Plant Molecular Biology 8:145-149 (1987) © Martinus Nijhoff Publishers, Dordrecht - Printed in the Netherlands
145
TMV protein synthesis is not translationally regulated by heat shock William O. Dawson & Carol Boyd
Department of Plant Pathology, University of California, Riverside, CA 92521, U.S.A.
Keywords: heat shock, Tobacco mosaic virus, TMV, translational regulation
Summary Tobacco mosaic virus (TMV) protein synthesis in tobacco leaf tissue was not translationally regulated under conditions of heat shock as were most of the other proteins that were produced at 25 °C. Upon shift from 25 ° C to 3 7 - 4 0 °C, most host protein synthesis was inhibited followed by initiation of synthesis of heat shock proteins. In contrast, TMV protein synthesis continued after the temperature shift. This phenomenon allowed the enhancement o f detection of TMV protein synthesis in tobacco leaves. The most prominent proteins labeled were viral when tissue was labeled during the first hr following the shift to 40 °C, a period after heat shock repression o f host protein synthesis, but before the onset of most heat shock protein synthesis. Another method to predominately label viral proteins was to incubate infected leaves for periods at 35 °C which induced repression of preexisting host protein synthesis without inducing synthesis of heat shock proteins.
Introduction All eukaryotic organisms so far examined respond to sudden increases to high temperatures by rapid changes in transcription and translation that protect the organism from this stress (1, 11, 12). The first reaction is the inhibition of synthesis of most preexisting proteins. Secondly, the synthesis of a small set of new proteins, usually referred to as heat shock proteins (hsp), begins as a result of the induction of transcription of a new set of mRNAs. The shutdown of normal protein synthesis results from translational regulation. Preexisting mRNAs are not broken down upon the temperature shift, but are sequestered and maintained such that normal protein synthesis resumes after return to the normal temperature, even in the absence of new transcription (6, 9). Also, normal mRNAs isolated from heat-shocked cells are translated in vitro in lysates from non-heat-shocked ceils but not in lysates from heat-shocked cells (14) demonstrating that some change occurs in heat-shocked cells that al-
lows discrimination between the two types of mRNAs. This suggests that some structural difference occurs between normal and hsp mRNAs. Recently, the preferential translation of hsp mRNAs has been shown to be due to the sequence of the 5' non-translated region. Addition of this leader to other gene coding sequences results in production of these proteins at high temperatures (2, 5) and modification of this leader sequence results in loss of preferential translation (10). A few mRNAs other than hsp mRNAs have been found not to be translationally regulated after heat shock. These include the synthesis of histones (16) and the proteins of a double-stranded RNA virus of Drosophila (13). In this paper, we demonstrate that tobacco mosaic virus (TMV) mRNAs are not subject to the translational regulation induced by heat shock that decreases the synthesis of most preexisting proteins in tobacco. Also, this phenomenon is utilized to enhance detection o f virus-specific protein synthesis in plant tissues.
146 Materials and methods
Tobacco plants (Nicotiana tabacum L. var. Xanthi) were maintained in a plant growth chamber at 25 °C and a 16 hr photoperiod of 15000 lux for at least 5 days prior to labeling experiments. Fully expanded tobacco leaves were mechanically inoculated with 1 mg/ml of tobacco mosaic virus (TMV) in 50 mM glycine, 30 mM K2HPO 4, pH 9.2, containing 1% Celite. Infected leaves were maintained at 25 °C for 5 days to allow the rate of virus multiplication to become maximal. To radioactively label proteins in healthy and TMV-infected leaves, 0.1 g samples of leaf strips were submerged and vacuum infiltrated in 50/~Ci/ml [aH]-leucine in 1 mM Tris-HC1 buffer, pH 7.0, plus 1 mg/ml penicillin G. Samples then were incubated in petri dishes in plant growth chambres at 10000 lux at the designated temperature. The labeling period was terminated by freezing the tissue at - 2 0 ° C . Proteins were extracted by powdering tissue frozen in liquid nitrogen with a mortar and pestle followed by boiling 15 min in 2.5 ml 150 mM TrisHC1, pH 8.0, 10 mM KC1, 1 mM EDTA, 12°70 glycerol, 2°7o SDS, 10 mM dithioerythritol, and 0.05 mM phenylmethylsulfonyl fluoride. The 10000 g supernatant was analyzed by electrophoresis in SDS-polyacrylamide gels (12°/0) (15), followed by fluorography (8).
