Human Pathology (2014) xx, xxx–xxx
www.elsevier.com/locate/humpath
Original contribution
TNFAIP8 overexpression is associated with platinum resistance in epithelial ovarian cancers with optimal cytoreduction☆,☆☆ Tianbo Liu MD, PhD a , Bairong Xia MD a , Yanhong Lu MD b , Ye Xu MD, PhD a , Ge Lou MD, PhD a,⁎ a
Department of Gynecology, The Third Affiliated Hospital, Harbin Medical University, Harbin 150040, China Department of Pathology, Heilongjiang Province Hospital, Harbin 150001, China
b
Received 20 November 2013; revised 22 January 2014; accepted 7 February 2014
Keywords: Tumor necrosis factor α–induced protein 8; Epithelial ovarian cancer; Platinum resistance; Optimal cytoreduction
Summary Here, we correlated tumor necrosis factor α–induced protein 8 (TNFAIP8) messenger RNA (mRNA) expression with clinicopathological parameters and investigated the involvement of TNFAIP8 overexpression in platinum resistance of epithelial ovarian cancer (EOC). The status of TNFAIP8 protein was evaluated by Western blot analysis (n = 25) and immunohistochemistry (n = 134). TNFAIP8 mRNA expression was assessed with real-time polymerase chain reaction in fresh frozen EOC tissues (n = 40). TNFAIP8 overexpression at both mRNA and protein levels in platinum-resistant disease was clearly higher than that in platinum-sensitive disease (P b .05). Platinum resistance was independently correlated with residual tumor size (P = .025), ascites (P = .027), and TNFAIP8 overexpression (P = .003). In particular, TNFAIP8 overexpression was correlated with platinum resistance in EOCs with optimal cytoreduction (P = .001). TNFAIP8 mRNA expression was strongly associated with residual tumor size (P = .019). In conclusion, our findings indicate that TNFAIP8 overexpression is an independent predictor of platinum resistance and may be a potential biomarker for targeted therapy. © 2014 Elsevier Inc. All rights reserved.
1. Introduction Tumor necrosis factor α–induced protein 8 (TNFAIP8), also known as SCC-S2, GG2-1, and MDC-3.13, is a 21 kDa (KiloDalton) cytosolic protein that can be induced by tumor necrosis factor α (TNF-α) and transcription factor nuclear factor–κB activation. TNFAIP8 has been shown to function ☆
Competing interests: All authors have no conflict of interests to disclose. Funding/Support: Supported by grant Heilongjiang Special Funds for Outstanding Youth (No. JC201108) from Heilongjiang Province, China. ⁎ Corresponding author. E-mail address: [email protected] (G. Lou). ☆☆
http://dx.doi.org/10.1016/j.humpath.2014.02.005 0046-8177/© 2014 Elsevier Inc. All rights reserved.
as an oncogenic and antiapoptotic molecule [1-5] by enhancing cell survival and inhibiting apoptotic protein caspase 3 and caspase 8 activities. Previous studies have demonstrated that TNFAIP8 overexpression exists in various tumors and is correlated with clinical significance [6-13]. The deletion of TNFAIP8 enhances the effectiveness of cisplatininduced apoptosis, especially in esophageal squamous cell carcinoma. TNFAIP8 is also reportedly overexpressed in patients with chemotherapy-resistant acute myeloid leukemia [14]. These findings suggest that TNFAIP8 may play a pivotal role in tumorous chemotherapy resistance. The current most frequently used standard therapy for treating epithelial ovarian cancer (EOC) is maximal
2 cytoreduction followed by standard platinum–based combination chemotherapy. Although this therapy may result in complete remission in 70% of patients [15], the treatment efficacy for EOC is frequently limited by the rapid emergence of resistance to chemotherapeutic drugs [16]. Patients who have a chemotherapy-resistant disease have poor prognosis [17], with a 5-year survival rate of only 30% [18]. This case is common even in patients with early disease [19]. Several studies have investigated biomarkers that can distinguish EOC patients through their response to platinum-based chemotherapy. However, the molecular basis for platinum resistance is largely undefined. Thus, the identification of specific genes strictly involved in individual tumor cell biology can aid the development of new strategies or prevent resistance from appearance. In the published article, we have mentioned that TNFAIP8 overexpression is associated with platinum resistance [13]. Many factors affect platinum resistance; however, the role of TNFAIP8 overexpression in this regard remains unclear. Accordingly, this study aimed to investigate the potential role of TNFAIP8 in platinum-resistant EOCs at both protein and messenger RNA (mRNA) levels.
2. Materials and methods 2.1. Patient selection, treatment, and follow-up The approval of the ethics committee of our medical research institute was initially obtained, and all the participants have provided their written informed consent to participate in this study. Then, paraffin-embedded tissue samples were collected from 134 patients with EOC diagnosed between January 2009 and October 2010 in The Affiliated Tumor Hospital of Harbin Medical University, China. All samples were obtained from naive patients who were initially treated, instead of patients with recurrence. All patients were treated with maximal cytoreduction followed by platinum-based combination chemotherapy. None of the patients received any prior treatment for cancer nor presented concurrently serious complications or other malignant diseases. Moreover, no patient died in the perioperative or postoperative period (within 45 days after surgery). Tumor stage was determined according to the Federation of Gynecology and Obstetrics (FIGO) staging systems. Histologic typing was classified based on the World Health Organization classification standards [20]. Grading of tumors were conducted based on FIGO staging system [21]. Optimal cytoreduction was defined based on the Gynecologic Oncology Group as the largest residual tumor nodule measuring less than or equal to 1 cm determined by the operating surgeon [22]. Principles of chemotherapy instruct us to abide by the National Comprehensive Cancer Network guidelines published in 2009 [23]. Patients intravenously received 6 to 8 cycles of platinum-based combination chemotherapy (at a 3-week
T. Liu et al. interval) 2 to 3 weeks after primary surgery. Intraperitoneal chemotherapy was administered to patients with tumor size less than 1 cm in optimally debulked stage II and stage III patients. The chemotherapy regimen consisted of either cisplatin/ carboplatin plus paclitaxel or carboplatin plus docetaxel. Platinum resistance was defined according to Gynecologic Oncology Group criteria [24]. Platinum-resistant disease was defined as a progression or recurrence after a platinum-free interval of less than 6 months. Platinumsensitive disease was defined as no evidence of progression or recurrence after a platinum-free interval greater than or equal to 6 months. Patients were followed up for less than 6 months from the date of last primary platinum treatment were excluded from the analyses regarding platinum status. During the follow-up period, several examinations were performed regularly, that is, every 3 months for 2 years and 6-month intervals for the next 3 years. These examinations were pelvic magnetic resonance imaging, a color Doppler ultrasound of the liver and kidney, x-rays, and serum levels of CA-125 (cancer antigen 125). Recurrence was diagnosed by increased CA-125 as well as radiographic and/or clinical relapse with pathologic biopsy but not exclusively by an increase in CA-125 (ie, without radiographic evidence of diseases).
2.2. Western blot analysis Twenty frozen tissue samples of EOCs and 5 frozen tissue sections of normal ovaries were homogenized in RIPA (Radioimmunoprecipitation assay) buffer consisting of 1% protease inhibitor mixture. The mixture was centrifuged at 12 000g for 15 minutes at 4°C, and the supernatant was collected. Protein concentrations were quantified by the Bradford method (Thermo Scientific, Waltham, MA) and then 30 μg of protein extract was separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto Polyvinylidene fluoride film (Millipore, Billerica, MA, USA). Primary antibodies, anti-TNFAIP8 (1:500, ab64988; Abcam, Cambridge, MA, USA), and antiβ–actin (sc-130301; Santa Cruz Biotechnology, Santa Cruz, CA) were diluted in buffer and incubated at 4°C overnight. After standard washing, the film was incubated with horseradish peroxidase–labeled secondary antibody for 1 hour at room temperature and washed again. The blots were stained with a SuperSignal kit (Pierce, Rockford, IL) and imaged by a charge-coupled camera LAS4000 (Fujifilm, Tokyo, Japan). The experiment was performed in triplicate.
