Topoisomerase I alone is sufficient to produce short DNA deletions and can also reverse nicks at ribonucleotide sites.

JBC Papers in Press. Published on April 17, 2015 as Manuscript M115.653345 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M115.653345

Topoisomerase I alone is sufficient to produce short DNA deletions and can also reverse nicks at ribonucleotide sites Shar-yin Naomi Huang, Sanchari Ghosh and Yves Pommier * Developmental Therapeutics Branch and Laboratory of Molecular Pharmacology, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, MD 20892. * To whom correspondence should be addressed. Tel.: 301-496-5944; Fax: 301-402-0752; E-mail: [email protected] Running Title: Top1 causes deletions and religates DNA nicks at ribo-sites

Background: DNA deletions at short repeat sites containing ribonucleotides are Top1dependent. Results: Top1 generates DNA deletions at short repeat sites in vitro and also reverses the nicks at the ribo-sites. Conclusion: The impact of Top1 on the ribo-sites is both negative and positive. Significance: We elucidate the detailed mechanism of Top1 interacting with ribo-sites, the most frequently misincorporated non-canonical nucleotide.

ABSTRACT Ribonucleotides monophosphates (rNMPs) are among the most frequent form of DNA aberration, as high ratios of ribonucleotide triphosphate/deoxyribonucleotide triphosphate (rNTP/dNTP) pools result in an estimated two misincorporated rNMPs per kilobase of DNA. The main pathway for the removal of rNMPs is by RNase H2. However, in RNase H2 knockout yeast strain, a topoisomerase I (Top1)-dependent mutator effect develops with accumulation of short deletions within tandem repeats. Proposed models for these deletions implicated processing of Top1generated nicks at rNMP sites or/and sequential Top1 binding, but experimental support has been lacking thus far. Here, we investigated the biochemical mechanism of the Top1-induced short deletions at the rNMP sites by generating nicked DNA substrates bearing 2’,3’-cyclic phosphates at the nick sites, mimicking the Top1-induced nicks. We demonstrate that a second Top1 cleavage complex adjacent to the nick and subsequent faulty Top1 religation lead to the short deletions. Moreover, when acting on the nicked DNA

substrates containing 2’,3’-cyclic phosphates, Top1 generated not only the short deletion, but also a full-length religated DNA product. Catalytically inactive Top1 mutant (Top1-Y723F) also induced the full-length products, indicating that Top1 binding independent of its enzymatic activity promotes the sealing of DNA backbones via nucleophilic attacks by the 5’-hydroxyl on the 2’,3’-cyclic phosphate. The resealed DNA would allow renewed attempt by the error-free RNase H2-dependent repair in vivo. Our results provide direct evidence for the generation of short deletions by sequential Top1 cleavage events and for Top1 promoting the religation of nicks at rNMP sites. INTRODUCTION The chemical stability of deoxyribonucleotides monophosphates (dNMPs) makes them the preferred nucleic acids for storing genetic information. DNA replicative polymerases are highly selective for the dNMPs over ribonucleotides monophosphates (rNMPs) due to

Copyright 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Downloaded from http://www.jbc.org/ at UNIV OF NEW ORLEANS on May 29, 2015

CAPSULE

Top1 causes deletions and religates DNA nicks at ribo-‐sites

freeing Top1 (16,24) [see Fig. 5 (inset)]. The subsequent events leading to DNA deletions at short repeat sites have been the subject of much speculation (8,9,16,18,25). Here we demonstrate that Top1 alone is sufficient to induce the observed DNA deletion at a short repeat site via sequential cleavage of DNA adjacent to the rNMP site. The Top1-induced DNA deletion events described here are accompanied by the loss of the rNMPs, potentially accounting for the way Top1 acts as a back-up rNMPs removal pathway, albeit at a cost of sequence deletions. In addition, we show that Top1 can reverse rNMP-induced DNA nicks, thus allowing the RNase H2-dependent repair pathway to carry out error-free removal of rNMPs. EXPERIMENTAL PROCEDURES Protein expression and purification: Recombinant human Top1 and Top1-Y723F were purified using baculovirus expression system from Sf9 insect cells as described previously (26). Recombinant human TDP1 was over-expressed and purified from E. coli as previously described (27). Over-expression and purification of Nterminal His10-tagged E. coli RtcA was carried out essentially as described previously with minor modifications (28). Briefly, pET16b-RtcA-(2-339) was transformed into BL21(DE3) competent cells and grown in LB medium containing 100 µg/mL ampicillin until OD600= 0.6~0.8 before the culture was chilled and grown for another 16 hr in the presence of 0.1 mM isopropyl b-D-thiogalactoside and 2% (v/v) ethanol at 17 °C. All subsequent procedures were performed at 4 °C. The cells were harvested and the pellet was resuspended in buffer A [50 mM Tris-HCl, pH 7.4, 250 mM NaCl, 2 mM 2-mercaptoethanol, and 10% sucrose, complemented with the addition of Complete, EDTA (ethylenediaminetetraacetic acid)-free Protease Inhibitor Cocktail Tablets (Roche Applied Science)]. Lysozyme was added to 0.2 mg/mL and the mixture was allowed to gently mix at 4 °C for 1 hr before sonication, followed by clarification by ultracentrifugation at 30,000 g for 45 min. The soluble lysate was loaded on a HisTrap HP column (GE Healthcare) pre-charged with nickel ions and pre-equilibrated with buffer

2


the steric hindrances present at their substrate binding sites. However, the selectivity of the DNA polymerases for the correct sugar structures is not absolute, which could be further exacerbated in some cancers bearing mutations in the replicative polymerases (1-4). Combined with the vast excess of rNTP over dNTP pools, rNMPs are frequently misincorporated into the genome during DNA synthesis (5-7). Based on recent estimates, rNMPs are the most frequently misincorporated noncanonical nucleotides during replication [see reviews (8,9)]. The majority of the misincorporated rNMPs are removed by a repair pathway termed ribonucleotide excision repair (RER), which is initiated by RNase H2 nicking the DNA backbone on the 5’-side of the rNMPs (6,10-12). In addition, nucleotide excision repair has been implicated as back-up pathway for rNMPs removal (13,14). Genetic studies in yeast and in mammalian cells show that blocking RER by inactivating RNase H2 leads to heightened cellular distress and genome instability (10,15). The phenotypes exhibited by the yeast strains harboring high levels of genomic rNMPs include DNA deletion at hotspots consisting of short repeats, increased rate of recombination, and replication stress (6,10). Strikingly, inactivating DNA topoisomerase IB (Top1) in these yeast strains reverses these phenotypes (10,16-18), firmly implicating processing of rNMPs by Top1 in the observed cellular responses. Top1 is a ubiquitous enzyme that relaxes DNA supercoiling induced by DNA replication, transcription and chromatin remodeling (19-21). The catalytic mechanism of Top1 involves a reversible transesterification reaction, initiated by the nucleophilic attack by the active site tyrosine (Tyr723 for human Top1) on the scissile phosphate, generating a DNA nick and a covalent protein-DNA complex [termed Top1 cleavage complexes (Top1cc)]. The Top1cc allows the nicked duplex to rotate around the intact strand in a Top1-controlled fashion (22,23), removing any local helical tension before a second transesterification reaction restores the continuity of DNA backbone. However, in the case of a covalent Top1-DNA complex at rNMP sites, the 2’-hydroxyl on the rNMPs can initiate nucleophilic attacks on the phosphotyrosyl linkages, generating a 2’,3’-cyclic phosphates and

