GENE-40651; No. of pages: 6; 4C: Gene xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Research paper

Transcription factors from Sox family regulate expression of zebrafish Gla-rich protein 2 gene C. Fazenda a,b, N. Conceição a,c,⁎, M.L. Cancela a,c,⁎ a b c

Centre of Marine Sciences (CCMAR), University of Algarve, Faro, Portugal PhD Program in Biomedical Sciences, University of Algarve, Faro, Portugal Department of Biomedical Sciences and Medicine, University of Algarve, Faro, Portugal

a r t i c l e

i n f o

Article history: Received 19 December 2014 Received in revised form 26 June 2015 Accepted 29 June 2015 Available online xxxx Keywords: Gla-rich protein Gene regulation Transcription factors Sox family

a b s t r a c t GRP is a vitamin K-dependent protein with orthologs in all vertebrate taxonomic groups and two paralogs in teleosts. However, no data is available about GRP transcriptional gene regulation. We report a functional promoter for zebrafish grp2 gene regulated by Sox9b, Sox10, Ets1 and Mef2ca as determined by in vitro assays. This was confirmed in vivo for Sox9b and Sox10. Due to the high conservation between human GRP and grp2, its zebrafish ortholog, our results are relevant for the study of human GRP gene regulation and provide new insights towards understanding GRP function. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Gla-rich protein (GRP) or Upper zone of growth plate and Cartilage Matrix Associated protein (UCMA), the most recent identified member of the vitamin K-dependent protein family, is associated to cartilage and bone and has been described to be conserved in different vertebrate species, ranging from sturgeon (Viegas et al., 2008) and zebrafish (Neacsu et al., 2011; Fazenda et al., 2012), to mouse (Tagariello et al., 2008; Surmann-Schmitt et al., 2008) and human (Viegas et al., 2009). Orthologs were identified in all taxonomic groups of vertebrates, and a paralog in bony fish but no homolog was found in invertebrates (Viegas et al., 2008). Its function has not yet been established, but due to its high content in γ-carboxylated glutamic acid (or Gla) residues, it was suggested that it may be related to modulation of calcification or its inhibition, similar to another member of this family, the matrix gla protein (MGP) gene (Cancela et al., 2012). In terms of GRP gene regulation, the information is scarce. Previous studies have shown a repression of Grp in retinoic acid treated dedifferentiated chondrocytes (Surmann-Schmitt et al., 2008) and a down-regulation in chondrocytes exposed to bone morphogenetic protein 2 (BMP2) and to transforming growth factor β1 (TGF-β1) (Surmann-Schmitt et al., 2008; Le Jeune

et al., 2010). In a transgenic mouse study, where a dominant negative form of ERG, a member of the E-twenty six (Ets) family of transcription factors, is expressed in chondrocytes, a conserved region exhibiting Ets-binding sites in the Grp promoter was identified to be functional (Le Jeune et al., 2011). These results point for the Ets family of transcriptional factors to be good candidates to be tested. Other possible candidates (nuclear factors involved in skeletal development, cartilage differentiation, and cartilage gene regulation) were predicted by computational analysis to be present in the flanking regions of the grp1 and grp2 genes (also called ucmaa and ucmab, respectively (Neacsu et al., 2011)) from the Japanese and the green-spotted pufferfish (Conceição et al., 2012). When compared to the transcriptional factors predicted to bind the human promoter, three of them, i.e., E47, Mef2, and Stat1 were also present, making them good candidates to be further analyzed (Conceição et al., 2012). Here, we report the identification of a functional promoter for zebrafish grp2 gene, and following a functional approach we confirm the involvement of transcription factors from the Sox family (Sox9b and Sox10) in the regulation of this gene. 2. Materials and methods 2.1. Zebrafish grp2 promoter TFBSs analysis

Abbreviations: GRP, Gla-rich protein; UCMA, Upper zone of growth plate and Cartilage Matrix Associated protein; BMP2, bone morphogenetic protein 2; TGF-β1, transforming growth factor β1; Ets, E-twenty six; MGP, matrix gla protein. ⁎ Corresponding authors at: CCMAR and Department of Biomedical Sciences and Medicine, University of Algarve, 8005-139 Faro, Portugal. E-mail addresses: [email protected] (N. Conceição), [email protected] (M.L. Cancela).

The zebrafish grp2 promoter sequence was masked for repetitive elements by the program RepeatMasker (http://www.repeatmasker. org) with the slow and sensitive mode. Then it was screened for putative transcription factor binding sites (TFBSs) using the web-based

http://dx.doi.org/10.1016/j.gene.2015.06.079 0378-1119/© 2015 Elsevier B.V. All rights reserved.

