a number of other, related genes.

The limited genome of the mammalian mitochondrion contributes only 13 structural genes of the dozens required to produce the five membrane-associated complexes and two soluble carriers which make up the mammalian mitochondrial oxidative phosphorylation system (1). The means for coordinating mitochondrial gene expression with the nuclear genes which provide the remaining products should yield novel insights into the mechanisms of intracellular communication. We have approached this problem by characterizing the mammalian genes that encode the respiratory electron carrier cytochrome c as a model system (6-8, 23, 25). Thus far, in addition to general transcription control elements common to a variety of cellular genes, we have identified transcription factor NRF-1. This factor participates in the activation of a potent control region within the rat somatic cytochrome c promoter (8) and also activates transcription through specific recognition sites present in other nuclear genes which contribute to mitochondrial function (9). Examination of other recently isolated nucleus-encoded respiratory genes has revealed, however, that not all of these genes are dependent on NRF-1 for full promoter activity. One such NRF-1-independent gene, the rat cytochrome c oxidase subunit IV (RC04) gene, has features of tissuespecific and hormone-regulated expression distinct from those of the rat somatic cytochrome c (RC4) gene (26). Thus, it appears from these observations that different means of gene control may operate even between functionally related components of the electron transport and oxidative phosphorylation system. Here we report the identification of several significant transcription control elements in the RC04 promoter. Among these are binding sites for a factor designated NRF-2. A functional NRF-2 recognition site is *

MATERIALS AND METHODS Oligonucleotides. Synthetic DNA oligomers used in this work were as follows: RC04 +13/+36,

GATCCGGGACCCGCTCTTCCGGTCGCGAA GCCCTGGGCGAGAAGGCCAGCGCTTTCGA;

P-ATPS +5821+605, GATCCGTGCGTTGACCTTCCGGTTGAACA GCACGCAACTGGAAGGCCAACTTGTTCGA;

hCC, -181/-204,

GATCCTCCCCACGCTCTTCGGGTTGTCGA GAGGGGTGCGAGAAGCCCAACAGCTTCGA;

MSV -53/-34,

GATCCGCGCGCTTCCGCTCTCCGAGA GCGCGCGAAGGCGAGAGGCTCTTCGA;

RC4 -172/-147,

GATCCTGCTAGCCCGCATGCGCGCGCACCTTA GACGATCGGGCGTACGCGCGCGTGGAATTCGA.

Vector constructions. The parent vector pRC04CAT was constructed by fusing a 1,420-bp BamHI-EcoRV fragment consisting of the RC04 upstream, exon I, and intron I regions via a Hindlll linker to the Hindlll site in the RC4 first intron of the CAT expression vector pRC4CAT (6). This vector was designed to produce a chimeric CAT mRNA driven by the RC04 promoter. The 590-bp BamHI-PvuII fragment of pRC04CAT was removed, and the vector was religated through a KpnI linker to generate pRC04CATD77. The remaining 5' deletions were constructed by exonuclease III digestion as previously described (22) and religation to the vector through a KpnI linker. Mutations in the NRF-2

Corresponding author. 5631

5632

M OL. CELL. BIOL.

VIRBASIUS AND SCARPULLA

binding sites were introduced by oligonucleotide-directed mutagenesis by the method of Kunkel (19) by using the oligonucleotides 5'-CTTGCTCTAGAGGTGCGGGA-3' (MUTA) and 5'-CCCGCTCTAGAGGTCGCGAG-3' (MUTB). The sequence of each mutant construction, as well as the endpoint of each deletion, was verified by DNA sequencing. To measure stimulation of the truncated RC4 promoter by the individual NRF-2 binding sites, NRF-2 oligonucleotides from RCO4, P-ATPS, and hCC1 cloned in pGEM-7Zf(+) were excised by ClaI and Asp718I cleavage and ligated into pRC4CATBA/-66BA (9), which had been cut with the same enzymes. This positioned the NRF-2 binding sites 95 nucleotides upstream from the RC4 transcription start site. Expression vectors containing four tandem copies of NRF-2 binding sites were constructed in the same way following head-to-tail multimerization of the cloned oligonucleotides as previously described (9). Cell culture and transfections. Growth of COS-1 cells and transfection by the calcium phosphate method (10) were carried out as previously described (8). For each transfection, cells were harvested from triplicate plates. One-half of the pooled cell volume was analyzed for chloramphenicol acetyltransferase (CAT) activity, and low-molecular-weight DNA was prepared from the remainder by the method of Hirt (14). The CAT activities reported have been normalized to the amount of CAT plasmid DNA recovered in the Hirt supernatant as quantitated by slot blot hybridization to correct for differences in transfection efficiency as previously described (6). Extracts and DNA-binding analysis. Nuclear extracts were prepared from HeLa, COS-1, GH3, and L6 cells by the method of Dignam et al. (5). Extracts were prepared from rat liver and testis nuclei as described by Graves et al. (11). Either crude extracts or a fraction (HA250) of HeLa nuclear extracts eluted from heparin agarose with 250 mM KCl (9) was used in all experiments. Mobility shift gel assays, DNase I footprinting, and methylation interference assays were performed as previously described (8, 9). For use in gel mobility shift assays, oligonucleotides were labeled by filling in 5' extensions with Klenow enzyme by using a-32P-labeled dideoxynucleotides. UV-induced cross-linking. Cross-linking of DNA-binding proteins to bromodeoxyuridine-substituted binding sites was carried out essentially as described by Chodosh et al. (4). Briefly, probes were prepared by synthesis in the presence of bromodeoxyuridine (Pharmacia) and [a-32P]dCTP of the upper strand of binding sites by using M13 clones of the above-indicated oligonucleotides. The labeled probe was released by digestion with BamHI and HindIlI and gel purified. Binding reactions contained 50,000 cpm (approximately 10 fmol) of each probe and 1 ,ug of a 2:1 mixture of native and denatured, sonicated calf thymus DNA per microgram of protein. Following 15 min at room temperature to allow binding, samples were irradiated for 5 to 30 min at 4°C with a 254-nm UV lamp. Samples were then boiled in sodium dodecyl sulfate (SDS) loading buffer and loaded onto SDSpolyacrylamide gels which were subsequently dried and autoradiographed. RESULTS Deletion analysis of proximal RCO4 promoter elements. A series of 5' deletion mutations was constructed to define the promoter region of the RCO4 gene. The 77-bp sequence upstream from the first transcription start site of RCO4 retained at least 50% of the activity of the most active