Results
The effects of temperature shifts from 25 °C to 35-42 °C upon host and virus protein synthesis in healthy and TMV-infected tobacco leaves were examined by monitoring [aH]-leucine incorporation into soluble proteins analyzed by polyacrylamide gel electrophoresis and fluorography. Results were similar upon shift to any temperature in this range. Figure 1 (lanes a - d ) shows the results of shifting healthy and infected leaves to 37 °C. During the first two hours after shift from 25 °C to 37 °C, the synthesis of most of the proteins produced at 25 °C (lanes a and b) was markedly reduced and a group of heat shock proteins (hsp) began to be synthesized (lanes c and d), which is the normal heat shock response. Synthesis of TMV proteins did not parallel that of the other proteins produced at
25 °C. Synthesis of the three TMV proteins (183k, 126k, and 17.5k coat protein) continued after the shift to 37°C (lane c), whereas, the synthesis of most of the proteins produced at 25°C in both healthy and infected leaves declined markedly upon shift to 37°C. The resulting major bands from TMV-infected leaves shifted to 37 °C are viral proteins and hsp. Figure 1, lanes e - h , demonstrate a similar response immediately following a shift to 40°C. However, the continuing viral synthesis at 40 °C is only transitory. Upon further incubation at 40 °C, viral protein synthesis began slowly decreasing. When tissue was labeled for 2 hr at 40 °C beginning at 15 min after the shift to 40°C (lane g) or 1 hr after the shift to 40°C (lane h), the synthesis of the 183K and 126K proteins was progressively reduced compared to that in tissue labeled immediately after the shift to 40°C (lane f). We previously have shown that synthesis of all TMV RNAs including viral mRNAs were inhibited upon shift to 40 °C (3, 4). The half-lives of synthesis of the 183K, 126K, and 17.5K proteins of TMV were approximately 0.5, 1, and 12 hr, respectively, after shift to 40°C (4). However, the kinetics of TMV protein synthesis after the temperature shift were totally different from that of the preexisting host proteins. Synthesis of the 183k and 126k viral proteins began decreasing within the first hour at 40 °C and the coat protein did not appreciably decrease during this period, but most preexisting host proteins were inhibited immediately. This demonstrates that TMV protein synthesis was not translationally regulated by heat shock in the same manner as were most of the tobacco proteins that were made before heat shock. The kinetics of induction of hsp synthesis and the repression of normal protein synthesis after heat shock were examined in healthy and TMVinfected tobacco leaves in an effort to determine whether the viral infection affected the heat shock response. In 10 different experiments, we observed no reproducible differences in the kinetics or profile of hsp synthesis, the loss of hsp synthesis upon prolonged incubation at the high temperature, the loss of hsp synthesis upon return to 25 °C, or the inhibition of normal protein synthesis upon shift to high temperatures. It is evident in Figure 1 that detection of TMV proteins was enhanced after the heat shock re-
147
Fig. 1. Synthesis of proteins in healthy and tobacco mosaic virus (TMV)-infected tobacco leaves at 25 °C and after shift to 37 °C or
40°C. Fluorographs of SDS-polyacrylamide gels of proteins from leaf tissues incubated 2 hr with [3H]-leucine. Proteins in TMVinfected (lane a) and healthy (lane b) tissues were labeled at 25 °C. Lane c (TMV-infected) and lane d (healthy) show proteins labeled 0 - 2 hr after shift to 37 °C. Lanes e - h show protein profiles from TMV-infected tissues labeled at 25 °C (lane e), 0 - 2 hr after shift to 40°C (lane f), 0.25-2.25 hr after shift to 40°C (lane g), and 1 - 3 hr after shift to 40°C for 10 hr and labeled 6 hr at 35°C (lane h). TMV proteins and some of the heat shock proteins (hsp) are identified in the margins. Each lane contains the amount of protein in 1 mg fresh leaf tissue.