Please cite this article as: Fazenda, C., et al., Transcription factors from Sox family regulate expression of zebrafish Gla-rich protein 2 gene, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.079

2

C. Fazenda et al. / Gene xxx (2015) xxx–xxx

prediction program MatInspector (http://www.genomatix.de/) with the default settings for the core similarity 0.75 and for matrix similarity 0.80. For zebrafish–medaka orthologous promoter pair, the DNA Block Aligner (DBA) software (www.ebi.ac.uk/Tools/psa/promoterwise/) was used to extract blocks of aligned sequence using the default parameter settings based on the postulation that conserved regulatory blocks may be regions important for regulation of the gene. For the multiple alignment plus prediction of TFBSs in the set of identified conserved blocks present within the promoter, we used the web tool PROMO (http://www.lsi.upc.es/~alggen; Messeguer et al., 2002; Farré et al., 2003) and all the common TFBS matches located in aligned regions were determined. The percentage of retention of putative TFBSs was calculated comparing the number of a given TFBS in the promoter to that from the conserved blocks in both zebrafish and medaka promoters. 2.2. Plasmid construction The construct − 5531/+ 32LuC was generated by PCR amplification using genomic DNA from a male adult zebrafish as a template and the remaining constructs were generated by PCR using the − 5531/+ 32LuC as template. Zebrafish grp2 luciferase reporter plasmids − 2585/+ 32LuC, − 3437/+ 32LuC, − 4644/+ 32LuC and − 5531/+ 32LuC were generated by PCR amplification with a common antisense primer (gpr2R1; Table 1) and four different sense specific primers (gpr2F3, gpr2F4, gpr2F5 and gpr2F6, respectively; Table 1). The − 449/+ 32LuC and − 2034/+ 32LuC were generated by PCR amplification with a common antisense primer (gpr2R2; Table 1) and two different sense specific primers (gpr2F1 and gpr2F2, respectively; Table 1). The − 2034/− 59LuC reporter construct was generated by PCR amplification with gpr2F2 and gpr2R3 as sense and antisense primers respectively (Table 1). In each case, the sequences for known restriction enzymes sites were introduced using specifically designed primers, and are identified in bold and underlined (Table 1). All PCR fragments thus obtained were digested with the respective restriction enzymes (For − 449/ + 32LuC, − 2034/+ 32LuC and − 2034/− 59LuC, XhoI and HindIII, and for − 2585/+ 32LuC, − 3437/+ 32LuC, − 4644/+ 32LuC and − 5531/+ 32LuC, SacI and NheI). The resulting DNA fragments were gel purified and inserted into the promoter less pGL3 basic vector (Promega) previously digested with the same enzymes. Plasmids used for transfection studies were prepared using the PureYield™ Plasmid Miniprep System (Promega). All constructs were verified by double stranded DNA sequence analysis.

medium (Gibco). Both media were supplemented with 10% fetal bovine serum (Sigma-Aldrich) and 1% antibiotics (Gibco). Cells were allowed to grow at 37 °C in a humidified, 5% CO2 atmosphere. 2.4. Cell transfection and luciferase assays To evaluate the activities of zebrafish grp2 promoter constructs, cells were transiently transfected for 48 h with different constructions in combination with the Renilla luciferase-expressing vector pRL-null (Promega) for normalization of transfection efficiency. Transient transfection and co-transfection assays were performed using XtremeHP (Roche Diagnostics) as DNA carrier and Luciferase (Luc) activity was assayed using Dual-Luciferase Reporter assay kit (Promega) in a Synergy 4 microplate reader (BioTek). Cells were transfected in 12-well plates (Nunc) with grp2 promoter LuC construct (500 ng/well); pRL-null (25 ng/well) and with or without transcription factors of interest (sox9b, sox10, ets1a, mef2ca and mef2cb; 25 ng/well for each transcription factor). Levels of firefly luciferase were normalized against those of Renilla luciferase. As a positive control for each transfection, the pGL3 control vector (Promega) was transfected. All experiments were repeated at least three times. 2.5. In vivo expression assays In vivo expression assays were performed as described in Fazenda et al. (2010). Briefly, mRNA was synthesized in vitro using mMESSAGE mMACHINE kit (Ambion) and eluted in MilliQ water. One-cell stage zebrafish embryos were injected with an internal control (pRL-null; ≈ 5 pg/embryo) and grp2 promoter LuC construct (≈ 50 pg/embryo) with or without mRNAs of interest (sox9b, sox10 or ets1a; ≈ 150 pg/embryo) using a Nanoject II (Drummond Scientific Co.). After 48 h post-injections, embryos were divided into groups of five embryos each, and lysed in Passive Lysis Buffer. Firefly and Renilla luciferase activities were measured as described above. Levels of firefly luciferase were normalized against those of Renilla luciferase. 2.6. Statistical analysis All data were expressed as means ± standard deviation (SD) of measurements from at least three independent experiments. Differences between groups were examined for statistical significance using Student's t-test. A p value lower than 0.05 was used as the minimum criteria for statistical significance.