Top1 causes deletions and religates DNA nicks at ribo-‐sites A. The column was washed first with buffer A and then with wash buffer (buffer A with the addition of 25 mM imidazole) before elution with a gradient of 100-500 mM imidazole, with the protein peak eluting at ~340 mM imidazole. The protein peak fractions (>95% pure assayed by SDS-PAGE) were buffer-exchanged into storage buffer [(10 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM DTT, 1 mM EDTA, 10 mM adenosine triphosphate (ATP)] and concentrated by centrifugal filters (Millipore). The protein sample was brought to a final concentration of 50% glycerol (v/v) and stored at -80 °C.

were annealed to cold complementary strands 5’ATGTGGCAAAACCTTTGT and 5’ACAAAGGTTTTGCCACATATCTTCAACGCT at 1:1:1 ratio.

Generation of 2’,3’-cyclic phosphate ends: The 12-mer oligo bearing a 3’-terminal ribonucleotide and a 3’-phosphate with the sequence of 5’-AGCGTTGAAGArU-P (final concentration = 4 µM) was incubated with RtcA (final concentration = 0.1 µg/µL) in buffer containing 50 mM Tris-HCl, pH 7.4, 10 mM MgCl2, 200 µM ATP and 2 mM DTT at 37 °C for 30 min. 1 U/µL of calf intestinal alkaline phosphatase (CIP) was added to the samples where indicated and the reaction mixtures were further incubated at 37 °C for 30 min before addition of 1 volume of gel loading buffer [96% (v/v) formamide, 10 mM ethylenediaminetetraacetic acid, 1% (w/v) xylene cyanol and 1% (w/v) bromophenol blue] to terminate the reaction. The resulting products were analyzed on a 20% denaturing polyacrylamide gel electrophoresis (PAGE) gel and stained with SYBR® Gold (Life Technologies). DNA substrates:

RESULTS

Custom synthesized oligonucleotides (Midland Certified or IDT) were either 3'-labeled or 5'labeled prior to annealing with the cold complementary strand at 1:1 ratio. For nicked DNA substrates, RtcA- or mock-treated oligos with different 3’-ends were passed through mini Quick Spin Oligo Columns (Roche Applied Science) before 5’-labeling with (γ-32P) ATP (PerkinElmer) by T4 polynucleotide kinase (3’ phosphatase minus) (New England BioLabs). After passing through mini Quick Spin Oligo Columns (Roche Applied Science) to remove residual (γ-32P) ATP, the 5’-radiolabeled oligos

Top1 binding at rNMP sites generates DNA nicks with 2’,3’-cyclic phosphate ends To study the mechanism of Top1-dependent DNA deletions at short repeat sites under high rNMP background, we focused on the (AT)2 hotspot from the CAN1 gene, which exhibits a strong Top1dependent deletion signature (16-18). We carried out Top1 cleavage assays with DNA constructs containing the (AT)2 hotspot (Fig. 1A) in the absence and presence of camptothecin (CPT), a highly selective and potent Top1 poison (20,30).

3


In vitro Top1 cleavage assays and alkaline treatments: The in vitro Top1 cleavage assays were carried out as described previously (29). The reaction mixture contained 50 to 200 nM of labeled doublestranded or nicked DNA construct, 70 nM or 140 nM of human recombinant Top1 (1X Top1 and 2X Top1). The reaction mixture also contained 10 µM CPT or a 2-fold serial dilution of human recombinant TDP1 (1 to 0.125 µM) where indicated. The reaction was stopped by addition of 0.5% SDS (final concentration) after incubation for 1 hr at 25 °C. For the alkaline treatments, nicked DNA constructs containing 2’,3’-cyclic phosphate ends were allowed to react with 70 or 140 nM of Top1 (1X Top1 and 2X Top1) for 1 hr at 25 °C before the reactions were stopped by addition of 0.5% SDS (final concentration). The samples were then split in two equal parts, and one part of the reaction mixture was further treated with 0.3 M KOH (final concentration) at 55 °C for 1 hr. Alternatively, 0.05 U/µL (final concentration) of RNase HII (New England BioLabs) was added to the reaction mixture and further incubated at 25 °C for 15 min. All reactions were stopped by the addition of 1 volume of gel loading buffer [96% (v/v) formamide, 10 mM EDTA, 1% (w/v) xylene cyanol, and 1% (w/v) bromophenol blue] before analysis by 20% sequencing gels.

Top1 causes deletions and religates DNA nicks at ribo-‐sites Top1cc efficiently (35), the amount of Top1cc decreased with increasing TDP1 (Fig. 1D, lane 26, “Top1cc” band). Most importantly, TDP1 generated two products in a dose-dependent manner, corresponding to Top1cc immediately upstream from the ribonucleotide-induced nick, at sites (h) and (i) (Fig. 1A and D), with Top1cc at site (i) being the dominant product. Generation of substrates containing 2’,3’-cyclic phosphate

To investigate how a nicked DNA with 2’,3’cyclic phosphate leads to short deletions (Fig. 2A), we sought to generate DNA substrates mimicking Top1-induced nicked DNA at rNMP sites. Although Top1 readily generates 2’,3’-cyclic phosphates, such products required gel purification and the 2’,3’-cyclic phosphates were not sufficiently stable through the lengthy purification steps. To circumvent such complex and inefficient purification steps, we took advantage of the fact that RNA 3’-terminal phosphate cyclase (RtcA) efficiently converts a single-stranded DNA with a 3’-rU and 3’-phosphate group (12rUP) into a 2’,3’-cyclic phosphate (Fig. 2B) (36). Because 2’,3’-cyclic phosphates are resistant to dephosphorylation by calf intestinal alkaline phosphatase (CIP) (24), CIP digestion confirmed complete conversion of the substrates by RtcA into single-stranded DNA bearing 2’,3’-cyclic phosphates (12CP) under our experimental conditions (Fig. 2C). The resulting 12CP was then 5’-radiolabeled before annealing to the unlabeled complementary strands to produce the nicked DNA constructs mimicking nicked DNA generated by Top1 at ribonucleotide sites (top panel of Fig. 2A with the 2’,3’-cyclic phosphate represented as the triangle). Sequential binding of Top1 induces the 2-nt deletion at the (AT)2 repeat site To examine whether Top1 alone is able to generate the 2-nt deletion by acting on the substrates containing 2’,3’-cyclic phosphates (Fig. 2A), we let Top1 react with substrates bearing different 3’-ends at the nicked site (Fig. 3A, Nicked-12X). Using these nicked DNA substrates allowed us to focus on the subsequent events induced by Top1 after the initial nicking at the rNMP sites. As shown in Figure 3A, the top strand