sponse due to the decrease in synthesis o f pre-heatshock proteins and the lack o f inhibition o f viral protein synthesis. The m a j o r proteins produced after the heat shock were T M V proteins and hsp, It was possible to enhance detection o f viral protein synthesis even more by reducing the labeling o f hsp. This could be d o n e by two methods. Translational repression o f host protein synthesis normally occurs almost immediately after heat shock, but p r o d u c t i o n o f hsp usually begins about one hour after the temperature shift (7). It was possible to label T M V proteins during this interval after repression o f n o r m a l protein synthesis and before induction o f hsp synthesis, labelling predominately T M V proteins. Figure 2, lane b,
shows incorporation into proteins o f TMV-infected leaves during the first hour after shift from 25 °C to 4 0 ° C . The m a j o r bands are the 126K and 17.5K virus proteins. The 183K protein is visible but reduced in intensity. The b a c k g r o u n d o f proteins produced at 25 °C (lane a) was decreased, but the hsp that were produced after the first h o u r at 40 °C (lane c) were only slightly labelled during the first h o u r after the shift to 40 °C (lane b). The resulting m a j o r bands in lane b are virus proteins. The disadvantage o f this procedure is that viral proteins have to be labeled during a relatively short pulse o f radioactivity making slowly produced proteins, like the 183K protein, difficult to label. A n o t h e r m e t h o d f o u n d to enhance detection o f
148
Fig. 2. Enhanced detection of synthesis of tobacco mosaic virus (TMV) proteins in infected tobacco leaves. Fluorographs of SDS-
polyacrylamidegels of proteins from leaf tissues incubated with [3H]-leucine. Tissues were labeled 1 hr at 25 °C (lane a), 0 - 1 hr after shift to 40°C (lane b), and 1 - 2 hr after shift to 40°C (lane c). Lanes d - i show effects of 35 °C on host non-heat-shock and heat-shock protein synthesis and TMV protein synthesis. Proteins of TMV-infected (lane d) and healthy (lane e) tissues labeled 6 hr at 25 °C; proteins of TMV-infected tissues incubated at 35 °C for 5 hr and labeled 6 hr at 35 °C (lane f) or 25 °C (lane g); proteins of TMV-infected leaves incubated at 35 °C (lane h) or 25 °C (lane i). TMV proteins are identified in the margins. Each lane contains the amount of protein in 1 mg fresh leaf tissue.
viral p r o t e i n synthesis was to induce t r a n s l a t i o n a l r e g u l a t i o n w i t h o u t i n d u c i n g p r o d u c t i o n o f hsp (Fig. 2, lanes d - i ) . I n c u b a t i o n o f leaves at 35 °C for 5 hrs (lanes f a n d g) or 10 hrs (lanes h a n d i) greatly r e d u c e d the synthesis o f host p r o t e i n s when labelled at either 35 °C (lanes f a n d h) or after shift b a c k to 25 °C (lanes g a n d i), b u t d i d n o t m a r k e d l y reduce viral p r o t e i n synthesis, n o r d i d these c o n d i tions i n d u c e the synthesis o f hsp. T h e m a j o r b a n d s in lanes f - i are t h o s e o f T M V proteins. In c o n t r a s t to 40 °C, virus r e p l i c a t i o n c o n t i n u e s at 35 °C. This allows the use o f long labeling p e r i o d s to e n h a n c e d e t e c t i o n o f viral proteins t h a t are p r o d u c e d in low a m o u n t s o r at low rates, i.e., the 183K protein. These c o n d i t i o n s d o n o t q u a n t i t a t i v e l y increase the rates o f synthesis o f viral proteins, b u t o n l y q u a l i t a tively increase the ratios o f r a d i o a c t i v e p r e c u r s o r
i n c o r p o r a t i o n into viral proteins c o m p a r e d to the b a c k g r o u n d o f host proteins, thus allowing better detection.
Discussion U p o n shift to high temperatures, the synthesis o f m o s t h o s t proteins was i m m e d i a t e l y inhibited, whereas the synthesis o f T M V proteins was n o t inhibited. This d i s c r i m i n a t i o n between the preexisting n o r m a l h o s t m R N A s a n d T M V m R N A s after h e a t shock suggests t h a t there is s o m e structural or spacial differences between these two classes o f m R N A s . T h e d i s c r i m i n a t i o n between n o r m a l m R N A s a n d hsp m R N A s has been identified as the n o n - t r a n s l a t e d l e a d e r sequence o f the hsp m R N A s .