2.3. Cell culture

3. Results

Mouse chondrogenic cell line ATDC5 was grown in DMEM:F12 medium (Gibco), whereas human HEK293 cells were grown in DMEM

3.1. Identification of a functional promoter for grp2 gene

Table 1 Oligonucleotides used for PCR amplification and reporter gene constructs. Underlined and bold sequences in primers are a known restriction site. Specific primers

Sequence (5′-3′)

Sense gpr2F1 gpr2F2 gpr2F3 gpr2F4 gpr2F5 gpr2F6

CCCGGGCTCGAGCAAAAACGAATAGAGAAAACACAGA CCCGGGCTCGAGTGTGAGGCTTGGGTTTAGGGTTGG CCCGGGGAGCTCCACTACTGTTTCCTGGGGTGTC CCCGGGGAGCTCCATTGTCATCATTTTCCAACATTA CCCGGGGAGCTCCAGAAAAGGTAAGTGCGCTAAGT CCCGGGGAGCTCATGCTGGAAACCTGTGACCATTATC

Antisense gpr2R1 gpr2R2 gpr2R3

CCCGGGGCTAGCTTAAGATCAGAGTGTCTTGAGCTGGT CCCGGGAAGCTTTTAAGATCAGAGTGTCTTGAGCTGGT CCCGGGAAGCTTAGAAGAGGGACGAGGGAAGGAAAGGAGG

In order to identify a functional promoter region in grp2 gene 5′ flanking region, constructs comprising sequential deletions of this region, ranging from − 5531 to − 449, were placed upstream from the luciferase reporter gene. Then each construction was transiently transfected into two different cell lines expressing GRP, i.e. ATDC5 cells (Tagariello et al., 2008; Surmann-Schmitt et al., 2008) and HEK293 (unpublished data from our laboratory), or microinjected into zebrafish embryos, and promoter activity assessed as a function of luciferase expression. The full promoter region (− 5531/+ 32) was shown to induce transcription of the LuC reporter gene demonstrating the functionality of this promoter, both in vitro in the two different cell systems tested (ATDC5 and HEK293 cells, Figs. 1A and S1, respectively) and in vivo (Fig. 1B). The significant decrease of luciferase activity between constructs − 5531/+ 32LuC and − 4644/+ 32LuC and the increase of luciferase activity between constructs − 2034/+ 32LuC and − 449/+ 32LuC showed that region

Please cite this article as: Fazenda, C., et al., Transcription factors from Sox family regulate expression of zebrafish Gla-rich protein 2 gene, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.079

C. Fazenda et al. / Gene xxx (2015) xxx–xxx

3

Fig. 1. 5′-flanking region of zebrafish grp2 gene induces promoter activity in (A) ATDC5 cells and (B) zebrafish embryos. Relative luciferase activities generated by different sized constructs of grp2 gene are compared with promoterless pGL3 basic vector. Each transfection was carried out at least three times and the results are expressed as the mean with the standard deviation indicated above each bar. Each result was analyzed using Student's t-test with respect to the pGL3 basic vector (empty expression vector) to estimate statistical significance. * indicates p b 0.05. Left panel: Schematic representation of zebrafish grp2 promoter region with interspersed repeats and low complexity DNA sequences detected by RepeatMasker indicated in grey. A schematic representation of the grp2 promoter-constructs used for transient transfections is shown below.

A and region B (Fig. 1) are important for grp2 gene regulation. The other constructions (− 2034/− 59LuC, − 2034/+ 32LuC and − 2585/+ 32LuC) were shown not to induce significant levels of transcription of the LuC reporter gene suggesting either the presence of binding sites for negative regulatory elements or the lack of binding sites for enhancers required for the binding of the transcriptional apparatus to the proximal promoter. A more detailed analysis showed that the region comprised between − 2034 and − 449 consisted almost exclusively (more than 90%) of a series of repetitive motifs (Figs. 1 and 2) which could interfere with the binding of regulatory proteins.

3.2. Identification of putative regulatory binding sites in the grp2 promoter regions A and B Zebrafish grp2 promoter region was screened for interspersed repeats and low complexity DNA sequences followed by an in silico analysis which identified several putative transcription factors binding sites. Focusing specifically on region A and B and taking into account that GRP is mainly expressed in bone and cartilage, we identified putative sites for three different transcription factors known to be involved in bone- and cartilage-related gene regulation: Sox, Mef2 and Ets1. In region A, we identified three putative binding sites for Sox transcription factor family, two putative binding sites for Mef2 and one for Ets1 families of transcription factors. In region B, we only identified three putative binding sites for members of the Sox transcription family.