4


The constructs contained either a deoxythymidine (dT), a deoxyuridine (dU) or a ribouridine (rU) at the first dT position within the (AT)2 hotspot [X position in Fig. 1A; the designation of the Top1 sites on the (AT)2 hotspot is adopted from our previous study (16)], indicating the position of the phosphortyrosyl linkage in Top1cc. With DNA constructs 3’-labeled on the transcribed strand (TS), the Top1 site (f) was greatly enhanced when the rU was present at the X position independently of CPT (Fig. 1B, lane 9). By contrast, the Top1 site (f) was barely visible with either dT or dU at the X position (lanes 3 and 6), although addition of CPT enhanced Top1 cleavage at site (f) (Fig. 1B, lanes 4 and 7). This indicated that although the Top1cc at site (f) was susceptible to CPT trapping, the 2’-hydroxyl at the X position was capable of enhancing site (f) cleavage independently of CPT. Furthermore, addition of CPT promoted other Top1 sites on the same construct, competing with site (f) under our experimental conditions. SN2 attack on the scissile phosphate of a Top1 cleavage complex by the 2’-hydroxyl at ribonucleotide sites results in a nick in the DNA backbone accompanied by the release of Top1 (16,24) [see Fig. 5 (inset)]. We confirmed that the Top1-induced product with a rU at the X position was an enzyme-free DNA nicked at site (f) by performing Top1 cleavage assay with substrates radiolabeled at the 5’-end of the TS strand (Fig. 1C). The appearance of the Top1-induced band corresponding to 12CP indicates that Top1 is not covalently linked to the product (Fig. 1C). Accordingly, the resulting product of Top1 interacting with the rU at the X position was a nicked DNA with the 2’,3’-cyclic phosphate at the nick site (top panel of Fig. 2A with the 2’,3’-cyclic phosphate represented as the triangle) (24,31). We reasoned that subsequent Top1 binding to the nicked DNA substrate likely led to formation of additional Top1cc (25,32), which do not enter the gel due to the covalent linkage of Top1 to the 3’-end of the DNA. The appearance of the band at the bottom of the well in the presence of Top1 confirmed this (Fig. 1D, lane 2, “Top1cc” band). We took advantage of the fact that tyrosyl DNA phosphodiesterase 1 (TDP1) directly hydrolyzes such complexes (33,34) to map the position of phosphotyrosyl linkage on the substrate. While TDP1 does not resolve intact


To confirm that the 30-nt religation product indeed contained the rNMP (see Fig. 5g) and that the 28nt product had lost the rNMP (see Fig. 5f), we treated the religation products with alkali (KOH) (Fig. 4D). Comparison of the band intensities of the 28-nt products with and without treatment revealed that the 28-nt product was completely resistant to alkaline treatment (Fig. 4D, compare lanes 2-3 with lanes 5-6), indicating the rNMPs had been lost. By contrast, the 30-nt religation product was sensitive to alkaline treatment (Fig. 4D, compare lanes 1-3 with lanes 4-6), confirming the presence of rNMPs in the 30-nt religation products. Additional experiments were performed with RNase H2, which only breaks DNA at the rNMP sites (Fig. 4E). The 30-nt religation product was sensitive to RNase H2, while the 28-nt religation product was not. These results confirmed that Top1 promoted religation of the DNA nick with 2’,3’-cyclic phosphate. Furthermore, at the (AT)2 hot spot, sequential Top1cc 2-nt away from the nick leads to the 2-nt deletion, accompanied by the loss of the rNMPs (see Fig. 5). DISCUSSION

In the case of the construct bearing 2’,3’-cyclic phosphate at the nicked site (Nicked-12CP), Top1 induced, in addition to the 2-nt deletion (28-nt) product, a prominent 30-nt product (Fig. 3B, lanes 14-15). The same construct also generated a small amount of the 30-nt products in the absence of Top1 (Fig. 3B, lane 13), indicating that 2’,3’cylclic phosphates are susceptible to direct nucleophilic attack by the 5’-hydroxyl at the DNA nicks (38,39). However, the presence of Top1 substantially enhanced the formation of the 30-nt product. We reasoned that the binding of Top1 enzyme to Nicked-12CP at site (f) potentially promoted a favorable alignment of the 2’,3’cylclic phosphate and the 5’-hydroxyl for the nucleophilic attack [see Fig. 5 (inset)]. Therefore,

Genomic misincorporation of ribonucleotides monophosphates (rNMPs) occurs in many domains of living organism: from bacteria to yeast to mammalian cells (5,6,15,41). Cells have developed specific RNase H2-dependent pathways

5


we tested the ability of the catalytically-inactive Top1-Y723F mutant enzyme (20,40) to generate the religation product from the nicked DNA constructs. Lacking the catalytic residue, Top1Y723F cannot catalyze the cleavage reaction, but maintains its DNA binding affinity. As expected, Top1-Y723F did not induce Top1cc (Fig. 3C). In addition, Top1-Y723F failed to induce the 28-nt product from any of the nicked DNA constructs tested, indicating that the generation of the deletion product requires catalytic activity of Top1. Top1-Y723F induced a similar amount of the 30-nt product from Nicked-12CP as wild type Top1 (Fig. 3C, lanes 14-15), consistent with the idea that Top1 binding promoted religation of 2’,3’-cyclic phosphate and 5’-hydroxyl group. The Top1-induced faulty religation 28-nt product does not contain rNMPs

(TS) of the (AT)2 hotspot construct was split into a 5’-radio-labeled 12-nt piece bearing different 3’ends and a 18-nt piece bearing 5’-hydroxyl. Therefore, any product longer than 12-nt represented a religation product. Addition of Top1 to all nicked DNA constructs generated Top1cc (Fig. 3B “Top1cc” band corresponding to the bottom of the gel wells) (21,37). These Top1cc represent suicide complexes generated by Top1 binding to the 5’ side of the existing nick (32). In addition, we observed a Top1-induced 28-nt product with all the substrates tested. Because direct sealing of the DNA nicks would generate a 30-nt (12 + 18-nt) product, the 28-nt product represents a faulty religation product with a 2-nt deletion. We hypothesized that the second Top1cc 2-nt upstream from the nicked site [site (h) in Fig. 1D] was responsible for the observed 2-nt loss. Even though Top1cc formed at site (i) was more abundant than site (h), Top1cc at site (i) appeared inefficient at religating across the gap as little to no 27-nt products was generated (Fig. 3B). Top1 induced varying amount of the 28-nt products in the different substrates, which was most abundant when the 3’-end was a deoxyribose without phosphate (Nicked-12dT) (Fig. 3B, lanes 2-3). The difference in local structures of the various 3’-ends at the DNA nicks most likely modulated the occurrence of Top1cc at site (h). Top1 binding at DNA nicks with 2’,3’-cyclic phosphates promotes religation