149
Among the different hsp mRNAs there are two conserved sequences, TTCAATTCAAA near the 5' end and AAGTGCAAGTTAAAGTGAATCAAT near the center of the leader region (10). The entire genome of TMV has been sequenced (6). We searched the TMV genome for similar sequences in leader regions and found nothing similar. However, either of these sequences can be removed from the hsp leader sequence and heat shock synthesis is retained (10), leading to the suggestion that a higher order structure is the characteristic recognized by the heat-shock translation mechanism. Hsp mRNAs have less secondary structure than most other mRNA leaders (10). The low CG content of the TMV leader sequence would be consistent with this model. A major technical problem in examining mechanisms of replication of RNA viruses of plants has been the difficulty of detecting viral protein synthesis in vivo. Because these viruses do not selectively induce the inhibition of host protein synthesis, it often is difficult to detect viral protein synthesis other than that of the virus coat protein from the background of host protein synthesis. Some researchers have been able to reduce the background of host protein synthesis in protoplasts by treatments with actinomycin D or ultraviolet light and thereby detect virus protein synthesis. These procedures have been less successful in intact leaves. Also, there are proteins produced in vitro using mRNAs of numerous viruses that have not been detected in vivo. The utilization of translational regulation of normal host protein synthesis after heat shock has the capacity to greatly enhance the ability to detect viral protein synthesis especially under conditions where viral proteins are labelled without interference of hsp synthesis.
References 1. Altachuler M, Mascarenhas JP: Heat shock proteins and effects of heat shock in plants. Plant Molec Biol 1 : 1 0 3 - 1 1 5 , 1982. 2. Bonner J J, Parks C, Parker-Thornburg J, Mortin MA, Pelham HRB: The use of promoter fusions in Drosophila genetics: isolation of mutations affecting the heat shock response. Cell 37:979 991, 1984. 3. Dawson WO: Synthesis of TMV R N A at restrictive high temperatures. Virology 7 3 : 3 1 9 - 326, 1976. 4. Dawson WO: Tobacco mosaic virus protein synthesis is correlated with double-stranded R N A synthesis and not single-stranded R N A synthesis. Virology 125:314-323, 1983. 5. Di Nocera PP, Dawid IB: Transient expression of genes introduced into cultured cells of Drosophila. Proc Natl Acad Sci USA 80:7095- 7098, 1983. 6. Goelet P, L o m o n o s s o f f GP, Butler PJG, A k a m ME, Gait M J, Karn J: Nucleotide sequence of tobacco mosaic virus RNA. Proc Natl Acad Sci USA 79:5818-5822, 1982. 7. Key JL, Lin CY, Chen YM: Heat shock proteins of higher plants. Proc Natl Acad Sci USA 78:3526-3530, 1981. 8. Laskey R, Mills A: Quantitative film detection of 3H and 14C in polyacrylamide gels by fluorography. Eur J Biochem 5 6 : 3 3 5 - 341, 1975. 9. Lindquist S: Regulation of protein synthesis in Drosophila during heat shock. Nature 293:311 - 314, 1981. 10. McGarry TJ, Lindquist S: The preferential translation of Drosophila hsp70 m R N A requires sequences in the untranslated leader. Cell 4 2 : 9 0 3 - 911, 1985. 11. Mitchell H, Moiler G, Petersen N, Lipps-Sarmiento L: Specific protection from phenocopy induction by heat shock. Dev Genet 1:181 - 192, 1979. 12. Petersen NS, Mitchell HK: Recovery of protein synthesis after heat shock: prior heat treatment affects the ability of cells to translate m R N A . Proc Natl Acad Sci USA 78:1708- 1711, 1981. 13. Scott MP, Fostel JM, Pardue ME: A new type of virus from cultured Drosophila cells: characterization and use in studies of the heat-shock response. Cell 22:929 - 941, 1980. 14. Scott MP, Pardue ML: Translational control in lysates of Drosophila melanogaster cells. Proc Natl Acad Sci USA 78:3353-3357, 1981. 15. Siegel A, Hari V, Kolacz K: The effect of tobacco mosaic virus infection on host and virus-specific protein synthesis in protoplasts. Virology 8 5 : 4 9 4 - 5 0 3 , 1987. 16. Storti RV, Scott MP, Rich A, Pardue ML: Translational control of protein synthesis in response to heat shock in D. melanogaster cells. Cell 22:825 - 834, 1980. Received 27 June 1986; in revised form 16 September 1986; accepted 24 September 1986.