3.3. Transactivation of grp2 promoter by bone- and cartilage-related transcription factors To determine if any of the identified transcription factors were involved in grp2 transactivation, we tested their ability to transactivate grp2 promoter constructs in co-transfection experiments. ATDC5 cells were co-transfected with the zebrafish Sox9b or Sox10 expression constructs together with the −449/+32LuC (construct containing region B) but no significant difference in transcriptional activity was obtained (results not shown) suggesting that Sox transcription factor family had no effect in this region. However, when these cells were cotransfected with the zebrafish Sox9b or Sox10 expression constructs together with the − 5531/+ 32LuC construct, we observed a clear regulation by these transcription factors (Fig. 3). We observed a 3.1and 2.6-fold induction of LuC expression for Sox9b and Sox10, respectively, relative to the activity of the grp2 promoter construct used alone. Additionally, co-expression of both Sox9b and Sox10 seems to have the same effect as when Sox transcription factors were expressed individually (Fig. 3). Altogether, these data suggest that both Sox9b and Sox10 act on the upstream Sox DNA-binding motifs (Fig. 2). In order to validate the implication of Sox9b and/or Sox10 factors in grp2 promoter activation, we co-transfected expression vectors encoding these factors in a dose-dependent manner. Co-transfection of increasing doses of Sox9b or Sox10 had no effect in luciferase expression by these cells (Fig. S2). A similar approach was conducted using Ets1a, Mef2ca and Mef2cb transcription factors. Ets1a and Mef2ca up-regulated grp2 promoter activity (2.0 and 1.4-fold, respectively), while Mef2cb had no detectable effect in grp2 regulation. However, the effect of Mef2ca in grp2 promoter

Fig. 2. Schematic representation of zebrafish grp2 promoter region and localization of putative Sox, Mef2 and Ets binding sites within the 5′ flaking region of this gene as identified by in silico analysis and indicated, respectively, by circles, diamond and square. Interspersed repeats and low complexity DNA sequences detected by RepeatMasker are indicated in grey.

Please cite this article as: Fazenda, C., et al., Transcription factors from Sox family regulate expression of zebrafish Gla-rich protein 2 gene, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.079

4

C. Fazenda et al. / Gene xxx (2015) xxx–xxx

mRNAs for the transcription factor in study. Our results confirmed that the two members of the Sox transcription factor family, Sox9b and Sox10 were able to regulate grp2 promoter region in vivo (Fig. 4), while no significant changes were observed with Ets1a. 3.4. Sox10 transcription factor regulates grp2 promoter gene

Fig. 3. In vitro transactivation of the grp2 promoter by each of the identified transcription factors. Transient co-transfection assays of ATDC5 cells with grp2 promoter construct (−5531/+32LuC), a Renilla luciferase normalizing vector and the indicated transcription factor expression vector. Results are presented as fold induction over the respective grp2 promoter construct used with pCMX-PL2 (empty expression vector). Each co-transfection experiment was carried out at least three times, and the results are expressed as the mean with the standard deviation indicated above each bar. Each result was analyzed using Student's t-test with respect to the pCMX-PL2 (empty expression vector) to estimate statistical significance. *** indicates p b 0.001.

appears to be increased when Mef2ca and Mef2cb were co-transfected (1.8-fold induction) indicating a synergistic effect. These results are in agreement with our in silico analysis which identified one putative binding site for Ets1 and two putative binding site for Mef2 in region A (Fig. 2). To evaluate the effect of Sox9b, Sox10 and Ets1a in vivo on grp2 promoter, the full promoter (− 5531/+ 32LuC) was microinjected in one-cell stage zebrafish embryos with or without the presence of

Fig. 4. In vivo transactivation of the grp2 promoter by some of the identified transcription factors. Transient expression of grp2 promoter construct (−5531/+32LuC) in zebrafish embryos. Embryos were microinjected at the one-cell stage with either zebrafish Sox9b, Sox10 or Ets1a mRNA together with grp2 promoter construct (−5531/+32LuC). Injected embryos were maintained at 28.5 °C in embryonic medium and were collected at 48 h post-fertilization for luciferase assay. Levels of firefly luciferase were normalized against Renilla luciferase. Results are presented as fold induction over the respective grp2 promoter construct used alone. The statistical significance of the results was determined with the Student's t-test. ** indicates p b 0.01.

In order to verify the effect of Sox10 in grp2 gene regulation, the full promoter (− 5531/+ 32LuC construct) was co-transfected in ATDC5 cells with one of three different Sox10 expression vectors: Sox10 wild type (Sox10wt), the mutant Sox10baz1 or the mutant Sox10m618 (Fig. 5). Sox10baz1 and Sox10m618 are characterized by a substitution that leads to an amino acid change, either V117M or L142Q, respectively, affecting in both cases the DNA-binding domain known as HMG (high mobility group) domain (Dutton et al., 2001; Carney et al., 2006). While both Sox10wt and Sox10baz1 were able to transactivate the grp2 promoter, Sox10m618 was not functional, indicating that the mutation is likely preventing binding to its target site, as also confirmed in another context previously (Dutton et al., 2001). These results provide additional evidence towards the confirmation of Sox10 as a bona fide regulator of grp2 gene transcription. 3.5. Zebrafish and medaka grp2 promoter regions comparison: analysis of regulatory elements In order to identify the putative TFBSs in the zebrafish grp2 promoter region responsible for the decrease of luciferase activity observed when using region B instead of region A, we performed a comparative promoter analysis. We analyzed the conservation of the promoter regions of the zebrafish and medaka grp2 genes using the DBA (DNA Block Aligner) web server. Then, the set of identified conserved blocks presented within the zebrafish and medaka promoters were compared for TFBSs. Our comparison reveals the conservation of multiple potential cis elements between the grp2 promoters from the two species. Thus, for

