Tissue-Specific Transcription Initiation and Effects of Growth Hormone (GH) Deficiency on the Regulation of Mouse and Rat GHReleasing Hormone Gene in Hypothalamus and Placenta
Mutsuhiko Mizobuchi, Michael A. Frohman*, Thomas R. Downs, and Lawrence A. Frohman Division of Endocrinology and Metabolism Department of Internal Medicine University of Cincinnati College of Medicine Cincinnati, Ohio 45267 Department of Anatomy University of California School of Medicine (M.A.F.) San Francisco, California 94143
above control levels in both females and males, and pregnancy did not alter the levels in either (dw) or control rats. However, GRH mRNA levels in placenta of {dw) and control animals were similar, indicating differential responses of GRH mRNA to GH deficiency in the two tissues. The differences in transcription initiation sites and in the regulation of expression in the two tissues suggest that the absence of effects of GH deficiency on placental GRH mRNA may be related to the use of different upstream sequences as regulatory regions in hypothalamus and placenta. (Molecular Endocrinology 5: 476-484, 1991)
Hypothalamic GRH gene expression has been shown to be negatively regulated by GH in both rat and mouse. The recent reports of different 5' untranslated sequences in mouse GRH cDNA from hypothalamus and placenta have raised the possibility of tissue-specific regulation of the GRH gene. To provide support for this possibility, we have studied rodent models with GH deficiency due to genetic defects in the pituitary. Complementary DNA probes for the hypothalamic and placental 5' regions were used to determine the tissue specificity of each mRNA. Although the hypothalamic form of GRH mRNA was detected in placenta, it constituted less than 0.7% of total placental GRH mRNA. A placental 5' probe (based on the previously reported sequence) hybridized only with a larger mRNA species and was not tissue specific, indicating that it was not related to GRH and was derived possibly from a cloning artifact. The correct 5' sequence of mouse placental GRH cDNA was determined and shown to be distinct from both that previously reported and the hypothalamic sequence. Although the placental form of GRH mRNA was detected in hypothalamus using the polymerase chain reaction, its levels were undetectable by Northern blotting. The 5' end of rat placental GRH cDNA was similarly sequenced and shown to exhibit no homology with the rat 5' hypothalamic sequence, but a high degree of homology with the corresponding mouse placental sequence. In GH-deficient dwarf (dw/dw) rats, hypothalamic GRH mRNA levels were significantly increased
INTRODUCTION
GH-releasing hormone (GRH) is a hypophysiotropic peptide that stimulates the synthesis and secretion of GH in anterior pituitary somatotrophs. Although the tissue distribution of GRH and its biological effects have been extensively reported in humans and animals (1, 2), there is only limited experimental data concerning the regulation of GRH gene expression, primarily related to inhibitory feedback effects of GH on hypothalamic GRH mRNA (3-7). GRH is synthesized primarily in neuronal perikarya in the hypothalamic arcuate nucleus and stored in nerve terminals in the median eminence (8). However, immunoreactive GRH has been found in extrahypothalamic sites, including the gastrointestinal tract (9), certain neoplasms (10), and the placenta (11, 12), which is also a rich source of other hypothalamic neuropeptides (13-15).
0888-8809/91/0476-0484S03.00/0 Molecular Endocrinology Copyright© 1991 by The Endocrine Society
476
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 22 November 2015. at 05:54 For personal use only. No other uses without permission. . All rights reserved.