Biochemical studies have demonstrated that Top1 nicks DNA at rNMP sites with a RNase H2-like ribonuclease activity, but with the opposite polarity from RNase H2 (16,42). The scissile phosphate of the Top1cc at a rNMP is susceptible to nucleophilic attack by the 2’hydroxyl on the nearby sugar moiety, forming a 2’,3’-cyclic phosphate and releasing Top1 [illustrated by Fig. 5 (inset)]. In RNase H2defective cells, the high levels of rNMPs combined with the ubiquitous presence of Top1, with its ability to form Top1cc extensively (43,44), likely result in a large number of DNA nicks. Furthermore, the 2’,3’-cyclic phosphates on the Top1-induced DNA nicks are considered as “dirty” ends, as they are neither suitable substrates for ligation nor for polymerase extension. The events following the formation of Top1-induced nicks with 2’,3’-cyclic phosphates that eventually result in DNA deletions at short repeat sites have been the subject of much speculation (8,9,18,25). Here we provide experimental evidence for a sequential model (25). First, Top1 forms a cleavage complex at the rNMP site (Fig. 5a), which leads to the 2’,3’-cyclic phosphate ends (Fig. 5b). Second, a Top1cc forms 2 bases 5’ to the nick (Fig. 5d), leading to the release of the short DNA fragment with the 2’,3’cyclic phosphates (Fig. 5e). The facile release of the dinucleotide is consistent with prior biochemical studies (32,45), attributable to the lack of extensive Top1 interaction to its DNA substrates on the 3’-side of the scissile phosphates (46). Efficient religation across gaps is also consistent with previous reports (32,45,47). Thus, the sequential cleavage of Top1, as depicted in Figure 5, results in short DNA deletions at repeat sequences. We note that while this manuscript was under review, a separate report by Sparks and Burgers appeared, which corroborates remarkably well with our present findings (31). Given the relative locations of the two Top1 binding events at the (AT)2 hot spot, the DNA deletions are accompanied by loss of rNMPs (Fig. 5d-f). This may account for the fact that Top1 has been reported to function as a back-up pathway to RER as deletion of Top1 gene leads to higher accumulation of rNMPs in RNase H2defective yeast strains (48). Moreover, the model of sequential Top1-binding is consistent with a recent report implicating Srs2 and Exo1 in a back-

6


for the removal of rNMPs, termed ribonucleotide excision repair (RER). In general, the misincorporated rNMPs are first recognized by RNase H2, which signals the beginning of the repair process by nicking the DNA on the 5’-side of the rNMP. These nicks serve as the entry point for a host of repair enzymes to simultaneously synthesize rNMP-free DNA and remove the pieces of rNMP-containing DNA. In E. coli, the removal of the rNMP-containing piece and the synthesis of the new piece are carried out by the 5’ to 3’ exonuclease activity and the polymerase activity of DNA polymerase I (41). In eukaryotes, replicative polymerases carry out strand-displacement synthesis in the presence of helicases, and the displaced DNA flap containing rNMPs are excised by structural nucleases, such as FEN1 (12). DNA ligase then restores the continuity of DNA backbone by sealing the final nicks. In addition, cells likely possess redundant repair pathways, as nucleotide excision repair (NER) has also been implicated in the removal of rNMPs (13,14). An important question is what are the consequences of unremoved rNMPs? Despite the labile nature of rNMPs, experiments carried out in yeast strains defective in RNase H2 and encoding a modified DNA polymerase prone to misincorporate rNMPs show that high levels of genomic rNMPs are tolerated. However, these yeast strains develop DNA deletions at short repeat sites and experience increased recombination rates (16,17). Additionally, the large number of genomic rNMPs in RNase H2null mouse embryonic fibroblasts leads to a strong p53-depedent DNA damage response (DDR) and significantly increased micronuclei occurrence and chromosomal rearrangements (15). In humans, mutations in RNase H2 give rise to the neuroinflammatory disease Aicardi-Goutières syndrome (AGS). Importantly, in yeast strains with high levels of genomic rNMPs, additional deletion of the Top1 gene essentially eliminates all of the aforementioned phenotypes while the levels of genomic rNMPs remain high (10,16-18). These results clearly establish that the cellular distress and genome instability in RNase H2-defective yeast are due to the processing of rNMPs by Top1. Whether this effect of Top1 extends to mammalian cells with defective RNase H2, and whether it has any potential connection to AGS, require further investigations.


ACKNOWLEDGEMENT We thank Dr. Stewart Shuman (Memorial Sloan Kettering Cancer Center) for the kind gift of RtcA expression plasmid and insightful discussions. Our studies are supported by the National Cancer Institute Intramural Program, Center for Cancer Research (Z01-BC 006161).

REFERENCES 1. 2.

Meng, B., Hoang, L. N., McIntyre, J. B., Duggan, M. A., Nelson, G. S., Lee, C. H., and Kobel, M. (2014) POLE exonuclease domain mutation predicts long progression-free survival in grade 3 endometrioid carcinoma of the endometrium. Gynecologic oncology 134, 15-19 Palles, C., Cazier, J. B., Howarth, K. M., Domingo, E., Jones, A. M., Broderick, P., Kemp, Z., Spain, S. L., Almeida, E. G., Salguero, I., Sherborne, A., Chubb, D., Carvajal-Carmona, L. G.,

7


rapidly the rNMPs are removed after misincorporation by replicative polymerases. Of the estimated more than 106 rNMPs embedded in the genome per cycle of replication in mammalian cells (15,49), what fraction is yet to be repaired by RNase H2-dependent RER before Top1-induced nicks can occur? Could Top1-induced DNA nicks pose greater threats in particular types of tissues? A recent key report highlights the potential damage of genomic rNMPs by showing that human ligases are prone to stall when they encounter RNase H2-generated nicks (50). The abortive ligation generates 5’-adenylation adducts, which require processing by aprataxin. Elimination of aprataxin homolog in yeast leads to impaired growth and hypersensitivity to hydroxyurea in a RNase H2-dependent fashion (50). Mutations in human aprataxin leads to the late onset neurological disease, ataxia oculomotor apraxia 1 (AOA1). Genomes of non-replicative cells, such as neurons, potentially accumulate high levels of rNMPs because DNA repair polymerases repeatedly misincorporate rNMPs, particularly with the low dNTP/rNTP ratio in these cells. It is possible that physiological manifestation of AOA1 only arises under the background of high genomic rNMPs. The results in the current study confirmed that interaction of Top1 with embedded rNMPs under similar background could have significant consequences.

up pathway to RER (17). Klein and coworkers showed that Srs2 and Exo1 removed a small DNA fragment on the 5’-hydroxyl side of the Top1induced nicks in vitro, creating a gap (17). From the biochemical point of view, Top1 and Srs2 compete for the same substrate: the nicks generated by the initial Top1 binding event. Genetic inactivation of Srs2 leads to higher rates of short DNA deletions (17), a finding that supports our interpretation since Top1 would have more opportunities to process the nicks in the absence of Srs2. Notably, we also found that Top1 efficiently promoted the resealing of the DNA nicks generated by the initial Top1cc at the rNMP sites (Fig. 3B-C and Fig. 5), consistent with previous reports (38,39). The rNMPs are highly labile as they are prone to spontaneous hydrolysis, forming nicks that are identical to the ones generated by Top1 at rNMP sites. If a misincorporated rNMP undergoes spontaneous hydrolysis before RNase H2 locates it, the resulting DNA nicks (with 2’,3’-cyclic phosphates) are no longer substrates for RNase H2 and therefore potentially excluded from the errorfree RNase H2-dependent repair. We note that when Top1 interacts with DNA nicks containing 2’,3’-cyclic phosphates, it generates the resealed full-length construct (Fig. 5g) as the dominant product, while the short deletions (Fig. 5f) appear as the minor product (see Fig. 3B). Direct resealing of this type of nicks would allow renewed attempt for repair by the RNase H2dependent pathway. Therefore, the consequences of Top1 can be viewed as both positive and negative, in a state of equilibrium (Fig. 5). Finally, it is important to consider the potential impact of Top1 under normal conditions. While RNase H2-dependent RER is the predominant repair pathway, it is not known how


4. 5. 6. 7.