Fig. 5. Validation of Sox10 transactivation effect on grp2 gene using different Sox10 constructs in ATDC5 cells. Transient co-transfection assays of ATDC5 cells with a luciferase reporter vector, a Renilla luciferase normalizing vector and the indicated transcription factor expression vectors: Sox10 wild type (Sox10wt), Sox10baz1 or Sox10m618. Results are presented as fold induction over the respective grp2 promoter construct used with Sox10wt. Each co-transfection was carried out at least three times and the results are expressed as the mean with the standard deviation indicated above each bar. Each result was analyzed using Student's t-test with respect to the Sox10wt to estimate statistical significance. ** indicates p b 0.01.

Please cite this article as: Fazenda, C., et al., Transcription factors from Sox family regulate expression of zebrafish Gla-rich protein 2 gene, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.079

C. Fazenda et al. / Gene xxx (2015) xxx–xxx

zebrafish, this criterion reduces the 511 TFBSs in the grp2 promoter sequence to only 143 in the conserved blocks (a reduction of 72%). To determine whether our comparative screening of TFBSs was likely to have identified TFs with roles in grp regulation that could explain the observed loss in the promoter activity, we searched our list for the presence of TFs previously known to be associated in the regulation of bone or cartilage. From those TFs that show conserved binding sites in the blocks analysed in the grp2 promoter sequence, at least ten TFs (Fig. S3) are prime candidates for future functional studies assessing their ability to bind to and regulate activity of grp2 in vivo. 4. Discussion We and others previously reported the identification of two genes coding for Grp in zebrafish, named grp1 (ucmaa) and grp2 (ucmab) (Neacsu et al., 2011; Fazenda et al., 2012). The high sequence homology between Grp1 and Grp2 and the rigorous conservation of protein features throughout evolution indicate that both Grp isoforms have most likely conserved a similar structure and function in modern teleost fish (revised in Cancela et al., 2012). Although grp1 gene was proposed to be the human ortholog by sequence comparison (Viegas et al., 2008), the fact that grp2 gene is more closely related to tetrapod GRP by genomic context and the most expressed in zebrafish from juvenile to adulthood, while grp1 is essentially only significantly expressed at the beginning of development, during embryo and larval phases (Fazenda et al., 2012) led us to focus our efforts in grp2 regulation. We cloned the 5′-flanking region containing the promoter of grp2 gene and, using a 5′-deletion approach, identified two distinct regulatory regions (Fig. 1¸ genomic regions A and B) essential for the regulation of this promoter both in vitro and in vivo (Fig. 1). Our in silico analysis of these two regions revealed putative binding sites for transcription factors known to regulate cartilage-related genes including members from Mef2, Ets and Sox families (Fig. 2). These findings are in agreement with what we previously predicted by computational analysis using the flanking region of grp1 and grp2 genes from the Japanese and green-spotted pufferfish. We have shown that these transcription factors could be good transactivator candidates, confirming the usefulness of the in silico predictions as a first step to identify binding sites for candidate TFs (Conceição et al., 2012). In addition, a binding site for Sox2 transcription factor was identified in the human GRP promoter, and shown to affect gene transcription (Michou et al., 2012). From all the tissues and cell types expressing GRP in mammals, chondrocytes appear to be one of the most prevalent (revised in Cancela et al., 2012). Accordingly, in zebrafish we showed that both grp1 and grp2 are highly expressed in skeletal and cartilaginous tissues (Fazenda et al., 2012). From the transcription factor families identified in our in silico study (Conceição et al., 2012), we choose to test those known to have a critical role in cartilage differentiation: Mef2ca, Mef2cb, Ets1a, Sox9b and Sox10. MEF2C has been shown to be required for normal chondrocyte hypertrophy and subsequent ossification. Chondrocytes in developing bones of Mef2c-null mice fail to undergo hypertrophy (Arnold et al., 2007) and expression of zebrafish mef2ca was shown to be required in cranial neural crest cells for proper head skeletal patterning (Miller et al., 2007). Our transfection assays showed that Mef2ca alone or with Mef2cb is able to regulate grp2 gene although moderately (Fig. 3). Ets-1 is involved in the regulation of integrin alpha10 transcription in chondrocytes (Wenke et al., 2006) and interestingly, the Grp gene was identified as differentially expressed in transgenic mouse chondrocytes expressing a dominant negative form of ERG, a member of the ETS family of transcription factors, and a conserved and functional region of the Grp mouse gene, which exhibits ETS-binding sites, was defined (Le Jeune et al., 2011). Due to this evidence, the ETS family of transcriptional factors was proposed to be a potential regulator for Grp. Accordingly, our experiments have shown an induction of grp2 expression by Ets1a in co-transfection experiments (Fig. 3), however these results were not confirmed in our in vivo studies (Fig. 4). Sox9