2.3. Immunohistochemical staining and evaluation Immunohistochemistry staining was performed with Two-Step IHC Detection Reagent (PV-6001) kit (Zhong Shan Golden Bridge Biological Technology, Beijing, China) on formalin-fixed, paraffin-embedded 4-μm-thick tissue sections. To increase specificity and sensitivity, samples were treated with 10 mmol/L citrate buffer (pH 6.0) in a
TNFAIP8 a platinum-resistant marker pressure cooker for 3 minutes. Then, the slides were immersed in 3% hydrogen peroxide for 10 minutes to block endogenous peroxidase. The rabbit polyclonal antibody against TNFAIP8 (1:100, ab64988; Abcam) was added to the sections for overnight at 4°C, followed by incubation with rabbit secondary antibody (Zhong Shan Golden Bridge Biological Technology) for 20 minutes at room temperature. The complexes of antigen-antibody were detected with 3,3′diaminobenzidine tetrahydrochloride (Dako, Glostrup, Denmark), and the slides were lightly counterstained with hematoxylin and then examined by light microscopy. The positive controls were non–small cell lung cancer with positive TNFAIP8 expression. The negative control slides were stained with rabbit serum instead of primary antibodies. TNFAIP8 staining was predominately localized in the cytoplasm, as in many other cancer tissues [6-11]. The levels of TNFAIP8 expression were scored by combining the percentage and intensity of positively stained tumor cells in a series of 10 randomly selected high-power fields. The percentage was classified as follows: 0 (0%), 1 (0%-10%), 2 (11%-50%), 3 (51%-70%), and 4 (≥71%). The intensity was also scored: 0 (negative staining), 1 (weak staining), 2 (moderate staining), and 3 (intense staining). The final scores of TNFAIP8 expression, ranging from 0 to 7, was the sum of the percentage of positive cells and the intensity score. Patients with a final score less than 4 were classified as the low expression group and vice versa. This procedure was carried out by 2 independent pathologists who were blinded to the clinicopathological data of the patients. Cases with any disagreement were rereviewed simultaneously by the original 2 pathologists and a senior pathologist until a consensus was reached.
3
2.5. Data analysis Student t test was used to compare continuous variables. The χ2 test or Fisher exact test was performed to assess differences in clinicopathological variables. The association between TNFAIP8 overexpression and chemotherapy resistance was estimated by univariate and multivariate logistic regression with covariate adjustment. For continuous variables, the cutoff point chosen was their median value. All analyses were performed using statistical software SPSS 13.0 (SPSS, Chicago, IL), and the findings were considered statistically significant at P b .05.
3. Results 3.1. TNFAIP8 protein overexpression in platinumresistant EOC tissues Western blot analysis was performed to evaluate the different levels of TNFAIP8 protein in EOC tissues with platinum-sensitive and platinum-resistant disease compared with those in normal tissues. An almost negative expression was found in normal tissues. Furthermore, low TNFAIP8 expression was detected in tissues from patients with platinum-sensitive disease, whereas high expression was found in those with platinum-resistant
2.4. RNA extraction and quantitative real-time reverse transcription–polymerase chain reaction Total RNA were isolated from EOC tissues (n = 40) using RNAsimple Total RNA Kit (DP419; Tiangen, Beijing China) according to the manufacturer’s protocol. We quantified the RNA concentration using a NanoDrop 2000 spectrophotometer (Thermo Scientific) and performed complementary DNA synthesis with 2× Power Taq PCR MasterMix kit (PR1702; BioTeke, Beijing China). We then performed real-time quantitative reverse transcription–polymerase chain reaction (RT-PCR) with the Exicycler 96 real-time RT-PCR system (Bioneer, Daejeon Korea) and SYBR Green mastermix (SY1020; Solarbio, Beijing China). The primers to TNFAIP8 were designed as follows: forward, 5′-TGAAGATGGAGCACTGCTGA-3′; reverse, 5′-GGTCTGTTACCCGTTAGGAAG-3′. β-actin was applied as the internal reference; its primers were as follows: forward, 5′-CTTAGTTGCGTTACACCCTTTCTTG-3′; reverse, 5′CTGTCACCTTCACCGTTCCAGTTT3′. Experiments were performed in triplicate in the same reaction. The results of the real-time quantitative RT-PCR experiments were calculated using the 2−ΔΔC(t) method with minor revision [25].
Fig. 1 A, Protein samples obtained from frozen normal ovaries (N), EOC tissues with platinum-sensitive (T1), and platinumresistant (T2) disease were analyzed by Western blot analysis. The levels of β-actin were used as an internal control. B, Histogram of pooled data from N (n = 5), EOC tissues with T1 disease (n = 10), and EOCs with T2 disease (n = 10). TNFAIP8 expression was elevated in EOCs compared with N (P b .05), and the highest TNFAIP8 expression was found in EOCs with T2 compared with EOC patients having T1 disease (P b .05).
4
T. Liu et al.
Fig. 2 Representative examples of TNFAIP8 immunohistochemical staining showing high and low expression. A, Negative control in EOC. B, Positive control in lung cancer. C and D, Low expression in EOCs with platinum-sensitive disease. E and F, High expression in EOCs with platinum-resistant disease. (×400 original magnification).
disease (Fig. 1A). Fig. 1B shows that TNFAIP8 expression progressively elevated from normal ovaries to platinumresistant tissues. Significant differences were observed among the 3 groups (P b .05). TNFAIP8 expression was mainly located in the cytoplasm of tumor cells, and representative images of its immunostaining are shown in Fig. 2. Weak or moderate staining of TNFAIP8 was frequently observed in specimens from patients with platinum-sensitive disease (Fig. 2C and D), whereas strong staining was observed in specimens from patients with platinum-resistant disease (Fig. 2E and F).
3.2. Association between TNFAIP8 overexpression and platinum resistance in EOCs At 6 months from the completion of chemotherapy, 41 patients (30.6%) exhibited platinum resistance. The characteristics of clinicopathological factors affecting platinum resistance are listed in Table 1. The presence of platinum resistance was positively correlated with advanced FIGO stage (P = .002), large residual tumor size (P = .010), ascites more than 100 mL (P = .027), and TNFAIP8 overexpression (P = .001). However, no statistically significant difference existed between platinum resistance and variables such as age, histologic grade, histologic type, and serum CA-125 level (P N .05). We performed multivariate logistic regression analysis to further assess the independent role of TNFAIP8 overexpression in platinum resistance. Residual tumor size (odds ratio [OR]: 3.024; 95% confidence interval [CI]: 1.150-7.953; P = .025), ascites (OR: 3.951; 95% CI: 1.17313.315; P = .027), and TNFAIP8 overexpression (OR: 4.147; 95% CI: 1.608-10.691; P = .003) were independently related with platinum resistance (Table 2).
The association between TNFAIP8 overexpression and platinum resistance in patients who had undergone Table 1 The association between platinum resistance and clinicopathological characteristics in patients with EOC Variables
Age (y) ≤54 N54 FIGO stage II III IV Histologic grade G1/G2 G3 Histologic type Serous Mucinous Endometrioid Clear cell Residual tumor size ≤1 cm N1 cm Ascites ≤100 mL N100 mL Serum CA-125 level ≤35 U/mL N35 U/mL TNFAIP8 expression Low High
Total Platinum resistance P n = 134 Present (%) Absent (%) .498 66 68
22 (33.3) 19 (27.9)
44 (66.7) 49 (72.1)
17 113 4
0 (0.0) 39 (34.5) 2 (50.0)
17 (100.0) 74 (65.5) 2 (50.0)
54 80
12 (22.2) 29 (36.2)
42 (77.8) 51 (63.8)
92 19 16 7
24 7 6 4
68 12 10 3
.002
.084
.249 (26.1) (36.8) (37.5) (57.1)
(73.9) (63.2) (62.5) (42.9) .010
109 25
28 (25.7) 13 (52.0)
81 (74.3) 12 (48.0)
29 105
4 (13.8) 37 (35.2)
25 (86.2) 68 (64.8)
31 103
9 (30.0) 32 (30.8)
22 (70.0) 71 (69.2)
51 83
7 (13.7) 34 (41.0)
44 (86.3) 49 (59.0)
.027
.829
.001
TNFAIP8 a platinum-resistant marker
5
0.331-1.675
mRNA expression was significantly associated with large residual tumor size (P = .019) and platinum resistance (P = .025). TNFAIP8 mRNA expression was not associated with age, FIGO stage, histologic grade, histologic type, ascites, or serum CA-125 level (P N .05).