8. 9. 10. 11. 12. 13. 14. 15.

8


3.

Ma, Y., Kaur, K., Dobbins, S., Barclay, E., Gorman, M., Martin, L., Kovac, M. B., Humphray, S., Thomas, H. J., Maher, E., Evans, G., Lucassen, A., Cummings, C., Stevens, M., Walker, L., Halliday, D., Armstrong, R., Paterson, J., Hodgson, S., Homfray, T., Side, L., Izatt, L., Donaldson, A., Tomkins, S., Morrison, P., Goodman, S., Brewer, C., Henderson, A., Davidson, R., Murday, V., Cook, J., Haites, N., Bishop, T., Sheridan, E., Green, A., Marks, C., Carpenter, S., Broughton, M., Greenhalge, L., Suri, M., Donnelly, P. C., Bell, J., Bentley, D., McVean, G., Ratcliffe, P., Taylor, J., Wilkie, A., Donnelly, P. C., Broxholme, J., Buck, D., Cazier, J. B., Cornall, R., Gregory, L., Knight, J., Lunter, G., McVean, G., Taylor, J., Tomlinson, I., Wilkie, A., Buck, D. L., Gregory, L., Humphray, S., Kingsbury, Z., McVean, G. L., Donnelly, P., Cazier, J. B., Broxholme, J., Grocock, R., Hatton, E., Holmes, C. C., Hughes, L., Humburg, P., Kanapin, A., Lunter, G., Murray, L., Rimmer, A., Lucassen, A., Holmes, C. C., Bentley, D., Donnelly, P., Taylor, J., Petridis, C., Roylance, R., Sawyer, E. J., Kerr, D. J., Clark, S., Grimes, J., Kearsey, S. E., Thomas, H. J., McVean, G., Houlston, R. S., and Tomlinson, I. (2012) Germline mutations affecting the proofreading domains of POLE and POLD1 predispose to colorectal adenomas and carcinomas. Nature genetics 45, 136-144 Abaan, O. D., Polley, E. C., Davis, S. R., Zhu, Y. J., Bilke, S., Walker, R. L., Pineda, M., Gindin, Y., Jiang, Y., Reinhold, W. C., Holbeck, S. L., Simon, R. M., Doroshow, J. H., Pommier, Y., and Meltzer, P. S. (2013) The Exomes of the NCI-60 Panel: A Genomic Resource for Cancer Biology and Systems Pharmacology. Cancer Res 73, 4372-4382 Sousa, F. G., Matuo, R., Tang, S. W., Rajapakse, V. N., Luna, A., Sander, C., Varma, S., Simon, P. H., Doroshow, J. H., Reinhold, W. C., and Pommier, Y. (2015) Alterations of DNA repair genes in the NCI-60 cell lines and their predictive value for anticancer drug activity. DNA repair Nick McElhinny, S. A., Watts, B. E., Kumar, D., Watt, D. L., Lundström, E.-B., Burgers, P. M. J., Johansson, E., Chabes, A., and Kunkel, T. A. (2010) Abundant ribonucleotide incorporation into DNA by yeast replicative polymerases. Proc Natl Acad Sci U S A 107, 4949-4954 Nick McElhinny, S. A., Kumar, D., Clark, A. B., Watt, D. L., Watts, B. E., Lundström, E.-B., Johansson, E., Chabes, A., and Kunkel, T. A. (2010) Genome instability due to ribonucleotide incorporation into DNA. Nat Chem Biol 6, 774-781 Clausen, A. R., Lujan, S. A., Burkholder, A. B., Orebaugh, C. D., Williams, J. S., Clausen, M. F., Malc, E. P., Mieczkowski, P. A., Fargo, D. C., Smith, D. J., and Kunkel, T. A. (2015) Tracking replication enzymology in vivo by genome-wide mapping of ribonucleotide incorporation. Nat Struct Mol Biol 22, 185-191 Williams, J. S., and Kunkel, T. A. (2014) Ribonucleotides in DNA: origins, repair and consequences. DNA repair 19, 27-37 Potenski, C. J., and Klein, H. L. (2014) How the misincorporation of ribonucleotides into genomic DNA can be both harmful and helpful to cells. Nucleic acids research 42, 10226-10234 Lazzaro, F., Novarina, D., Amara, F., Watt, D. L., Stone, J. E., Costanzo, V., Burgers, P. M., Kunkel, T. A., Plevani, P., and Muzi-Falconi, M. (2012) RNase H and postreplication repair protect cells from ribonucleotides incorporated in DNA. Mol Cell 45, 99-110 Shen, Y., Koh, K. D., Weiss, B., and Storici, F. (2012) Mispaired rNMPs in DNA are mutagenic and are targets of mismatch repair and RNases H. Nat Struct Mol Biol 19, 98-104 Sparks, J. L., Chon, H., Cerritelli, S. M., Kunkel, T. A., Johansson, E., Crouch, R. J., and Burgers, P. M. (2012) RNase H2-Initiated Ribonucleotide Excision Repair. Mol Cell Kim, N., Cho, J. E., Li, Y. C., and Jinks-Robertson, S. (2013) RNA:DNA hybrids initiate quasipalindrome-associated mutations in highly transcribed yeast DNA. PLoS genetics 9, e1003924 Vaisman, A., McDonald, J. P., Huston, D., Kuban, W., Liu, L., Van Houten, B., and Woodgate, R. (2013) Removal of misincorporated ribonucleotides from prokaryotic genomes: an unexpected role for nucleotide excision repair. PLoS genetics 9, e1003878 Reijns, M. A. M., Rabe, B., Rigby, R. E., Mill, P., Astell, K. R., Lettice, L. A., Boyle, S., Leitch, A., Keighren, M., Kilanowski, F., Devenney, P. S., Sexton, D., Grimes, G., Holt, I. J., Hill, R. E., Taylor, M. S., Lawson, K. A., Dorin, J. R., and Jackson, A. P. (2012) Enzymatic removal of


16. 17. 18. 19. 20.

22. 23. 24. 25. 26.

27.

28. 29. 30. 31. 32.

33.