5

and Sox10 belong to the SoxE group and are critical for the development of neural crest progenitors (Hong and Saint-Jeannet, 2005; Haldin and LaBonne, 2010). These cells give rise to diverse cell lineages including melanocytes, craniofacial cartilage and bone cells, smooth muscle cells, peripheral and enteric neurons and glia (Huang and SaintJeannet, 2004). Furthermore, Sox9 is a master regulator of cartilage development and plays an essential role in the specification and differentiation of mesenchymal cells towards the chondrogenic lineage in all developing skeletal elements (Lefebvre and de Crombrugghe, 1998; Lefebvre and Smits, 2005). Interestingly, both Sox9 and Sox10 were shown to regulate Col2 expression in chick (Suzuki et al., 2006) and the location of Grp expression has been shown in another study to correspond, during mouse development, almost exclusively to areas of Col2 expression (Surmann-Schmitt et al., 2008). The capability of Sox9b and Sox10 to transactivate the grp2 promoter was tested in ATDC5 cells and results confirmed an effect leading to its up-regulation (Fig. 3). Similar effects were observed in vivo following microinjection of both the grp2 promoter and mRNA of the corresponding transcription factors (Fig. 4). Moreover, the observed effect suggests that Sox9b and Sox10 act on the Sox DNA-binding motifs within the region A of the grp2 promoter, a conclusion supported by the finding that when region B was used in co-transfection assays, no up-regulation of grp2 promoter was observed. Interestingly, when Sox9b and Sox10 were co-transfected, the activation was at the intermediate level of the results obtained by the transfection of Sox9b or Sox10 alone. Similar results were described for the regulation of Col2a1 by Sox10 and Sox9 (Suzuki et al., 2006). The involvement of these two factors in grp2 promoter activity was further evaluated by co-transfection of increasing levels of Sox9b and Sox10 factors. We found that none of these two TFs showed a dose dependent effect on these cells. Although the precise cause of this phenomenon is still unclear, it may be explained by the following possibilities: 1) because ATDC5 cells spontaneously express high levels of Sox9 (Woods et al., 2005) and the Sox9 expression levels may have reached a saturation point, above which the ATDC5 cells are not responsive; but Sox10, in turn, is known to be expressed exclusively in melanoma cells (Bobinet et al., 2013). 2) Specific co-factors may be necessary for transcriptional activation of grp2 by Sox9. It has been reported that Sox9 forms the transcriptional complex including Sox5 and Sox6 to promote the expression of Sox9 targets during chondrogenesis (Lefebvre et al., 1998). The endogenous levels of each one of these co-factors in these cells may be the limiting regulator for promoting the activation of grp2 expression. It is nevertheless of note that the upregulation of grp2 by Sox9/Sox10 transfection was different in vitro and in vivo assays. These observations may indicate that in early development (in vivo assays) and in cartilage differentiation (in vitro assays) the regulatory system may be common but with different partners being recruited. Furthermore, the transactivation of grp2 promoter by Sox10 was confirmed in co-transfection assays using available Sox10 mutants previously shown to affect its binding to DNA (Fig. 5). Using the luciferase reporter assay, we found that the Sox10 m618 mutant no longer significantly induced luciferase expression of the construct driven by the grp2 promoter. Consistent with these results, Sox10 m618 plays a more severe role in phenotype defect than Sox10 baz1 (Carney et al., 2006), although the mechanistic basis remains unclear. Altogether, our results provide clear evidence that Sox10 is a bona fide transcription regulator of grp2 gene. Moreover, to gain further insight into the regulatory mechanism of the grp2 gene, and since our results showed that between region A and region B the transcription activity decreased, we further performed a more detailed in silico analysis and searched for the existence of putative recognition sites to transcription factors in that genomic fragment (between −5531 and +32). Our analysis identified numerous putative cis regulatory elements that may serve as targets for sequence-specific enhancer/silencer transcription factors. We have then used the DBA

Please cite this article as: Fazenda, C., et al., Transcription factors from Sox family regulate expression of zebrafish Gla-rich protein 2 gene, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.079