145
TMV protein synthesis is not translationally regulated by heat shock William O. Dawson & Carol Boyd
Department of Plant Pathology, University of California, Riverside, CA 92521, U.S.A.
Keywords: heat shock, Tobacco mosaic virus, TMV, translational regulation
Summary Tobacco mosaic virus (TMV) protein synthesis in tobacco leaf tissue was not translationally regulated under conditions of heat shock as were most of the other proteins that were produced at 25 °C. Upon shift from 25 ° C to 3 7 - 4 0 °C, most host protein synthesis was inhibited followed by initiation of synthesis of heat shock proteins. In contrast, TMV protein synthesis continued after the temperature shift. This phenomenon allowed the enhancement o f detection of TMV protein synthesis in tobacco leaves. The most prominent proteins labeled were viral when tissue was labeled during the first hr following the shift to 40 °C, a period after heat shock repression o f host protein synthesis, but before the onset of most heat shock protein synthesis. Another method to predominately label viral proteins was to incubate infected leaves for periods at 35 °C which induced repression of preexisting host protein synthesis without inducing synthesis of heat shock proteins.
Introduction All eukaryotic organisms so far examined respond to sudden increases to high temperatures by rapid changes in transcription and translation that protect the organism from this stress (1, 11, 12). The first reaction is the inhibition of synthesis of most preexisting proteins. Secondly, the synthesis of a small set of new proteins, usually referred to as heat shock proteins (hsp), begins as a result of the induction of transcription of a new set of mRNAs. The shutdown of normal protein synthesis results from translational regulation. Preexisting mRNAs are not broken down upon the temperature shift, but are sequestered and maintained such that normal protein synthesis resumes after return to the normal temperature, even in the absence of new transcription (6, 9). Also, normal mRNAs isolated from heat-shocked cells are translated in vitro in lysates from non-heat-shocked ceils but not in lysates from heat-shocked cells (14) demonstrating that some change occurs in heat-shocked cells that al-
lows discrimination between the two types of mRNAs. This suggests that some structural difference occurs between normal and hsp mRNAs. Recently, the preferential translation of hsp mRNAs has been shown to be due to the sequence of the 5' non-translated region. Addition of this leader to other gene coding sequences results in production of these proteins at high temperatures (2, 5) and modification of this leader sequence results in loss of preferential translation (10). A few mRNAs other than hsp mRNAs have been found not to be translationally regulated after heat shock. These include the synthesis of histones (16) and the proteins of a double-stranded RNA virus of Drosophila (13). In this paper, we demonstrate that tobacco mosaic virus (TMV) mRNAs are not subject to the translational regulation induced by heat shock that decreases the synthesis of most preexisting proteins in tobacco. Also, this phenomenon is utilized to enhance detection o f virus-specific protein synthesis in plant tissues.
146 Materials and methods
Tobacco plants (Nicotiana tabacum L. var. Xanthi) were maintained in a plant growth chamber at 25 °C and a 16 hr photoperiod of 15000 lux for at least 5 days prior to labeling experiments. Fully expanded tobacco leaves were mechanically inoculated with 1 mg/ml of tobacco mosaic virus (TMV) in 50 mM glycine, 30 mM K2HPO 4, pH 9.2, containing 1% Celite. Infected leaves were maintained at 25 °C for 5 days to allow the rate of virus multiplication to become maximal. To radioactively label proteins in healthy and TMV-infected leaves, 0.1 g samples of leaf strips were submerged and vacuum infiltrated in 50/~Ci/ml [aH]-leucine in 1 mM Tris-HC1 buffer, pH 7.0, plus 1 mg/ml penicillin G. Samples then were incubated in petri dishes in plant growth chambres at 10000 lux at the designated temperature. The labeling period was terminated by freezing the tissue at - 2 0 ° C . Proteins were extracted by powdering tissue frozen in liquid nitrogen with a mortar and pestle followed by boiling 15 min in 2.5 ml 150 mM TrisHC1, pH 8.0, 10 mM KC1, 1 mM EDTA, 12°70 glycerol, 2°7o SDS, 10 mM dithioerythritol, and 0.05 mM phenylmethylsulfonyl fluoride. The 10000 g supernatant was analyzed by electrophoresis in SDS-polyacrylamide gels (12°/0) (15), followed by fluorography (8).