9


21.

ribonucleotides from DNA is essential for mammalian genome integrity and development. Cell 149, 1008-1022 Kim, N., Huang, S.-y. N., Williams, J. S., Li, Y. C., Clark, A. B., Cho, J.-E., Kunkel, T. A., Pommier, Y., and Jinks-Robertson, S. (2011) Mutagenic processing of ribonucleotides in DNA by yeast topoisomerase I. Science 332, 1561-1564 Potenski, C. J., Niu, H., Sung, P., and Klein, H. L. (2014) Avoidance of ribonucleotide-induced mutations by RNase H2 and Srs2-Exo1 mechanisms. Nature 511, 251-254 Takahashi, T., Burguiere-Slezak, G., Van der Kemp, P. A., and Boiteux, S. (2010) Topoisomerase 1 provokes the formation of short deletions in repeated sequences upon high transcription in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A Wang, J. C. (2002) Cellular roles of DNA topoisomerases: a molecular perspective. Nature reviews 3, 430-440 Pommier, Y., Leo, E., Zhang, H., and Marchand, C. (2010) DNA topoisomerases and their poisoning by anticancer and antibacterial drugs. Chem Biol 17, 421-433 Leppard, J. B., and Champoux, J. J. (2005) Human DNA topoisomerase I: relaxation, roles, and damage control. Chromosoma 114, 75-85 Koster, D. A., Croquette, V., Dekker, C., Shuman, S., and Dekker, N. H. (2005) Friction and torque govern the relaxation of DNA supercoils by eukaryotic topoisomerase IB. Nature 434, 671-674 Seol, Y., Zhang, H., Pommier, Y., and Neuman, K. C. (2012) A kinetic clutch governs religation by type IB topoisomerases and determines camptothecin sensitivity. Proceedings of the National Academy of Sciences of the United States of America 109, 16125-16130 Sekiguchi, J., and Shuman, S. (1997) Site-specific ribonuclease activity of eukaryotic DNA topoisomerase I. Mol Cell 1, 89-97 Cho, J. E., Kim, N., Li, Y. C., and Jinks-Robertson, S. (2013) Two distinct mechanisms of Topoisomerase 1-dependent mutagenesis in yeast. DNA repair 12, 205-211 Pourquier, P., Ueng, L.-M., Fertala, J., Wang, D., Park, H.-J., Essigmann, J. M., Bjornsti, M.-A., and Pommier, Y. (1999) Induction of Reversible Complexes between Eukaryotic DNA Topoisomerase I and DNA-containing Oxidative Base Damages. Journal of Biological Chemistry 274, 8516-8523 Antony, S., Marchand, C., Stephen, A. G., Thibaut, L., Agama, K. K., Fisher, R. J., and Pommier, Y. (2007) Novel high-throughput electrochemiluminescent assay for identification of human tyrosyl-DNA phosphodiesterase (Tdp1) inhibitors and characterization of furamidine (NSC 305831) as an inhibitor of Tdp1. Nucleic acids research 35, 4474-4484 Tanaka, N., Smith, P., and Shuman, S. (2010) Structure of the RNA 3'-phosphate cyclaseadenylate intermediate illuminates nucleotide specificity and covalent nucleotidyl transfer. Structure 18, 449-457 Dexheimer, T. S., and Pommier, Y. (2008) DNA cleavage assay for the identification of topoisomerase I inhibitors. Nat Protoc 3, 1736-1750 Hsiang, Y. H., Hertzberg, R., Hecht, S., and Liu, L. F. (1985) Camptothecin induces proteinlinked DNA breaks via mammalian DNA topoisomerase I. J. Biol. Chem. 260, 14873-14878 Sparks, J. L., and Burgers, P. M. (2015) Error-free and mutagenic processing of topoisomerase 1provoked damage at genomic ribonucleotides. EMBO J Pourquier, P., Pilon, A., Kohlhagen, G., Mazumder, A., Sharma, A., and Pommier, Y. (1997) Trapping of mammalian topoisomerase I and recombinations induced by damaged DNA containing nicks or gaps: importance of DNA end phosphorylation and camptothecin effects. J. Biol. Chem. 272, 26441-26447 Yang, S.-W., Burgin, A. B., Huizenga, B. N., Robertson, C. A., Yao, K. C., and Nash, H. A. (1996) A eukaryotic enzyme that can disjoin dead-end covalent complexes between DNA and type I topoisomerases. Proc. Natl. Acad. Sci. U.S.A. 93, 11534-11539

Top1 causes deletions and religates DNA nicks at ribo-‐sites 34. 35. 36. 37. 38. 39.

41. 42. 43.

44. 45. 46. 47. 48. 49. 50.

10


40.

Interthal, H., and Champoux, J. J. (2011) Effects of DNA and protein size on substrate cleavage by human tyrosyl-DNA phosphodiesterase 1. The Biochemical journal 436, 559-566 Interthal, H., Chen, H. J., and Champoux, J. J. (2005) Human Tdp1 cleaves a broad spectrum of substrates, including phosphoamide linkages. J Biol Chem 280, 36518-36528 Chakravarty, A. K., and Shuman, S. (2011) RNA 3'-phosphate cyclase (RtcA) catalyzes ligaselike adenylylation of DNA and RNA 5'-monophosphate ends. The Journal of biological chemistry 286, 4117-4122 Pommier, Y., Pourquier, P., Fan, Y., and Strumberg, D. (1998) Mechanism of action of eukaryotic DNA topoisomerase I and drugs targeted to the enzyme. Biochimica et biophysica acta 1400, 83-105 Shuman, S. (1998) Polynucleotide ligase activity of eukaryotic topoisomerase I. Mol Cell 1, 741748 Woodfield, G., Cheng, C., Shuman, S., and Burgin, A. B. (2000) Vaccinia topoisomerase and Cre recombinase catalyze direct ligation of activated DNA substrates containing a 3'-para-nitrophenyl phosphate ester. Nucleic acids research 28, 3323-3331 Champoux, J. J. (2001) DNA topoisomerases: Structure, Function, and Mechanism. Annu. Rev. Biochem. 70, 369-413 Vaisman, A., McDonald, J. P., Noll, S., Huston, D., Loeb, G., Goodman, M. F., and Woodgate, R. (2014) Investigating the mechanisms of ribonucleotide excision repair in Escherichia coli. Mutation research. Fundamental and molecular mechanisms of mutagenesis 761, 21-33 Shuman, S., and Turner, J. (1993) Site-specific interaction of vaccinia virus topoisomerase I with base and sugar moieties in duplex DNA. The Journal of biological chemistry 268, 18943-18950 Strumberg, D., Pilon, A. A., Smith, M., Hickey, R., Malkas, L., and Pommier, Y. (2000) Conversion of topoisomerase I cleavage complexes on the leading strand of ribosomal DNA into 5'-phosphorylated DNA double-strand breaks by replication runoff. Mol. Cell. Biol. 20, 39773987 Pommier, Y., Poddevin, B., Gupta, M., and Jenkins, J. (1994) DNA topoisomerases I & II cleavage sites in the type 1 human immunodeficiency virus (HIV-1) DNA promoter region. Biochem Biophys Res Commun 205, 1601-1609 Shuman, S. (1992) DNA strand transfer reactions catalyzed by Vaccinia topoisomerase I. J. Biol. Chem. 267, 8620-8627 Redinbo, M. R., Stewart, L., Kuhn, P., Champoux, J. J., and Hol, W. G. (1998) Crystal structures of human topoisomerase I in covalent and noncovalent complexes with DNA. Science 279, 15041513 Henningfeld, K. A., and Hecht, S. (1995) A model for topoisomerase I-mediated insertions and deletions with duplex DNA substrates containing branches, nicks, and gaps. Biochemistry 34, 6120-6129 Williams, J. S., Smith, D. J., Marjavaara, L., Lujan, S. A., Chabes, A., and Kunkel, T. A. (2013) Topoisomerase 1-mediated removal of ribonucleotides from nascent leading-strand DNA. Mol Cell 49, 1010-1015 Clausen, A. R., Zhang, S., Burgers, P. M., Lee, M. Y., and Kunkel, T. A. (2013) Ribonucleotide incorporation, proofreading and bypass by human DNA polymerase delta. DNA repair 12, 121127 Tumbale, P., Williams, J. S., Schellenberg, M. J., Kunkel, T. A., and Williams, R. S. (2014) Aprataxin resolves adenylated RNA-DNA junctions to maintain genome integrity. Nature 506, 111-115