1.150-7.953
4. Discussion
Table 2 Multivariate analysis of the association between TNFAIP8 expression and platinum resistance Variable
B
SE
P
OR
≤54 N54 −0.294 0.413 .476 0.745 Residual ≤1 tumor size cm Ascites N1 1.106 0.493 .025 3.024 cm ≤100 mL TNFAIP8 N100 1.374 0.620 .027 3.951 expression mL Low High 1.422 0.483 .003 4.147
95%CI
Age (y)
In this study, we assessed the status of TNFAIP8 expression at both mRNA and protein levels as well as the effect of TNFAIP8 expression on platinum resistance. Interestingly, we found that TNFAIP8 overexpression was related to platinum resistance, particularly in EOCs with optimal cytoreduction. Clinicopathological analysis revealed that tumors with high TNFAIP8 mRNA expression were associated with large residual tumor size and platinum resistance. TNFAIP8 was initially identified by comparing the expression profile of a primary human head and neck squamous cell carcinoma cell line with its matched metastatic cell line [26]. Studies have reported that TNFAIP8 plays an important role in oncogenesis, invasion, metastasis, and platinum-induced apoptosis. In MDA-MB 435 (M.D. Anderson - Metastatic Breast 435) human breast cancer cells, TNFAIP8 transfectants showed increased proliferation, cell migration, tumor growth rate [4], experimental metastasis, and elevated frequency of pulmonary colonization of tumor cells in athymic mice [5]. Our study revealed that high TNFAIP8 mRNA expression was correlated with large residual tumor size, and this correlation may play a role in disease progression. The molecular mechanisms underlying the apoptotic regulation of TNFAIP8 remain unclear. TNFAIP8 contains a death effector domain that can inhibit TNF-α–induced caspase activation and apoptosis [1,5]. A recent study has shown that TNFAIP8 is a novel Gaiinteracting protein able to interact with Ga to reduce cell death independent of caspase [27]. However, the identified chicken ovalbumin upstream promoter transcription factor I, a repressor of TNFAIP8 transcription in TNF-α–induced signaling pathways [28], may bring a new expectation for molecular targeted therapy. Thus, TNFAIP8 may be an effective variable for the individualization of both clinical outcome and therapy in EOC. Chemotherapy resistance is one of the most important prognostic factors in EOCs [29]. Approximately 30% of patients show platinum resistance and aggressive disease
1.173-13.315
1.608-10.691
Abbreviations: OR, odds ratio; CI, confidence interval.
optimal and suboptimal cytoreduction was also analyzed (Table 3). Interestingly, the high TNFAIP8 expression group but not the low TNFAIP8 expression group had a significantly higher risk of platinum resistance in patients with optimal cytoreduction (P = .001). No significant difference was found between TNFAIP8 overexpression and platinum resistance in patients with suboptimal cytoreduction (P N .05).
3.3. TNFAIP8 mRNA expression and clinicopathological characteristics The mean expression value of TNFAIP8 mRNA in tumor tissues with platinum-resistant disease, 7.61 ± 3.17 (mean ± standard deviation, normalized by β-actin gene expression), was statistically higher than the value in tumor tissues with platinum-sensitive disease (4.79 ± 2.27 [mean ± standard deviation, normalized by β-actin gene expression]) (P = .002, Fig. 3). The median expression value of TNFAIP8 mRNA was 5.22 (range: 2.24-14.78). Based on this cutoff point, we categorized TNFAIP8 mRNA expression into low and high groups. Clinicopathological variables related to TNFAIP8 mRNA expression are shown in Table 4. High TNFAIP8
Table 3 Correlation of TNFAIP8 expression with platinum resistance in patients with optimal cytoreduction and suboptimal cytoreduction TNFAIP8 expression
Optimal cytoreduction Platinum resistance
Low High
Suboptimal cytoreduction P
Present
Absent
4 24
42 39
.001
Platinum resistance
P
Present
Absent
3 10
2 10
1.000
6
T. Liu et al.
Fig. 3 Histogram of TNFAIP8 mRNA expression in EOC based on platinum resistance (S, platinum-sensitive tumors; R, platinumresistant tumors).
progression [30]. However, intrinsic or acquired chemotherapy resistance remains a dominating clinical challenge and a pivotal factor affecting the survival outcome of these patients [31]. Previously, immunohistochemical study showed that TNFAIP8 correlated with platinum resistance by χ2 test [13]. In the present work, Western blot analysis of ovarian tissues revealed that TNFAIP8 protein expression gradually increased from normal tissues to platinum-sensitive tumors to platinum-resistant tumors. Furthermore, the association between TNFAIP8 and platinum resistance is indicated at both Table 4 Clinicopathological variables and TNFAIP8 mRNA expression in 40 EOCs Variables
Age (y) ≤54 N54 FIGO stage II III IV Histologic grade G1/G2 G3 Histologic type Serous Mucinous Endometrioid Residual tumor size ≤1 cm N1 cm Ascites ≤100 mL N100 mL Serum CA-125 level ≤35 U/mL N35 U/mL Platinum resistance Present Absent
Total TNFAIP8 mRNA n = 40 expression Low (%)
High (%)
21 19
12 (57.1) 8 (42.1)
9 (42.9) 11 (57.9)
6 31 3
5 (33.33) 1 (66.67) 14 (52.78) 17 (47.22) 1 (0.00) 2 (100.00)
18 22
11 (61.1) 9 (40.9)
28 5 7
15 (53.57) 13 (46.43) 3 (60.00) 2 (40.00) 2 (28.57) 5 (71.43)
26 14
17 (65.4) 3 (21.4)
9 (34.6) 11 (78.6)
7 33
4 (57.1) 16 (48.5)
3 (42.9) 17 (51.5)
3 37
1 (33.3) 19 (51.4)
2 (66.7) 18 (48.6)
18 22
5 (27.8) 15 (68.2)
13 (72.2) 7 (31.8)
P
.527
.292
.341 7 (38.9) 13 (59.1) .606
.019
1.000
1.000
.025
protein and mRNA levels. We also found that FIGO stage, residual tumor size, and ascites were significantly correlated with platinum resistance. Multivariate logistic regression analysis showed that TNFAIP8 expression was an independent predictor of platinum resistance, implying that TNFAIP8 overexpression plays a crucial role in chemotherapy resistance. In accordance with our results, previous studies on esophageal squamous cell carcinoma have reported that platinum-induced apoptosis is greater in the TNFAIP8 siRNA (Small interfering RNA) group than in its counterpart [11]. We also demonstrated that ascites and residual tumor size were both independent factors affecting platinum resistance. Malignant ascites include numerous survival factors [32] that can potentially promote rapid tumor cell growth and enhance resistance to cytotoxic agents. Therefore, malignant ascites, the microenvironment of tumor cells, is a potential factor affecting the elimination of tumor cells in vivo. Lane et al [33] found that the tumor microenvironment may contribute to the resistance of ovarian cancer cells to death receptor– induced apoptosis. TNFAIP8 is known as a member of the Fas-associated death domain–like interleukin-1β–converting enzyme–inhibitory protein family of cell death inhibitory proteins [1]. However, the presence of cross-interaction between TNFAIP8 gene and ascites still needs elucidation. Our data agreed with previous ones indicating that enormous residual tumor may lead to a high chance of chemotherapy resistance [34]. However, numerous patients treated with maximal cytoreduction have disease progression upon initial chemotherapy, which can be attributed to biological aggressiveness [35]. We separately evaluated the association between TNFAIP8 expression and platinum resistance in 2 groups divided by the extent of cytoreduction to eliminate the effect of residual tumor size. Our evaluation indicated that patients with TNFAIP8 overexpression had a higher risk of platinum resistance in the optimal cytoreduction group but not in the suboptimal cytoreduction group. In conclusion, this study indicated that TNFAIP8 overexpression can be used alone or in combination with other markers to identify EOC patients who are more susceptible to platinum resistance. Taken together, these observations may influence clinical management, that is, patients with TNFAIP8 overexpression may be more frequently monitored
TNFAIP8 a platinum-resistant marker to detect resistance early enough and help them benefit from second-line chemotherapy or molecular targeted therapy. Thus, the immunohistochemical analysis of TNFAIP8 may have clear clinical implications.