Results
The effects of temperature shifts from 25 °C to 35-42 °C upon host and virus protein synthesis in healthy and TMV-infected tobacco leaves were examined by monitoring [aH]-leucine incorporation into soluble proteins analyzed by polyacrylamide gel electrophoresis and fluorography. Results were similar upon shift to any temperature in this range. Figure 1 (lanes a - d ) shows the results of shifting healthy and infected leaves to 37 °C. During the first two hours after shift from 25 °C to 37 °C, the synthesis of most of the proteins produced at 25 °C (lanes a and b) was markedly reduced and a group of heat shock proteins (hsp) began to be synthesized (lanes c and d), which is the normal heat shock response. Synthesis of TMV proteins did not parallel that of the other proteins produced at
25 °C. Synthesis of the three TMV proteins (183k, 126k, and 17.5k coat protein) continued after the shift to 37°C (lane c), whereas, the synthesis of most of the proteins produced at 25°C in both healthy and infected leaves declined markedly upon shift to 37°C. The resulting major bands from TMV-infected leaves shifted to 37 °C are viral proteins and hsp. Figure 1, lanes e - h , demonstrate a similar response immediately following a shift to 40°C. However, the continuing viral synthesis at 40 °C is only transitory. Upon further incubation at 40 °C, viral protein synthesis began slowly decreasing. When tissue was labeled for 2 hr at 40 °C beginning at 15 min after the shift to 40°C (lane g) or 1 hr after the shift to 40°C (lane h), the synthesis of the 183K and 126K proteins was progressively reduced compared to that in tissue labeled immediately after the shift to 40°C (lane f). We previously have shown that synthesis of all TMV RNAs including viral mRNAs were inhibited upon shift to 40 °C (3, 4). The half-lives of synthesis of the 183K, 126K, and 17.5K proteins of TMV were approximately 0.5, 1, and 12 hr, respectively, after shift to 40°C (4). However, the kinetics of TMV protein synthesis after the temperature shift were totally different from that of the preexisting host proteins. Synthesis of the 183k and 126k viral proteins began decreasing within the first hour at 40 °C and the coat protein did not appreciably decrease during this period, but most preexisting host proteins were inhibited immediately. This demonstrates that TMV protein synthesis was not translationally regulated by heat shock in the same manner as were most of the tobacco proteins that were made before heat shock. The kinetics of induction of hsp synthesis and the repression of normal protein synthesis after heat shock were examined in healthy and TMVinfected tobacco leaves in an effort to determine whether the viral infection affected the heat shock response. In 10 different experiments, we observed no reproducible differences in the kinetics or profile of hsp synthesis, the loss of hsp synthesis upon prolonged incubation at the high temperature, the loss of hsp synthesis upon return to 25 °C, or the inhibition of normal protein synthesis upon shift to high temperatures. It is evident in Figure 1 that detection of TMV proteins was enhanced after the heat shock re-
147
Fig. 1. Synthesis of proteins in healthy and tobacco mosaic virus (TMV)-infected tobacco leaves at 25 °C and after shift to 37 °C or
40°C. Fluorographs of SDS-polyacrylamide gels of proteins from leaf tissues incubated 2 hr with [3H]-leucine. Proteins in TMVinfected (lane a) and healthy (lane b) tissues were labeled at 25 °C. Lane c (TMV-infected) and lane d (healthy) show proteins labeled 0 - 2 hr after shift to 37 °C. Lanes e - h show protein profiles from TMV-infected tissues labeled at 25 °C (lane e), 0 - 2 hr after shift to 40°C (lane f), 0.25-2.25 hr after shift to 40°C (lane g), and 1 - 3 hr after shift to 40°C for 10 hr and labeled 6 hr at 35°C (lane h). TMV proteins and some of the heat shock proteins (hsp) are identified in the margins. Each lane contains the amount of protein in 1 mg fresh leaf tissue.