Top1 causes deletions and religates DNA nicks at ribo-‐sites FIGURE LEGENDS

FIG 2. Generation of 2’,3’-cyclic phosphates. (A) Scheme depicting the generation of 2-nt deletion from nicked DNA substrates containing 2’,3’-cyclic phosphate ends (represented as the red triangle). (B) Biochemical scheme of the RNA 3'-terminal phosphate cyclase (RtcA) reaction. RtcA generates a 2’,3’cyclic phosphate end (12CP) from single-stranded DNA with 3’-ribonucleotide containing a 3’-phosphate group (12rUP). The resulting 2’,3’-cyclic phosphate (12CP) is not susceptible to digestion by calf intestinal alkaline phosphatase (CIP), while the 3’-phosphate group on the 3’-ribonucleotide is. (C) CIP digestion verified the completion of 2’,3’-cyclic phosphate generation. The single-stranded DNA with 3’ribonucleotide (12rU) was not susceptible to CIP. The same DNA construct with an additional 3’phosphate group (12rUP) is dephosphatased by CIP, generating a 12rU, as demonstrated by the decreased migration mobility in the sequencing gel. However, the product generated by RtcA from 12rUP is completely resistant to CIP treatment, as shown by the unaltered migration mobility, indicating that conversion of 12rUP to 12CP by RtcA was complete. To produce the DNA constructs mimicking Top1induced DNA nicks [as shown in panel (A)], we used RtcA to generate a 12-nt piece of DNA bearing 2’,3’-cyclic phosphates (12CP), followed by annealing with the complementary DNA strands. FIG 3. Induction of both short deletions and religation by Top1 at rNMP misincorporation sites. (A) Nicked DNA constructs (Nicked-12X) containing the (AT)2 short repeat site from the CAN1 reporter gene (see top panel of Fig 2A). The length of each of the 3 fragments constituting the nicked DNA substrate is indicated. The 5’-end of the 12-mer was radio-labeled and each construct contained a different 3’-end (X). The structures of the different 3’-ends are illustrated on the right side of the panel. (B) Top1induced religation of nicked DNA substrates bearing various 3’-ends (Nicked-12X). The nicked DNA constructs shown in (A) were reacted with two different concentrations of Top1 (1X Top1 and 2X Top1) until reaching equilibrium, then resolved on denaturing sequencing gels. A representative gel is shown. (C) Same as in (B) except that reaction mixtures contained the catalytically inactive Top1 mutant, Top1Y723F. FIG. 4. Top1-induced short deletion in rNMP-containing DNA, accompanied by excision of the rNMPs. (A) Scheme showing the 28-nt product accompanied by loss of rNMPs, which would be resistant to breakage by alkaline treatment. (B) Alternative scheme showing the 28-nt product retaining rNMPs, which would be sensitive to breakage by alkaline treatment, generating 2’,3’-cyclic phosphates. (C) Full length religated product containing the rNMP, which is predicted to be cleaved by alkaline treatment. (D) Top1-induced relegation products with or without alkaline treatment. A representative gel is shown.

11


FIG. 1. Top1 induces DNA nicks at rNMP sites and generation of 2’,3’-cyclic phosphates. (A) Sequence of the DNA construct containing the (AT)2 short repeat site from the CAN1 reporter gene is shown. The (AT)2 short repeat site is marked by a gray box. The top strand is the transcribed strand (TS) and the bottom strand is the non-transcribed strand (NTS) The TS was radiolabeled at the 3’-end [for panel (B)], or radiolabeled at the 5’-end [for panel (C) and (D)]. Five Top1 sites in the transcribed strand are marked by e-i, indicating the positions of the phosphortyrosyl linkage in Top1cc. (B) Representative Top1 cleavage assay with the construct sequence (3’-labeled on the TS) shown in (A) resolved by denaturing sequencing gel. The nucleotide at the X-position is a deoxythymidine (dT), a deoxyuridine (dU), or a ribouridine (rU). Top1-induced cleavage products are labeled e, f, or g (annotated with their respective length), corresponding to the positions shown in panel (A). (C) Representative Top1 cleavage assay with the construct sequence (5’-labeled on the TS) shown in (A) containing a rU at the X-position. The only visible site, f, is annotated with its corresponding length. (D) Representative Top1 cleavage assay with the construct sequence (5’-labeled on the TS) shown in (A) containing a rU at the X-position. The reactions contained a 2-fold serial dilution of human recombinant TDP1 (1 to 0.125 µM). Top1cc bands correspond the bottom of the gel wells. The Top1 sites f, h and i are annotated with their respective length. TDP1-generated products bear 3’-phosphate ends as indicated.

Top1 causes deletions and religates DNA nicks at ribo-‐sites Nicked DNA constructs containing 2’,3’-cyclic phosphate at the X position were allowed to react with two different concentrations of Top1 until reaching equilibrium (1X Top1 and 2X Top1), then the samples were split in two. One part of the reaction mixture was further treated with 0.3 M KOH (final concentration) at 55 °C for 1 hr. Products were then resolved on a denaturing sequencing gel. (E) Quantification of the 30-nt and 28-nt products from KOH- (panel D) and RNase H2-treatment. The same experiment as in (D) was carried out with RNase H2, as the enzyme selectively cleaves ribonucleotide embedded in DNA. Band intensities were normalized to that of the untreated 30-nt product containing 1X Top1 in each experiment.