Acknowledgments The authors thank all the people who participated in this study.
References [1] Kumar D, Whiteside TL, Kasid U. Identification of a novel tumor necrosis factor-alpha-inducible gene, SCC-S2, containing the consensus sequence of a death effector domain of fas-associated death domain-like interleukin-1beta-converting enzyme-inhibitory protein. J Biol Chem 2000;275:2973-8. [2] Horrevoets AJ, Fontijn RD, van Zonneveld AJ, de Vries CJ, ten Cate JW, Pannekoek H. Vascular endothelial genes that are responsive to tumor necrosis factor-alpha in vitro are expressed in atherosclerotic lesions, including inhibitor of apoptosis protein-1, stannin, and two novel genes. Blood 1999;93:3418-31. [3] You Z, Ouyang H, Lopatin D, Polver PJ, Wang CY. Nuclear factorkappa B-inducible death effector domain-containing protein suppresses tumor necrosis factor-mediated apoptosis by inhibiting caspase-8 activity. J Biol Chem 2001;276:26398-404. [4] Kumar D, Gokhale P, Broustas C, Chakravarty D, Ahmad I, Kasid U. Expression of SCC-S2, an antiapoptotic molecule, correlates with enhanced proliferation and tumorigenicity of MDA-MB 435 cells. Oncogene 2004;23:612-6. [5] Zhang C, Chakravarty D, Sakabe I, et al. Role of SCC-S2 in experimental metastasis and modulation of VEGFR-2, MMP-1, and MMP-9 expression. Mol Ther 2006;13:947-55. [6] Liu K, Qin CK, Wang ZY, Liu SX, Cui XP, Zhang DY. Expression of tumor necrosis factor-alpha-induced protein 8 in pancreas tissues and its correlation with epithelial growth factor receptor levels. Asian Pac J Cancer Prev 2012;13:847-50. [7] Miao Z, Zhao T, Wang Z. SCC-S2 is overexpressed in colon cancers and regulates cell proliferation. Tumour Biol 2012;33:2099-106. [8] Zhang C, Kallakury BV, Ross JS, et al. The significance of TNFAIP8 in prostate cancer response to radiation and docetaxel and disease recurrence. Int J Cancer 2012;133:31-42. [9] Shi TY, Cheng X, Yu KD, et al. Functional variants in TNFAIP8 associated with cervical cancer susceptibility and clinical outcomes. Carcinogenesis 2013;34:770-8. [10] Dong QZ, Zhao Y, Liu Y, et al. Overexpression of SCC-S2 correlates with lymph node metastasis and poor prognosis in patients with nonsmall-cell lung cancer. Cancer Sci 2010;101:1562-9. [11] Hadisaputri YE, Miyazaki T, Suzuki S, et al. TNFAIP8 overexpression: clinical relevance to esophageal squamous cell carcinoma. Ann Surg Oncol 2012;19:S589-96. [12] Zhang Y, Wang MY, He J, et al. Tumor necrosis factor-α induced protein 8 polymorphism and risk of non-Hodgkin’s lymphoma in a Chinese population: a case-control study. PLoS One 2012;7:e37846. [13] Liu T, Gao H, Chen X, et al. TNFAIP8 as a predictor of metastasis and a novel prognostic biomarker in patients with epithelial ovarian cancer. Br J Cancer 2013;109:1685-92. [14] Wang MC, Liu SX, Liu PB. Gene expression profile of multiple myeloma cell line treated by realgar. J Exp Clin Cancer Res 2006;25:243-9. [15] Ozols RF. Treatment goals in ovarian cancer. Int J Gynecol Cancer 2005;15:3-11.
7 [16] Partridge EE, Barnes MN. Epithelial ovarian cancer: prevention, diagnosis, and treatment. CA Cancer J Clin 1999;49:297-320. [17] Guarneri V, Piacentini F, Barbieri E, Conte PF. Achievements and unmet needs in the management of advanced ovarian cancer. Gynecol Oncol 2010;117:152-8. [18] Agarwal R, Kaye SB. Ovarian cancer: strategies for overcoming resistance to chemotherapy. Nat Rev Cancer 2003;3:502-16. [19] Kobayashi H, Yamada Y, Kanayama S, et al. The role of hepatocyte nuclear factor-1beta in the pathogenesis of clear cell carcinoma of the ovary. Int J Gynecol Cancer 2009;19:471-9. [20] Tavassoeli FA, Devilee P. WHO Classification of tumours, pathology and genetics: tumours of the breast and female genital organs. Lyon: IARC; 2003. [21] Benedet JL, Bender H, Jones 3rd H, Ngan HY, Pecorelli S. FIGO staging classifications and clinical practice guidelines in the management of gynecologic cancers. FIGO Committee on Gynecologic Oncology. Int J Gynaecol Obstet 2000;70:209-62. [22] Ozols RF, Bundy BN, Greer BE, et al. Phase III trial of carboplatin and paclitaxel compared with cisplatin and paclitaxel in patients with optimally resected stage III ovarian cancer: a Gynecologic Oncology Group study. J Clin Oncol 2003;21:3194-200. [23] Morgan RJ, Alvarez RD, Armstrong DK, et al. Ovarian cancer including fallopian tube cancer and primary peritoneal cancer. NCCN clinical practice guidelines in oncology. 2009. [24] Markman M, Bookman MA. Second-line treatment of ovarian cancer. Oncologist 2000;5:26-35. [25] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−delta delta C(T)) method. Methods 2001;25:402-8. [26] Patel S, Wang FH, Whiteside TL, Kasid U. Identification of seven differentially displayed transcripts in human primary and matched metastatic head and neck squamous cell carcinoma cell lines: implications in metastasis and/or radiation response. Oral Oncol 1997;33:197-203. [27] Laliberté B, Wilson AM, Nafisi H, et al. TNFAIP8: a new effector for Galpha(i) coupling to reduce cell death and induce cell transformation. J Cell Physiol 2010;225:865-74. [28] Zhang LJ, Liu X, Gafken PR, Kioussi C, Leid M. A chicken ovalbumin upstream promoter transcription factor I (COUP-TFI) complex represses expression of the gene encoding tumor necrosis factor alpha-induced protein 8 (TNFAIP8). J Biol Chem 2009;284:6156-68. [29] Holschneider CH, Berek JS. Ovarian cancer: epidemiology, biology, and prognostic factors. Semin Surg Oncol 2000;19:3-10. [30] Miller DS, Blessing JA, Krasner CN, et al. Phase II evaluation of pemetrexed in the treatment of recurrent or persistent platinumresistant ovarian or primary peritoneal carcinoma: a study of the Gynecologic Oncology Group. J Clin Oncol 2009;27:2686-91. [31] Bristow RE, Tomacruz RS, Armstrong DK, Trimble EL, Montz FJ. Survival effect of maximal cytoreductive surgery for advanced ovarian carcinoma during the platinum era: a meta-analysis. J Clin Oncol 2002;20:1248-59. [32] Ahmed N, Riley C, Oliva K, Rice G, Quinn M. Ascites induces modulation of alpha6beta1 integrin and urokinase plasminogen activator receptor expression and associated functions in ovarian carcinoma. Br J Cancer 2005;92:1475-85. [33] Lane D, Robert V, Grondin R, Rancourt C, Piché A. Malignant ascites protect against TRAIL-induced apoptosis by activating the PI3K/Akt pathway in human ovarian carcinoma cells. Int J Cancer 2007;121:1227-37. [34] Eisenhauer EL, Abu-Rustum NR, Sonoda Y, Aghajanian C, Barakat RR, Chi DS. The effect of maximal surgical cytoreduction on sensitivity to platinum-taxane chemotherapy and subsequent survival in patients with advanced ovarian cancer. Gynecol Oncol 2008;108:276-81. [35] Bristow RE, Eisenhauer EL, Santillan A, Chi DS. Delaying the primary surgical effort for advanced ovarian cancer: a systematic review of neoadjuvant chemotherapy and interval cytoreduction. Gynecol Oncol 2007;104:480-90.