sponse due to the decrease in synthesis o f pre-heatshock proteins and the lack o f inhibition o f viral protein synthesis. The m a j o r proteins produced after the heat shock were T M V proteins and hsp, It was possible to enhance detection o f viral protein synthesis even more by reducing the labeling o f hsp. This could be d o n e by two methods. Translational repression o f host protein synthesis normally occurs almost immediately after heat shock, but p r o d u c t i o n o f hsp usually begins about one hour after the temperature shift (7). It was possible to label T M V proteins during this interval after repression o f n o r m a l protein synthesis and before induction o f hsp synthesis, labelling predominately T M V proteins. Figure 2, lane b,
shows incorporation into proteins o f TMV-infected leaves during the first hour after shift from 25 °C to 4 0 ° C . The m a j o r bands are the 126K and 17.5K virus proteins. The 183K protein is visible but reduced in intensity. The b a c k g r o u n d o f proteins produced at 25 °C (lane a) was decreased, but the hsp that were produced after the first h o u r at 40 °C (lane c) were only slightly labelled during the first h o u r after the shift to 40 °C (lane b). The resulting m a j o r bands in lane b are virus proteins. The disadvantage o f this procedure is that viral proteins have to be labeled during a relatively short pulse o f radioactivity making slowly produced proteins, like the 183K protein, difficult to label. A n o t h e r m e t h o d f o u n d to enhance detection o f
148
Fig. 2. Enhanced detection of synthesis of tobacco mosaic virus (TMV) proteins in infected tobacco leaves. Fluorographs of SDS-
polyacrylamidegels of proteins from leaf tissues incubated with [3H]-leucine. Tissues were labeled 1 hr at 25 °C (lane a), 0 - 1 hr after shift to 40°C (lane b), and 1 - 2 hr after shift to 40°C (lane c). Lanes d - i show effects of 35 °C on host non-heat-shock and heat-shock protein synthesis and TMV protein synthesis. Proteins of TMV-infected (lane d) and healthy (lane e) tissues labeled 6 hr at 25 °C; proteins of TMV-infected tissues incubated at 35 °C for 5 hr and labeled 6 hr at 35 °C (lane f) or 25 °C (lane g); proteins of TMV-infected leaves incubated at 35 °C (lane h) or 25 °C (lane i). TMV proteins are identified in the margins. Each lane contains the amount of protein in 1 mg fresh leaf tissue.
viral p r o t e i n synthesis was to induce t r a n s l a t i o n a l r e g u l a t i o n w i t h o u t i n d u c i n g p r o d u c t i o n o f hsp (Fig. 2, lanes d - i ) . I n c u b a t i o n o f leaves at 35 °C for 5 hrs (lanes f a n d g) or 10 hrs (lanes h a n d i) greatly r e d u c e d the synthesis o f host p r o t e i n s when labelled at either 35 °C (lanes f a n d h) or after shift b a c k to 25 °C (lanes g a n d i), b u t d i d n o t m a r k e d l y reduce viral p r o t e i n synthesis, n o r d i d these c o n d i tions i n d u c e the synthesis o f hsp. T h e m a j o r b a n d s in lanes f - i are t h o s e o f T M V proteins. In c o n t r a s t to 40 °C, virus r e p l i c a t i o n c o n t i n u e s at 35 °C. This allows the use o f long labeling p e r i o d s to e n h a n c e d e t e c t i o n o f viral proteins t h a t are p r o d u c e d in low a m o u n t s o r at low rates, i.e., the 183K protein. These c o n d i t i o n s d o n o t q u a n t i t a t i v e l y increase the rates o f synthesis o f viral proteins, b u t o n l y q u a l i t a tively increase the ratios o f r a d i o a c t i v e p r e c u r s o r
i n c o r p o r a t i o n into viral proteins c o m p a r e d to the b a c k g r o u n d o f host proteins, thus allowing better detection.
Discussion U p o n shift to high temperatures, the synthesis o f m o s t h o s t proteins was i m m e d i a t e l y inhibited, whereas the synthesis o f T M V proteins was n o t inhibited. This d i s c r i m i n a t i o n between the preexisting n o r m a l h o s t m R N A s a n d T M V m R N A s after h e a t shock suggests t h a t there is s o m e structural or spacial differences between these two classes o f m R N A s . T h e d i s c r i m i n a t i o n between n o r m a l m R N A s a n d hsp m R N A s has been identified as the n o n - t r a n s l a t e d l e a d e r sequence o f the hsp m R N A s .