rD77 rD28 rD52 CTGCCGCACCGCGATCTGAAGCTGATGGGCGTGGGCGGGGCTTCTTCGATTCCCGCGA

spi

rD9

rD+l8

+1

rD+29

TGCTTCGCGGCACCGTCTTGCTCTTCCGGTGCGGGACCC2GCLQCTCGCGCGAGCAC NNRF-2

NRUF-2

Plasmid

pRCO4CAT D77

D52 D28 D9 D+18 D+29

Relative Activity 1.0

0.66 0.25 0.020 0.0017 0.0018

± ± ± ± ±

0.14 0.080 0.014 0.00053 0.00021 FIG. 1. Activity of 5' deletions of the RC04 promoter. Plasmid pRC04CATD77 or the deletions to the endpoints indicated relative to the first transcription initiation site (+1) were transfected into COS-1 cells, and CAT activity was measured and normalized to the CAT DNA recovered in the Hirt supernatant. The values given show activity relative to pRC04CATD77 and are expressed as the average ± standard deviation of a minimum of four independent

determinations.

construction which includes additional 5'-flanking sequences (27). We therefore chose to analyze in more detail this relatively short sequence. A series of deletions of a CAT expression vector including fragments of the RCO4 promoter beginning at -77 and continuing beyond the transcription start sites was transfected into COS-1 cells, and the resultant CAT activity was measured. As shown in Fig. 1, relatively modest decreases in promoter activity (two- to threefold) occurred upon deletion of the sequence between -77 and -52 and that between -52 and -28. The latter region includes a perfect (10-of-10) match to the consensus sequence for Spl binding sites (16), which are common to the promoters of many housekeeping genes. The rat cytochrome c gene promoter contains a potent intron element consisting of tandem Spl binding sites (6, 8). A more substantial decrease in activity (13-fold) occurred upon further deletion to -9; however, we did not characterize this element further. A deletion proceeding beyond the first transcription start site, -9 to +18, reduced promoter activity nearly to background levels, although the major transcription start sites between +25 and +50 (26) remained intact. This region included the first copy of a perfect tandem repeat of the sequence GCTCTTCCGGT. A deletion into the second copy of this repeat to +29 resulted in no further reduction; however, the activities of this and the previous deletion were marginally above background levels. To determine whether this repeated sequence was responsible for promoter activation, as suggested by the results of the deletions, a cluster of site-directed point mutations was introduced into one or both copies of this element and the constructions were transfected into COS-1 cells (Fig. 2A). A 3-bp mutation in the 5' copy of this sequence (D77MUTA) reduced promoter activity fivefold relative to the control vector (pRCO4CATD77). The analogous mutation in the 3' copy of this sequence (D77MUTB) also diminished promoter activity, although to a lesser extent. Mutation of both copies (D77MUTAB) reduced the CAT activity driven by this promoter more than 20-fold. These results are consistent with the deletion mutations and indicate that a strong promoter element coincides with these tandemly repeated sequences. To determine whether the promoter activity of these

ETS DOMAIN ACTIVATOR OF NUCLEAR RESPIRATORY GENES

VOL. 1 l, 1991

A

Relative

Plasmid

Activity -4

A

+34

B

D77

TCTCCTCGGGGCCCC'CMG

1.0

D77MUTA

TCTTGCTCTagaGGTGCGGGACCCGCTCTTCCGl:CGC

0.20

±

D77MUTB TGCTGCTTQCCGGIGCGGGACCCGCTCTagaGGTCGC

0.43

±

D7 7M1UTAB TCTTGCTCTagaGGTGCGGGACCCGCTCTagaGGTCGC

0.047

0.074 0.19

±

0.027

B