www.elsevier.com/locate/humpath
Original contribution
TNFAIP8 overexpression is associated with platinum resistance in epithelial ovarian cancers with optimal cytoreduction☆,☆☆ Tianbo Liu MD, PhD a , Bairong Xia MD a , Yanhong Lu MD b , Ye Xu MD, PhD a , Ge Lou MD, PhD a,⁎ a
Department of Gynecology, The Third Affiliated Hospital, Harbin Medical University, Harbin 150040, China Department of Pathology, Heilongjiang Province Hospital, Harbin 150001, China
b
Received 20 November 2013; revised 22 January 2014; accepted 7 February 2014
Keywords: Tumor necrosis factor α–induced protein 8; Epithelial ovarian cancer; Platinum resistance; Optimal cytoreduction
Summary Here, we correlated tumor necrosis factor α–induced protein 8 (TNFAIP8) messenger RNA (mRNA) expression with clinicopathological parameters and investigated the involvement of TNFAIP8 overexpression in platinum resistance of epithelial ovarian cancer (EOC). The status of TNFAIP8 protein was evaluated by Western blot analysis (n = 25) and immunohistochemistry (n = 134). TNFAIP8 mRNA expression was assessed with real-time polymerase chain reaction in fresh frozen EOC tissues (n = 40). TNFAIP8 overexpression at both mRNA and protein levels in platinum-resistant disease was clearly higher than that in platinum-sensitive disease (P b .05). Platinum resistance was independently correlated with residual tumor size (P = .025), ascites (P = .027), and TNFAIP8 overexpression (P = .003). In particular, TNFAIP8 overexpression was correlated with platinum resistance in EOCs with optimal cytoreduction (P = .001). TNFAIP8 mRNA expression was strongly associated with residual tumor size (P = .019). In conclusion, our findings indicate that TNFAIP8 overexpression is an independent predictor of platinum resistance and may be a potential biomarker for targeted therapy. © 2014 Elsevier Inc. All rights reserved.
1. Introduction Tumor necrosis factor α–induced protein 8 (TNFAIP8), also known as SCC-S2, GG2-1, and MDC-3.13, is a 21 kDa (KiloDalton) cytosolic protein that can be induced by tumor necrosis factor α (TNF-α) and transcription factor nuclear factor–κB activation. TNFAIP8 has been shown to function ☆
Competing interests: All authors have no conflict of interests to disclose. Funding/Support: Supported by grant Heilongjiang Special Funds for Outstanding Youth (No. JC201108) from Heilongjiang Province, China. ⁎ Corresponding author. E-mail address: [email protected] (G. Lou). ☆☆
http://dx.doi.org/10.1016/j.humpath.2014.02.005 0046-8177/© 2014 Elsevier Inc. All rights reserved.
as an oncogenic and antiapoptotic molecule [1-5] by enhancing cell survival and inhibiting apoptotic protein caspase 3 and caspase 8 activities. Previous studies have demonstrated that TNFAIP8 overexpression exists in various tumors and is correlated with clinical significance [6-13]. The deletion of TNFAIP8 enhances the effectiveness of cisplatininduced apoptosis, especially in esophageal squamous cell carcinoma. TNFAIP8 is also reportedly overexpressed in patients with chemotherapy-resistant acute myeloid leukemia [14]. These findings suggest that TNFAIP8 may play a pivotal role in tumorous chemotherapy resistance. The current most frequently used standard therapy for treating epithelial ovarian cancer (EOC) is maximal
2 cytoreduction followed by standard platinum–based combination chemotherapy. Although this therapy may result in complete remission in 70% of patients [15], the treatment efficacy for EOC is frequently limited by the rapid emergence of resistance to chemotherapeutic drugs [16]. Patients who have a chemotherapy-resistant disease have poor prognosis [17], with a 5-year survival rate of only 30% [18]. This case is common even in patients with early disease [19]. Several studies have investigated biomarkers that can distinguish EOC patients through their response to platinum-based chemotherapy. However, the molecular basis for platinum resistance is largely undefined. Thus, the identification of specific genes strictly involved in individual tumor cell biology can aid the development of new strategies or prevent resistance from appearance. In the published article, we have mentioned that TNFAIP8 overexpression is associated with platinum resistance [13]. Many factors affect platinum resistance; however, the role of TNFAIP8 overexpression in this regard remains unclear. Accordingly, this study aimed to investigate the potential role of TNFAIP8 in platinum-resistant EOCs at both protein and messenger RNA (mRNA) levels.
2. Materials and methods 2.1. Patient selection, treatment, and follow-up The approval of the ethics committee of our medical research institute was initially obtained, and all the participants have provided their written informed consent to participate in this study. Then, paraffin-embedded tissue samples were collected from 134 patients with EOC diagnosed between January 2009 and October 2010 in The Affiliated Tumor Hospital of Harbin Medical University, China. All samples were obtained from naive patients who were initially treated, instead of patients with recurrence. All patients were treated with maximal cytoreduction followed by platinum-based combination chemotherapy. None of the patients received any prior treatment for cancer nor presented concurrently serious complications or other malignant diseases. Moreover, no patient died in the perioperative or postoperative period (within 45 days after surgery). Tumor stage was determined according to the Federation of Gynecology and Obstetrics (FIGO) staging systems. Histologic typing was classified based on the World Health Organization classification standards [20]. Grading of tumors were conducted based on FIGO staging system [21]. Optimal cytoreduction was defined based on the Gynecologic Oncology Group as the largest residual tumor nodule measuring less than or equal to 1 cm determined by the operating surgeon [22]. Principles of chemotherapy instruct us to abide by the National Comprehensive Cancer Network guidelines published in 2009 [23]. Patients intravenously received 6 to 8 cycles of platinum-based combination chemotherapy (at a 3-week
T. Liu et al. interval) 2 to 3 weeks after primary surgery. Intraperitoneal chemotherapy was administered to patients with tumor size less than 1 cm in optimally debulked stage II and stage III patients. The chemotherapy regimen consisted of either cisplatin/ carboplatin plus paclitaxel or carboplatin plus docetaxel. Platinum resistance was defined according to Gynecologic Oncology Group criteria [24]. Platinum-resistant disease was defined as a progression or recurrence after a platinum-free interval of less than 6 months. Platinumsensitive disease was defined as no evidence of progression or recurrence after a platinum-free interval greater than or equal to 6 months. Patients were followed up for less than 6 months from the date of last primary platinum treatment were excluded from the analyses regarding platinum status. During the follow-up period, several examinations were performed regularly, that is, every 3 months for 2 years and 6-month intervals for the next 3 years. These examinations were pelvic magnetic resonance imaging, a color Doppler ultrasound of the liver and kidney, x-rays, and serum levels of CA-125 (cancer antigen 125). Recurrence was diagnosed by increased CA-125 as well as radiographic and/or clinical relapse with pathologic biopsy but not exclusively by an increase in CA-125 (ie, without radiographic evidence of diseases).
2.2. Western blot analysis Twenty frozen tissue samples of EOCs and 5 frozen tissue sections of normal ovaries were homogenized in RIPA (Radioimmunoprecipitation assay) buffer consisting of 1% protease inhibitor mixture. The mixture was centrifuged at 12 000g for 15 minutes at 4°C, and the supernatant was collected. Protein concentrations were quantified by the Bradford method (Thermo Scientific, Waltham, MA) and then 30 μg of protein extract was separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto Polyvinylidene fluoride film (Millipore, Billerica, MA, USA). Primary antibodies, anti-TNFAIP8 (1:500, ab64988; Abcam, Cambridge, MA, USA), and antiβ–actin (sc-130301; Santa Cruz Biotechnology, Santa Cruz, CA) were diluted in buffer and incubated at 4°C overnight. After standard washing, the film was incubated with horseradish peroxidase–labeled secondary antibody for 1 hour at room temperature and washed again. The blots were stained with a SuperSignal kit (Pierce, Rockford, IL) and imaged by a charge-coupled camera LAS4000 (Fujifilm, Tokyo, Japan). The experiment was performed in triplicate.