6

C. Fazenda et al. / Gene xxx (2015) xxx–xxx

algorithm to obtain comparative alignment between zebrafish and medaka grp2 promoter regions in order to detect conserved sequence blocks and then determine putative TFBSs in those blocks, so as to enrich for likely functionally relevant TFBSs. From the list of 143 putative TFBSs families retained after the comparative analysis, we focused only on those having a retained score higher than 20% (see Fig. S3), which included androgen receptor (AR), forkhead-box protein J2 (FoxJ2), forkhead-box class O (FoxO4), GA-binding factor (GA-BF), hypoxia-inducible factor (HIF), leukemia virus factor c (LVc), nuclear factor activated in T cells-3 (NFAT3), NK2 homeobox 2 (Nkx2-2), NK2 homeobox 5 (Nkx2-5), and SMAD family member 3 (Smad3). Interestingly, available data links some of these with either skeletogenesis or chondrogenesis and all were identified in the conserved blocks located between region A and region B. AR was recently shown to be essential for normal skeletal growth (Russell et al., 2015). FoxJ2 was identified as a candidate gene to regulate col10a1 and found to be upregulated in hypertrophic mouse chondrocyte cells (Gu et al., 2014). FoxO4 is one of the three FoxO genes (FoxO1, 3 and 4) found to be expressed in calvaria and vertebrae by qPCR (Ambrogini et al., 2010). HIF signaling was shown to be involved in coupling angiogenesis and osteogenesis during bone development and repair (Drager et al., 2015). NF-AT3 is a known activator and in normal human chondrocytes its translocation to the nucleus due to a calcium signaling was shown to up-regulate miR-140 which in turn decreases the expression of genes that play detrimental roles in osteoarthritis (Tardif et al., 2013). Nkx2-5 was shown to have a link with Wolf–Hirschhorn Syndrome which is characterized by craniofacial malformations and heart defects (Nimura et al., 2009). Nkx2-2 is a useful marker for Ewing sarcoma, a high-grade round cell sarcoma that affects bones and soft tissues in children and young adults (Yoshida et al., 2012). Smad3 was shown to induce chondrogenesis (Furumatsu et al., 2005) but also it can induce or inhibit osteoblast differentiation (Kaji et al., 2006). They are thus possible candidates for regulating expression of grp2 and their involvement should be further analysed in future works. In conclusion, our comparative in silico analysis of zebrafish grp2 gene promoter regions predicts strong candidate TFBS likely to contribute to regulation of grp2 transcription. Our data also provide relevant information demonstrating that GRP is a target of cartilage associated TFs thus confirming that this gene is likely to exert an important role in chondrocytes as suggested by its significant levels of expression in these cells. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2015.06.079. Acknowledgments CF and NC were supported respectively by doctoral (SFRH/BD/ 66745/2009) and postdoctoral (SFRH/BPD/48206/2008) fellowships from the Portuguese Foundation for Science and Technology (FCT). The authors are grateful to Andreia Adrião, Marlene Trindade and Brigite Simões for the subcloning of zebrafish Mef2ca and Mef2cb, and Sox9b and Sox10 (wt, m618 and bazI), respectively, into pCMX vector. Zebrafish Sox9b and Sox10 were kind gifts from Prof. Robert Kelsh (University of Bath). References Ambrogini, E., Almeida, M., Martin-Millan, M., et al., 2010. FoxO-mediated defense against oxidative stress in osteoblasts is indispensable for skeletal homeostasis in mice. Cell Metab. 11, 136–146. Arnold, M.A., Kim, Y., Czubryt, M.P., et al., 2007. MEF2C transcription factor controls chondrocyte hypertrophy and bone development. Dev. Cell 12, 377–389. Bobinet, M., Vignard, V., Florenceau, L., et al., 2013. Overexpression of meloe gene in melanomas is controlled both by specific transcription factors and hypomethylation. PLoS One 8, e75421.