149
Among the different hsp mRNAs there are two conserved sequences, TTCAATTCAAA near the 5' end and AAGTGCAAGTTAAAGTGAATCAAT near the center of the leader region (10). The entire genome of TMV has been sequenced (6). We searched the TMV genome for similar sequences in leader regions and found nothing similar. However, either of these sequences can be removed from the hsp leader sequence and heat shock synthesis is retained (10), leading to the suggestion that a higher order structure is the characteristic recognized by the heat-shock translation mechanism. Hsp mRNAs have less secondary structure than most other mRNA leaders (10). The low CG content of the TMV leader sequence would be consistent with this model. A major technical problem in examining mechanisms of replication of RNA viruses of plants has been the difficulty of detecting viral protein synthesis in vivo. Because these viruses do not selectively induce the inhibition of host protein synthesis, it often is difficult to detect viral protein synthesis other than that of the virus coat protein from the background of host protein synthesis. Some researchers have been able to reduce the background of host protein synthesis in protoplasts by treatments with actinomycin D or ultraviolet light and thereby detect virus protein synthesis. These procedures have been less successful in intact leaves. Also, there are proteins produced in vitro using mRNAs of numerous viruses that have not been detected in vivo. The utilization of translational regulation of normal host protein synthesis after heat shock has the capacity to greatly enhance the ability to detect viral protein synthesis especially under conditions where viral proteins are labelled without interference of hsp synthesis.
References 1. Altachuler M, Mascarenhas JP: Heat shock proteins and effects of heat shock in plants. Plant Molec Biol 1 : 1 0 3 - 1 1 5 , 1982. 2. Bonner J J, Parks C, Parker-Thornburg J, Mortin MA, Pelham HRB: The use of promoter fusions in Drosophila genetics: isolation of mutations affecting the heat shock response. Cell 37:979 991, 1984. 3. Dawson WO: Synthesis of TMV R N A at restrictive high temperatures. Virology 7 3 : 3 1 9 - 326, 1976. 4. Dawson WO: Tobacco mosaic virus protein synthesis is correlated with double-stranded R N A synthesis and not single-stranded R N A synthesis. Virology 125:314-323, 1983. 5. Di Nocera PP, Dawid IB: Transient expression of genes introduced into cultured cells of Drosophila. Proc Natl Acad Sci USA 80:7095- 7098, 1983. 6. Goelet P, L o m o n o s s o f f GP, Butler PJG, A k a m ME, Gait M J, Karn J: Nucleotide sequence of tobacco mosaic virus RNA. Proc Natl Acad Sci USA 79:5818-5822, 1982. 7. Key JL, Lin CY, Chen YM: Heat shock proteins of higher plants. Proc Natl Acad Sci USA 78:3526-3530, 1981. 8. Laskey R, Mills A: Quantitative film detection of 3H and 14C in polyacrylamide gels by fluorography. Eur J Biochem 5 6 : 3 3 5 - 341, 1975. 9. Lindquist S: Regulation of protein synthesis in Drosophila during heat shock. Nature 293:311 - 314, 1981. 10. McGarry TJ, Lindquist S: The preferential translation of Drosophila hsp70 m R N A requires sequences in the untranslated leader. Cell 4 2 : 9 0 3 - 911, 1985. 11. Mitchell H, Moiler G, Petersen N, Lipps-Sarmiento L: Specific protection from phenocopy induction by heat shock. Dev Genet 1:181 - 192, 1979. 12. Petersen NS, Mitchell HK: Recovery of protein synthesis after heat shock: prior heat treatment affects the ability of cells to translate m R N A . Proc Natl Acad Sci USA 78:1708- 1711, 1981. 13. Scott MP, Fostel JM, Pardue ME: A new type of virus from cultured Drosophila cells: characterization and use in studies of the heat-shock response. Cell 22:929 - 941, 1980. 14. Scott MP, Pardue ML: Translational control in lysates of Drosophila melanogaster cells. Proc Natl Acad Sci USA 78:3353-3357, 1981. 15. Siegel A, Hari V, Kolacz K: The effect of tobacco mosaic virus infection on host and virus-specific protein synthesis in protoplasts. Virology 8 5 : 4 9 4 - 5 0 3 , 1987. 16. Storti RV, Scott MP, Rich A, Pardue ML: Translational control of protein synthesis in response to heat shock in D. melanogaster cells. Cell 22:825 - 834, 1980. Received 27 June 1986; in revised form 16 September 1986; accepted 24 September 1986.