2.3. Immunohistochemical staining and evaluation Immunohistochemistry staining was performed with Two-Step IHC Detection Reagent (PV-6001) kit (Zhong Shan Golden Bridge Biological Technology, Beijing, China) on formalin-fixed, paraffin-embedded 4-μm-thick tissue sections. To increase specificity and sensitivity, samples were treated with 10 mmol/L citrate buffer (pH 6.0) in a
TNFAIP8 a platinum-resistant marker pressure cooker for 3 minutes. Then, the slides were immersed in 3% hydrogen peroxide for 10 minutes to block endogenous peroxidase. The rabbit polyclonal antibody against TNFAIP8 (1:100, ab64988; Abcam) was added to the sections for overnight at 4°C, followed by incubation with rabbit secondary antibody (Zhong Shan Golden Bridge Biological Technology) for 20 minutes at room temperature. The complexes of antigen-antibody were detected with 3,3′diaminobenzidine tetrahydrochloride (Dako, Glostrup, Denmark), and the slides were lightly counterstained with hematoxylin and then examined by light microscopy. The positive controls were non–small cell lung cancer with positive TNFAIP8 expression. The negative control slides were stained with rabbit serum instead of primary antibodies. TNFAIP8 staining was predominately localized in the cytoplasm, as in many other cancer tissues [6-11]. The levels of TNFAIP8 expression were scored by combining the percentage and intensity of positively stained tumor cells in a series of 10 randomly selected high-power fields. The percentage was classified as follows: 0 (0%), 1 (0%-10%), 2 (11%-50%), 3 (51%-70%), and 4 (≥71%). The intensity was also scored: 0 (negative staining), 1 (weak staining), 2 (moderate staining), and 3 (intense staining). The final scores of TNFAIP8 expression, ranging from 0 to 7, was the sum of the percentage of positive cells and the intensity score. Patients with a final score less than 4 were classified as the low expression group and vice versa. This procedure was carried out by 2 independent pathologists who were blinded to the clinicopathological data of the patients. Cases with any disagreement were rereviewed simultaneously by the original 2 pathologists and a senior pathologist until a consensus was reached.
3
2.5. Data analysis Student t test was used to compare continuous variables. The χ2 test or Fisher exact test was performed to assess differences in clinicopathological variables. The association between TNFAIP8 overexpression and chemotherapy resistance was estimated by univariate and multivariate logistic regression with covariate adjustment. For continuous variables, the cutoff point chosen was their median value. All analyses were performed using statistical software SPSS 13.0 (SPSS, Chicago, IL), and the findings were considered statistically significant at P b .05.
3. Results 3.1. TNFAIP8 protein overexpression in platinumresistant EOC tissues Western blot analysis was performed to evaluate the different levels of TNFAIP8 protein in EOC tissues with platinum-sensitive and platinum-resistant disease compared with those in normal tissues. An almost negative expression was found in normal tissues. Furthermore, low TNFAIP8 expression was detected in tissues from patients with platinum-sensitive disease, whereas high expression was found in those with platinum-resistant
2.4. RNA extraction and quantitative real-time reverse transcription–polymerase chain reaction Total RNA were isolated from EOC tissues (n = 40) using RNAsimple Total RNA Kit (DP419; Tiangen, Beijing China) according to the manufacturer’s protocol. We quantified the RNA concentration using a NanoDrop 2000 spectrophotometer (Thermo Scientific) and performed complementary DNA synthesis with 2× Power Taq PCR MasterMix kit (PR1702; BioTeke, Beijing China). We then performed real-time quantitative reverse transcription–polymerase chain reaction (RT-PCR) with the Exicycler 96 real-time RT-PCR system (Bioneer, Daejeon Korea) and SYBR Green mastermix (SY1020; Solarbio, Beijing China). The primers to TNFAIP8 were designed as follows: forward, 5′-TGAAGATGGAGCACTGCTGA-3′; reverse, 5′-GGTCTGTTACCCGTTAGGAAG-3′. β-actin was applied as the internal reference; its primers were as follows: forward, 5′-CTTAGTTGCGTTACACCCTTTCTTG-3′; reverse, 5′CTGTCACCTTCACCGTTCCAGTTT3′. Experiments were performed in triplicate in the same reaction. The results of the real-time quantitative RT-PCR experiments were calculated using the 2−ΔΔC(t) method with minor revision [25].
Fig. 1 A, Protein samples obtained from frozen normal ovaries (N), EOC tissues with platinum-sensitive (T1), and platinumresistant (T2) disease were analyzed by Western blot analysis. The levels of β-actin were used as an internal control. B, Histogram of pooled data from N (n = 5), EOC tissues with T1 disease (n = 10), and EOCs with T2 disease (n = 10). TNFAIP8 expression was elevated in EOCs compared with N (P b .05), and the highest TNFAIP8 expression was found in EOCs with T2 compared with EOC patients having T1 disease (P b .05).
4
T. Liu et al.
Fig. 2 Representative examples of TNFAIP8 immunohistochemical staining showing high and low expression. A, Negative control in EOC. B, Positive control in lung cancer. C and D, Low expression in EOCs with platinum-sensitive disease. E and F, High expression in EOCs with platinum-resistant disease. (×400 original magnification).
disease (Fig. 1A). Fig. 1B shows that TNFAIP8 expression progressively elevated from normal ovaries to platinumresistant tissues. Significant differences were observed among the 3 groups (P b .05). TNFAIP8 expression was mainly located in the cytoplasm of tumor cells, and representative images of its immunostaining are shown in Fig. 2. Weak or moderate staining of TNFAIP8 was frequently observed in specimens from patients with platinum-sensitive disease (Fig. 2C and D), whereas strong staining was observed in specimens from patients with platinum-resistant disease (Fig. 2E and F).
3.2. Association between TNFAIP8 overexpression and platinum resistance in EOCs At 6 months from the completion of chemotherapy, 41 patients (30.6%) exhibited platinum resistance. The characteristics of clinicopathological factors affecting platinum resistance are listed in Table 1. The presence of platinum resistance was positively correlated with advanced FIGO stage (P = .002), large residual tumor size (P = .010), ascites more than 100 mL (P = .027), and TNFAIP8 overexpression (P = .001). However, no statistically significant difference existed between platinum resistance and variables such as age, histologic grade, histologic type, and serum CA-125 level (P N .05). We performed multivariate logistic regression analysis to further assess the independent role of TNFAIP8 overexpression in platinum resistance. Residual tumor size (odds ratio [OR]: 3.024; 95% confidence interval [CI]: 1.150-7.953; P = .025), ascites (OR: 3.951; 95% CI: 1.17313.315; P = .027), and TNFAIP8 overexpression (OR: 4.147; 95% CI: 1.608-10.691; P = .003) were independently related with platinum resistance (Table 2).
The association between TNFAIP8 overexpression and platinum resistance in patients who had undergone Table 1 The association between platinum resistance and clinicopathological characteristics in patients with EOC Variables
Age (y) ≤54 N54 FIGO stage II III IV Histologic grade G1/G2 G3 Histologic type Serous Mucinous Endometrioid Clear cell Residual tumor size ≤1 cm N1 cm Ascites ≤100 mL N100 mL Serum CA-125 level ≤35 U/mL N35 U/mL TNFAIP8 expression Low High
Total Platinum resistance P n = 134 Present (%) Absent (%) .498 66 68
22 (33.3) 19 (27.9)
44 (66.7) 49 (72.1)
17 113 4
0 (0.0) 39 (34.5) 2 (50.0)
17 (100.0) 74 (65.5) 2 (50.0)
54 80
12 (22.2) 29 (36.2)
42 (77.8) 51 (63.8)
92 19 16 7
24 7 6 4
68 12 10 3
.002
.084
.249 (26.1) (36.8) (37.5) (57.1)
(73.9) (63.2) (62.5) (42.9) .010
109 25
28 (25.7) 13 (52.0)
81 (74.3) 12 (48.0)
29 105
4 (13.8) 37 (35.2)
25 (86.2) 68 (64.8)
31 103
9 (30.0) 32 (30.8)
22 (70.0) 71 (69.2)
51 83
7 (13.7) 34 (41.0)
44 (86.3) 49 (59.0)
.027
.829
.001
TNFAIP8 a platinum-resistant marker
5
0.331-1.675
mRNA expression was significantly associated with large residual tumor size (P = .019) and platinum resistance (P = .025). TNFAIP8 mRNA expression was not associated with age, FIGO stage, histologic grade, histologic type, ascites, or serum CA-125 level (P N .05).