12


FIG. 5. Scheme for the processing of rNMP-containing substrates leading to Top1-induced deletions at short repeats or Top1-induced religation of the DNA nicks for subsequent RNase H2dependent repair. (a) rNMPs embedded in the genomic DNA, which can generate products (b) or (c); (b) DNA breaks with 2’,3’-cyclic phosphates can be generated either by Top1 binding to the rNMPs or by spontaneous breakage; (c) RNase H2-mediated DNA repair removes rNMPs from the genomic DNA; (d) a second Top1cc adjacent to the nick enables the dissociation of the short DNA fragment, resulting in the excision of the ribonucleotide; (e) religation across the gap by Top1; (f) Top1 dissociates leaving a 2-nt deletion; (g) alternatively, Top1 binding at the 2’,3’-cyclic phosphates can reseal the DNA nicks, which allows RNase H2-mediated DNA repair to remove ribonucleotides to generate (c). Bottom inset: chemical scheme of the key intermediates.

Fig. 1 18

(D)

i h f e

5’-AGCGTTGAAGAXATGTGGCAAAACCTTTGT 3’-TCGCAACTTCTATACACCGTTTTGGAAACA (B)

(3’-label)

X=

O

T O

O

U O

OH

OH

dT

dU

O

(C)

U

(TS) (NTS)

(5’-label)

X=

rU

Top1 − + + + + + TDP1

Top1cc (5’-label)

O OH OH

rU

X=

Top1 − + + − + + − + + CPT − − + − − + − − +

rU

Top1 − + 30

30

30

24 (g)

Marker 18


12 g

(A)

18 (f ) 16 (e) 12CP (f ) 12CP (f)

1 2 3 4 5 6 7 8 9 10

1 2

10-P (h) 9-P (i) 1 2 3 4 5 6

Fig. 2 (A)

12

18

5’-AGCGTTGAAGAU ATGTGGCAAAACCTTTGT 3’-TCGCAACTTCTA-TACACCGTTTTGGAAACA

(TS) (NTS)

? 28

5’-AGCGTTGAAG ATGTGGCAAAACCTTTGT 3’-TCGCAACTTCTATACACCGTTTTGGAAACA

O

Base O

O

ATP

O OH O P OO-

Base

AMP+PPi

CIP

CIP O

Base O HO OH

12rU

O O

RtcA

12rUP

O P

O

O-

(C)

12rU RtcA CIP

12CP

Marker 10

− − − +

12rUP

− −

− +

+ + − + 12rU 12rUP 12CP


(B)

(TS) (NTS)

Fig. 3 (A) 5’32P

12

nick X

18

30 Nicked-12X

O

(TS) X

=

O

Base

Base O

O

OH

OH OH

12dT

12rU

Base O

O O P OO-

12dTP

O

Base O

O OH O P OO-

12rUP

Base

O

O O O

P

O

O-

12CP (

)

(C) X = 12dT 12rU12dTP12rUP12CP Top1

X = 12dT 12rU 12dTP 12rUP 12CP top1Y723F

Religation products

Top1cc

30 28

30

12X

12X 1 2 3 4 5 6 7 8 9 10 1112 13 1415

1 2 3 4 5 6 7 8 9 10 1112 13 14 15


(B)

O

Fig. 4

5’

P

32

P

32

P

28

28 rU 30 rU

(D)

Nicked-12CP

Top1 KOH Top1cc

1X 2X

32 5’ P

KOH

28 nick

5’

KOH

32

P

nick 5’

KOH

32

(E)

1X 2X

1.8

30

1.2 0.6 0.0

1.8

Marker 30 28

P

Control KOH RNaseH2 28

1.2 0.6 0.0

Marker 12rUP

1 2 3 4 5 6 7 8

Control KOH RNaseH2 1X Top1 2X Top1


(C)

5’

32

Band Intensity (A.U.)

(B)

5’

Band Intensity (A.U.)

(A)

Fig. 5 Top1

Top1 5’

rU (a)

RN

ase

H2

1

(d)

Top

5’

(e) Top1

(b)

Top

1

5’

ase

RN

5’

H2

rU (g) religation

5’ (f) deletion

(c) 2’, 3’-cyclic phosphate

Top1cc Top1

O

Base O

O OH OH O P OBase O O

Top1

O

Base O

O OH O P OO Base

HO

O

O

(a)

O

Top1

Base

O

OH

O O O HO

P

O OO

Nicked DNA O (b)

O

Base O

O OH O P OBase Top1 Base O O religation O

(g)


5’

us eo n e ta on akag p S re B cc p1 o T

5’

DNA and Chromosomes: Topoisomerase I alone is sufficient to produce short DNA deletions and can also reverse nicks at ribonucleotide sites Shar-yin Naomi Huang, Sanchari Ghosh and Yves Pommier J. Biol. Chem. published online April 17, 2015

Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites. Alerts: • When this article is cited • When a correction for this article is posted Click here to choose from all of JBC's e-mail alerts This article cites 0 references, 0 of which can be accessed free at http://www.jbc.org/content/early/2015/04/17/jbc.M115.653345.full.html#ref-list-1


Access the most updated version of this article at doi: 10.1074/jbc.M115.653345

Mapping topoisomerase sites in mitochondrial DNA with a poisonous mitochondrial topoisomerase I (Top1mt).

The conformation of constitutive DNA interaction sites for eukaryotic DNA topoisomerase I on intrinsically curved DNAs.

Eukaryotic topoisomerase I-DNA interaction is stabilized by helix curvature.

Mutations of human DNA topoisomerase I at poly(ADP-ribose) binding sites: modulation of camptothecin activity by ADP-ribose polymers.

Arabidopsis DNA topoisomerase I alpha is required for adaptive response to light and flower development.

Dynamic Effects of Topoisomerase I Inhibition on R-Loops and Short Transcripts at Active Promoters.

Monoclonal antibodies to human DNA topoisomerase I and the two isoforms of DNA topoisomerase II: 170- and 180-kDa isozymes.

Histone H1 inhibits eukaryotic DNA topoisomerase I.

Doxorubicin inhibits human DNA topoisomerase I.

Mitochondrial DNA topoisomerase I from human platelets.

protein complexes applied to DNA topoisomerase II cleavage sites.

Analysis of CpG methylation and genomic footprinting at the tyrosine aminotransferase gene: DNA methylation alone is not sufficient to prevent protein binding in vivo.

Purification and properties of DNA topoisomerase I from broccoli.

Autonomous parvovirus DNA replication requires topoisomerase I and its activity is increased during infection.

Reverse Transcription Errors and RNA-DNA Differences at Short Tandem Repeats.

Archaebacterial reverse gyrase cleavage-site specificity is similar to that of eubacterial DNA topoisomerases I.

Dinucleotide repeat polymorphism at the topoisomerase (DNA) I pseudogene 2 (TOPIP2).

Molecular cloning of a cDNA of a camptothecin-resistant human DNA topoisomerase I and identification of mutation sites.

Transflip mutations produce deletions in pancreatic cancer.

Knowledge of response location alone is not sufficient to generate social inhibition of return.

Presence of human chromosome 21 alone is sufficient for hybrid cell sensitivity to human interferon.

The 165-kDa DNA topoisomerase I from Xenopus laevis oocytes is a tissue-specific variant.

A DNA topoisomerase type I from wheat embryo mitochondria.

Distamycin inhibition of topoisomerase I-DNA interaction: a mechanistic analysis.