Cancela, M.L., Conceição, N., Laizé, V., 2012. Gla-rich protein, a new player in tissue calcification? Adv. Nutr. 3, 174–181. Carney, T.J., Dutton, K.A., Greenhill, E., et al., 2006. A direct role for Sox10 in specification of neural crest derived sensory neurons. Development 133, 4619–4630. Conceição, N., Fazenda, C., Cancela, M.L., 2012. Comparative gene promoter analysis: an in silico strategy to identify candidate regulatory factors for Gla Rich Protein. J. Appl. Ichthyol. 28, 372–376. Drager, J., Harvey, E.J., Barralet, J., 2015. Hypoxia signalling manipulation for bone regeneration. Expert Rev. Mol. Med. 17, e6. Dutton, K.A., Pauliny, A., Lopes, S.S., et al., 2001. Zebrafish colourless encodes sox10 and specifies non-ectomesenchymal neural crest fates. Development 128, 4113–4125. Farré, D., Roset, R., Huerta, M., et al., 2003. Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res. 31, 3651–3653. Fazenda, C., Simões, B., Kelsh, R.N., et al., 2010. Dual transcriptional regulation by runx2 of matrix Gla protein in Xenopus laevis. Gene 450, 94–102. Fazenda, C., Silva, I.A.L., Cancela, M.L., Conceição, N., 2012. Molecular characterization of two paralog genes encoding Gla-rich protein (Grp) in zebrafish. J. Appl. Ichthyol. 28, 377–381. Furumatsu, T., Tsuda, M., Taniguchi, N., et al., 2005. Smad3 induces chondrogenesis through the activation of SOX9 via CREB-binding protein/p300 recruitment. J. Biol. Chem. 280, 8343–8350. Gu, J., Lu, Y., Li, F., et al., 2014. Identification and characterization of the novel Col10a1 regulatory mechanism during chondrocyte hypertrophic differentiation. Cell Death Dis. 5, e1469. Haldin, C.E., LaBonne, C., 2010. SoxE factors as multifunctional neural crest regulatory factors. Int. J. Biochem. Cell Biol. 42, 441–444. Hong, C.-S., Saint-Jeannet, J.-P., 2005. Sox proteins and neural crest development. Semin. Cell Dev. Biol. 16, 694–703. Huang, X., Saint-Jeannet, J.-P., 2004. Induction of the neural crest and the opportunities of life on the edge. Dev. Biol. 275, 1–11. Kaji, H., Naito, J., Sowa, H., et al., 2006. Smad3 differently affects osteoblast differentiation depending upon its differentiation stage. Horm. Metab. Res. 38, 740–745. Le Jeune, M., Tomavo, N., Tian, T.V., et al., 2010. Identification of four alternatively spliced transcripts of the UCMA/GRP gene, encoding a new Gla-containing protein. Exp. Cell Res. 316, 203–215. Le Jeune, M., Duterque-Coquillaud, M., Flajollet, S., et al., 2011. The expression of GRP gene, encoding four new gla-rich protein isoforms, is finely regulated in cartilage. Osteoporos. Int. 22, S52. Lefebvre, V., de Crombrugghe, B., 1998. Toward understanding SOX9 function in chondrocyte differentiation. Matrix Biol. 16, 529–540. Lefebvre, V., Smits, P., 2005. Transcriptional control of chondrocyte fate and differentiation. Birth Defects Res. 75, 200–212. Lefebvre, V., Li, P., de Crombrugghe, B., 1998. A new long form of Sox5 (L-Sox5) Sox6 and Sox9 are coexpressed in chondrogenesis and cooperatively activate the type II collagen gene. EMBO J. 17, 5718–5733. Messeguer, X., Escudero, R., Farré, D., et al., 2002. PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics 18, 333–334. Michou, L., Conceição, N., Morissette, J., et al., 2012. Genetic association study of UCMA/ GRP and OPTN genes (PDB6 locus) with Paget's disease of bone. Bone 51, 720–728. Miller, C.T., Swartz, M.E., Khuu, P.A., et al., 2007. Mef2ca is required in cranial neural crest to effect endothelin 1 signaling in zebrafish. Dev. Biol. 308, 144–157. Neacsu, C.D., Grosch, M., Tejada, M., et al., 2011. Ucmaa (Grp-2) is required for zebrafish skeletal development. Evidence for a functional role of its glutamate γ-carboxylation. Matrix Biol. 30, 369–378. Nimura, K., Ura, K., Shiratori, H., et al., 2009. A histone H3 lysine 36 trimethyltransferase links Nkx2-5 to Wolf–Hirschhorn syndrome. Nature 460, 287–291. Russell, P.K., Clarke, M.V., Cheong, K., et al., 2015. Androgen receptor action in osteoblasts in male mice is dependent on their stage of maturation. J. Bone Miner. Res. 30, 809–823. Surmann-Schmitt, C., Dietz, U., Kireva, T., et al., 2008. UCMA, a novel secreted cartilagespecific protein with implications in osteogenesis. J. Biol. Chem. 283, 7082–7093. Suzuki, T., Sakai, D., Osumi, N., Wada, H., Wakamatsu, Y., 2006. Sox genes regulate type 2 collagen expression in avian neural crest cells. Dev. Growth Differ. 48, 477–486. Tagariello, A., Luther, J., Streiter, M., et al., 2008. UCMA — a novel secreted factor represents a highly specific marker for distal chondrocytes. Matrix Biol. 27, 3–11. Tardif, G., Pelletier, J.P., Fahmi, H., et al., 2013. NFAT3 and TGF-β/SMAD3 regulate the expression of miR-140 in osteoarthritis. Arthritis Res. Ther. 15, R197. Viegas, C.S.B., Simes, D.C., Laizé, V., et al., 2008. Gla-rich protein (GRP), a new vitamin K-dependent protein identified from sturgeon cartilage and highly conserved in vertebrates. J. Biol. Chem. 283, 36655–36664. Viegas, C.S.B., Cavaco, S., Neves, P.L., et al., 2009. Gla-rich protein is a novel vitamin K-dependent protein present in serum that accumulates at sites of pathological calcifications. Am. J. Pathol. 175, 2288–2298. Wenke, A., Rothhammer, T., Moser, M., Bosserhoff, A.K., 2006. Regulation of integrin alpha10 expression in chondrocytes by the transcription factors AP-2epsilon and Ets-1. Biochem. Biophys. Res. Commun. 345, 495–501. Woods, A., Wang, G., Beier, F., 2005. RhoA/ROCK signaling regulates Sox9 expression and actin organization during chondrogenesis. J. Biol. Chem. 280, 11626–11634. Yoshida, A., Sekine, S., Tsuta, K., et al., 2012. NKX2.2 is a useful immunohistochemical marker for Ewing sarcoma. Am. J. Surg. Pathol. 36, 993–999.

Please cite this article as: Fazenda, C., et al., Transcription factors from Sox family regulate expression of zebrafish Gla-rich protein 2 gene, Gene (2015), http://dx.doi.org/10.1016/j.gene.2015.06.079