1.150-7.953
4. Discussion
Table 2 Multivariate analysis of the association between TNFAIP8 expression and platinum resistance Variable
B
SE
P
OR
≤54 N54 −0.294 0.413 .476 0.745 Residual ≤1 tumor size cm Ascites N1 1.106 0.493 .025 3.024 cm ≤100 mL TNFAIP8 N100 1.374 0.620 .027 3.951 expression mL Low High 1.422 0.483 .003 4.147
95%CI
Age (y)
In this study, we assessed the status of TNFAIP8 expression at both mRNA and protein levels as well as the effect of TNFAIP8 expression on platinum resistance. Interestingly, we found that TNFAIP8 overexpression was related to platinum resistance, particularly in EOCs with optimal cytoreduction. Clinicopathological analysis revealed that tumors with high TNFAIP8 mRNA expression were associated with large residual tumor size and platinum resistance. TNFAIP8 was initially identified by comparing the expression profile of a primary human head and neck squamous cell carcinoma cell line with its matched metastatic cell line [26]. Studies have reported that TNFAIP8 plays an important role in oncogenesis, invasion, metastasis, and platinum-induced apoptosis. In MDA-MB 435 (M.D. Anderson - Metastatic Breast 435) human breast cancer cells, TNFAIP8 transfectants showed increased proliferation, cell migration, tumor growth rate [4], experimental metastasis, and elevated frequency of pulmonary colonization of tumor cells in athymic mice [5]. Our study revealed that high TNFAIP8 mRNA expression was correlated with large residual tumor size, and this correlation may play a role in disease progression. The molecular mechanisms underlying the apoptotic regulation of TNFAIP8 remain unclear. TNFAIP8 contains a death effector domain that can inhibit TNF-α–induced caspase activation and apoptosis [1,5]. A recent study has shown that TNFAIP8 is a novel Gaiinteracting protein able to interact with Ga to reduce cell death independent of caspase [27]. However, the identified chicken ovalbumin upstream promoter transcription factor I, a repressor of TNFAIP8 transcription in TNF-α–induced signaling pathways [28], may bring a new expectation for molecular targeted therapy. Thus, TNFAIP8 may be an effective variable for the individualization of both clinical outcome and therapy in EOC. Chemotherapy resistance is one of the most important prognostic factors in EOCs [29]. Approximately 30% of patients show platinum resistance and aggressive disease
1.173-13.315
1.608-10.691
Abbreviations: OR, odds ratio; CI, confidence interval.
optimal and suboptimal cytoreduction was also analyzed (Table 3). Interestingly, the high TNFAIP8 expression group but not the low TNFAIP8 expression group had a significantly higher risk of platinum resistance in patients with optimal cytoreduction (P = .001). No significant difference was found between TNFAIP8 overexpression and platinum resistance in patients with suboptimal cytoreduction (P N .05).
3.3. TNFAIP8 mRNA expression and clinicopathological characteristics The mean expression value of TNFAIP8 mRNA in tumor tissues with platinum-resistant disease, 7.61 ± 3.17 (mean ± standard deviation, normalized by β-actin gene expression), was statistically higher than the value in tumor tissues with platinum-sensitive disease (4.79 ± 2.27 [mean ± standard deviation, normalized by β-actin gene expression]) (P = .002, Fig. 3). The median expression value of TNFAIP8 mRNA was 5.22 (range: 2.24-14.78). Based on this cutoff point, we categorized TNFAIP8 mRNA expression into low and high groups. Clinicopathological variables related to TNFAIP8 mRNA expression are shown in Table 4. High TNFAIP8
Table 3 Correlation of TNFAIP8 expression with platinum resistance in patients with optimal cytoreduction and suboptimal cytoreduction TNFAIP8 expression
Optimal cytoreduction Platinum resistance
Low High
Suboptimal cytoreduction P
Present
Absent
4 24
42 39
.001
Platinum resistance
P
Present
Absent
3 10
2 10
1.000
6
T. Liu et al.
Fig. 3 Histogram of TNFAIP8 mRNA expression in EOC based on platinum resistance (S, platinum-sensitive tumors; R, platinumresistant tumors).
progression [30]. However, intrinsic or acquired chemotherapy resistance remains a dominating clinical challenge and a pivotal factor affecting the survival outcome of these patients [31]. Previously, immunohistochemical study showed that TNFAIP8 correlated with platinum resistance by χ2 test [13]. In the present work, Western blot analysis of ovarian tissues revealed that TNFAIP8 protein expression gradually increased from normal tissues to platinum-sensitive tumors to platinum-resistant tumors. Furthermore, the association between TNFAIP8 and platinum resistance is indicated at both Table 4 Clinicopathological variables and TNFAIP8 mRNA expression in 40 EOCs Variables
Age (y) ≤54 N54 FIGO stage II III IV Histologic grade G1/G2 G3 Histologic type Serous Mucinous Endometrioid Residual tumor size ≤1 cm N1 cm Ascites ≤100 mL N100 mL Serum CA-125 level ≤35 U/mL N35 U/mL Platinum resistance Present Absent
Total TNFAIP8 mRNA n = 40 expression Low (%)
High (%)
21 19
12 (57.1) 8 (42.1)
9 (42.9) 11 (57.9)
6 31 3
5 (33.33) 1 (66.67) 14 (52.78) 17 (47.22) 1 (0.00) 2 (100.00)
18 22
11 (61.1) 9 (40.9)
28 5 7
15 (53.57) 13 (46.43) 3 (60.00) 2 (40.00) 2 (28.57) 5 (71.43)
26 14
17 (65.4) 3 (21.4)
9 (34.6) 11 (78.6)
7 33
4 (57.1) 16 (48.5)
3 (42.9) 17 (51.5)
3 37
1 (33.3) 19 (51.4)
2 (66.7) 18 (48.6)
18 22
5 (27.8) 15 (68.2)
13 (72.2) 7 (31.8)
P
.527
.292
.341 7 (38.9) 13 (59.1) .606
.019
1.000
1.000
.025
protein and mRNA levels. We also found that FIGO stage, residual tumor size, and ascites were significantly correlated with platinum resistance. Multivariate logistic regression analysis showed that TNFAIP8 expression was an independent predictor of platinum resistance, implying that TNFAIP8 overexpression plays a crucial role in chemotherapy resistance. In accordance with our results, previous studies on esophageal squamous cell carcinoma have reported that platinum-induced apoptosis is greater in the TNFAIP8 siRNA (Small interfering RNA) group than in its counterpart [11]. We also demonstrated that ascites and residual tumor size were both independent factors affecting platinum resistance. Malignant ascites include numerous survival factors [32] that can potentially promote rapid tumor cell growth and enhance resistance to cytotoxic agents. Therefore, malignant ascites, the microenvironment of tumor cells, is a potential factor affecting the elimination of tumor cells in vivo. Lane et al [33] found that the tumor microenvironment may contribute to the resistance of ovarian cancer cells to death receptor– induced apoptosis. TNFAIP8 is known as a member of the Fas-associated death domain–like interleukin-1β–converting enzyme–inhibitory protein family of cell death inhibitory proteins [1]. However, the presence of cross-interaction between TNFAIP8 gene and ascites still needs elucidation. Our data agreed with previous ones indicating that enormous residual tumor may lead to a high chance of chemotherapy resistance [34]. However, numerous patients treated with maximal cytoreduction have disease progression upon initial chemotherapy, which can be attributed to biological aggressiveness [35]. We separately evaluated the association between TNFAIP8 expression and platinum resistance in 2 groups divided by the extent of cytoreduction to eliminate the effect of residual tumor size. Our evaluation indicated that patients with TNFAIP8 overexpression had a higher risk of platinum resistance in the optimal cytoreduction group but not in the suboptimal cytoreduction group. In conclusion, this study indicated that TNFAIP8 overexpression can be used alone or in combination with other markers to identify EOC patients who are more susceptible to platinum resistance. Taken together, these observations may influence clinical management, that is, patients with TNFAIP8 overexpression may be more frequently monitored
TNFAIP8 a platinum-resistant marker to detect resistance early enough and help them benefit from second-line chemotherapy or molecular targeted therapy. Thus, the immunohistochemical analysis of TNFAIP8 may have clear clinical implications.
Acknowledgments The authors thank all the people who participated in this study.
References [1] Kumar D, Whiteside TL, Kasid U. Identification of a novel tumor necrosis factor-alpha-inducible gene, SCC-S2, containing the consensus sequence of a death effector domain of fas-associated death domain-like interleukin-1beta-converting enzyme-inhibitory protein. J Biol Chem 2000;275:2973-8. [2] Horrevoets AJ, Fontijn RD, van Zonneveld AJ, de Vries CJ, ten Cate JW, Pannekoek H. Vascular endothelial genes that are responsive to tumor necrosis factor-alpha in vitro are expressed in atherosclerotic lesions, including inhibitor of apoptosis protein-1, stannin, and two novel genes. Blood 1999;93:3418-31. [3] You Z, Ouyang H, Lopatin D, Polver PJ, Wang CY. Nuclear factorkappa B-inducible death effector domain-containing protein suppresses tumor necrosis factor-mediated apoptosis by inhibiting caspase-8 activity. J Biol Chem 2001;276:26398-404. [4] Kumar D, Gokhale P, Broustas C, Chakravarty D, Ahmad I, Kasid U. Expression of SCC-S2, an antiapoptotic molecule, correlates with enhanced proliferation and tumorigenicity of MDA-MB 435 cells. Oncogene 2004;23:612-6. [5] Zhang C, Chakravarty D, Sakabe I, et al. Role of SCC-S2 in experimental metastasis and modulation of VEGFR-2, MMP-1, and MMP-9 expression. Mol Ther 2006;13:947-55. [6] Liu K, Qin CK, Wang ZY, Liu SX, Cui XP, Zhang DY. Expression of tumor necrosis factor-alpha-induced protein 8 in pancreas tissues and its correlation with epithelial growth factor receptor levels. Asian Pac J Cancer Prev 2012;13:847-50. [7] Miao Z, Zhao T, Wang Z. SCC-S2 is overexpressed in colon cancers and regulates cell proliferation. Tumour Biol 2012;33:2099-106. [8] Zhang C, Kallakury BV, Ross JS, et al. The significance of TNFAIP8 in prostate cancer response to radiation and docetaxel and disease recurrence. Int J Cancer 2012;133:31-42. [9] Shi TY, Cheng X, Yu KD, et al. Functional variants in TNFAIP8 associated with cervical cancer susceptibility and clinical outcomes. Carcinogenesis 2013;34:770-8. [10] Dong QZ, Zhao Y, Liu Y, et al. Overexpression of SCC-S2 correlates with lymph node metastasis and poor prognosis in patients with nonsmall-cell lung cancer. Cancer Sci 2010;101:1562-9. [11] Hadisaputri YE, Miyazaki T, Suzuki S, et al. TNFAIP8 overexpression: clinical relevance to esophageal squamous cell carcinoma. Ann Surg Oncol 2012;19:S589-96. [12] Zhang Y, Wang MY, He J, et al. Tumor necrosis factor-α induced protein 8 polymorphism and risk of non-Hodgkin’s lymphoma in a Chinese population: a case-control study. PLoS One 2012;7:e37846. [13] Liu T, Gao H, Chen X, et al. TNFAIP8 as a predictor of metastasis and a novel prognostic biomarker in patients with epithelial ovarian cancer. Br J Cancer 2013;109:1685-92. [14] Wang MC, Liu SX, Liu PB. Gene expression profile of multiple myeloma cell line treated by realgar. J Exp Clin Cancer Res 2006;25:243-9. [15] Ozols RF. Treatment goals in ovarian cancer. Int J Gynecol Cancer 2005;15:3-11.
7 [16] Partridge EE, Barnes MN. Epithelial ovarian cancer: prevention, diagnosis, and treatment. CA Cancer J Clin 1999;49:297-320. [17] Guarneri V, Piacentini F, Barbieri E, Conte PF. Achievements and unmet needs in the management of advanced ovarian cancer. Gynecol Oncol 2010;117:152-8. [18] Agarwal R, Kaye SB. Ovarian cancer: strategies for overcoming resistance to chemotherapy. Nat Rev Cancer 2003;3:502-16. [19] Kobayashi H, Yamada Y, Kanayama S, et al. The role of hepatocyte nuclear factor-1beta in the pathogenesis of clear cell carcinoma of the ovary. Int J Gynecol Cancer 2009;19:471-9. [20] Tavassoeli FA, Devilee P. WHO Classification of tumours, pathology and genetics: tumours of the breast and female genital organs. Lyon: IARC; 2003. [21] Benedet JL, Bender H, Jones 3rd H, Ngan HY, Pecorelli S. FIGO staging classifications and clinical practice guidelines in the management of gynecologic cancers. FIGO Committee on Gynecologic Oncology. Int J Gynaecol Obstet 2000;70:209-62. [22] Ozols RF, Bundy BN, Greer BE, et al. Phase III trial of carboplatin and paclitaxel compared with cisplatin and paclitaxel in patients with optimally resected stage III ovarian cancer: a Gynecologic Oncology Group study. J Clin Oncol 2003;21:3194-200. [23] Morgan RJ, Alvarez RD, Armstrong DK, et al. Ovarian cancer including fallopian tube cancer and primary peritoneal cancer. NCCN clinical practice guidelines in oncology. 2009. [24] Markman M, Bookman MA. Second-line treatment of ovarian cancer. Oncologist 2000;5:26-35. [25] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−delta delta C(T)) method. Methods 2001;25:402-8. [26] Patel S, Wang FH, Whiteside TL, Kasid U. Identification of seven differentially displayed transcripts in human primary and matched metastatic head and neck squamous cell carcinoma cell lines: implications in metastasis and/or radiation response. Oral Oncol 1997;33:197-203. [27] Laliberté B, Wilson AM, Nafisi H, et al. TNFAIP8: a new effector for Galpha(i) coupling to reduce cell death and induce cell transformation. J Cell Physiol 2010;225:865-74. [28] Zhang LJ, Liu X, Gafken PR, Kioussi C, Leid M. A chicken ovalbumin upstream promoter transcription factor I (COUP-TFI) complex represses expression of the gene encoding tumor necrosis factor alpha-induced protein 8 (TNFAIP8). J Biol Chem 2009;284:6156-68. [29] Holschneider CH, Berek JS. Ovarian cancer: epidemiology, biology, and prognostic factors. Semin Surg Oncol 2000;19:3-10. [30] Miller DS, Blessing JA, Krasner CN, et al. Phase II evaluation of pemetrexed in the treatment of recurrent or persistent platinumresistant ovarian or primary peritoneal carcinoma: a study of the Gynecologic Oncology Group. J Clin Oncol 2009;27:2686-91. [31] Bristow RE, Tomacruz RS, Armstrong DK, Trimble EL, Montz FJ. Survival effect of maximal cytoreductive surgery for advanced ovarian carcinoma during the platinum era: a meta-analysis. J Clin Oncol 2002;20:1248-59. [32] Ahmed N, Riley C, Oliva K, Rice G, Quinn M. Ascites induces modulation of alpha6beta1 integrin and urokinase plasminogen activator receptor expression and associated functions in ovarian carcinoma. Br J Cancer 2005;92:1475-85. [33] Lane D, Robert V, Grondin R, Rancourt C, Piché A. Malignant ascites protect against TRAIL-induced apoptosis by activating the PI3K/Akt pathway in human ovarian carcinoma cells. Int J Cancer 2007;121:1227-37. [34] Eisenhauer EL, Abu-Rustum NR, Sonoda Y, Aghajanian C, Barakat RR, Chi DS. The effect of maximal surgical cytoreduction on sensitivity to platinum-taxane chemotherapy and subsequent survival in patients with advanced ovarian cancer. Gynecol Oncol 2008;108:276-81. [35] Bristow RE, Eisenhauer EL, Santillan A, Chi DS. Delaying the primary surgical effort for advanced ovarian cancer: a systematic review of neoadjuvant chemotherapy and interval cytoreduction. Gynecol Oncol 2007;104:480-90.