477
Placental GRH
Studies in several species have indicated that the expression of genes may be regulated in a tissuespecific manner, as manifested by alternate mRNA splicing (16, 17) or differences in transcription initiation sites (18). Recent studies in the placenta have raised the possibility that releasing hormone gene expression may be differentially regulated from that in the hypothalamus, based on the observations that glucocorticoids have opposite effects on hypothalamic and placental CRH secretion (19-21) and that placental GnRH gene transcription is initiated at a site distinct from that in the hypothalamus (22, 23). We and others have recently reported the cloning of mouse GRH cDNA from the hypothalamus (7) and placenta (24), respectively. The sequences reported by the two groups, corresponding to exons 2-5 of rat GRH cDNA and which contain the entire coding region, were identical and exhibited extensive cross-species homology. However, the reported sequences of the 5' untranslated end of the cDNAs, corresponding to exon 1, were of different length (71 nucleotides in hypothalamus and 204 in placenta) and did not exhibit any homology with one another, although the 5' end of mouse hypothalamic GRH cDNA showed a high degree of homology with exon 1 of the rat sequence (25). This difference suggested that GRH gene expression might be differentially regulated in hypothalamus and placenta. Since GH deficiency leads to an increase in hypothalamic GRH gene expression, such a model provides a setting in which to explore possible tissue differences in GRH gene regulation. In the present study we have examined the tissue specificity of the different forms of GRH mRNA and have searched for differential regulation of the GRH gene in rodent strains that are GH deficient due to a primary genetic defect in the pituitary (26-28).
RESULTS Northern Analysis of Mouse GRH mRNA in Hypothalamus, Placenta, and Liver A schematic representation of mouse hypothalamic and placental GRH cDNAs, indicating the location and orientation of each of the primers used in the present study, is provided in Fig. 1. Complementary DNA probes corresponding to the tissue-specific region (5' end) of the mouse hypothalamic (Fig. 1, primers 5 and 6) and placental (Fig. 1, primers A and C and primers B and D) sequences and to a region within the common sequence of the two cDNAs corresponding to portions of exons 3 and 4 (Fig. 1, primers 1 and 4) were generated by the polymerase chain reaction (PCR). They, together with a full-length hypothalamic GRH cDNA probe, were used for Northern blot analysis of total RNA from mouse hypothalamus, placenta, and liver. As previously reported (7), the full-length mouse hypothalamic GRH probe detected a single band of approximately 750 bases in both hypothalamic and
HYPOTHALAMUS (Frohman et al [7]) A B
PLACENTA (Suhr et al [24])
CD
II
III
IV
V
PLACENTA (Present report)
Fig. 1. Schematic Representation of Mouse Hypothalamic (7) and Placental (Ref. 24 and Present Report) GRH cDNAs Together with the Primers Used in the Present Study Exons are indicated in Roman numerals; exons II—V are common to hypothalamus and placenta. The primers used for generation of specific probes and for sequencing are shown in relation to their exonal location and orientation.
placental RNA (Fig. 2). GRH mRNA was much more abundant in placental RNA than in hypothalamic RNA. However, accurate quantitative comparisons are not possible, since GRH mRNA is not homogeneously distributed in the hypothalamus. Similar results were observed using a probe representing the common region of the GRH cDNA, a single species of mRNA that was more abundant in placental than in hypothalamic RNA and was not detectable in liver RNA. In contrast, the hypothalamus-specific probe detected much less GRH mRNA in placental than in hypothalamic RNA. On the basis of the relative intensities of the hybridization signals in placenta and hypothalamus (densitometric analysis) using the common (12:1) and hypothalamusspecific (1:13) probes, the results indicate that the hypothalamic form of GRH mRNA can account for no more than 0.7% of the total GRH mRNA present in placenta. Northern analysis using the probe generated with primers based on the reported placental 5' end sequence (Fig. 1, primers B and D) detected only a single signal of approximately 3.0 kilobases, present in hypothalamus, placenta, and liver (Fig. 2). The absence of a signal of the correct size (750 bases) using this probe indicates that its sequence is unrelated to GRH and may represent a cloning artifact. This was confirmed by our inability to amplify a PCR product from placental or hypothalamic cDNA of CF1 or C57BL/6J x SJL/J mice using either of two nonoverlapping 5' (sense) primers (Fig. 1, primers A and B) based on the reported placental sequence (24) together with any of three common region (antisense) primers (Fig. 1, primers 1, 2, and 3; data not shown). Amplification and Direct Sequencing of Mouse Placental GRH cDNA 5' End On the basis of the above results, we chose to amplify and sequence the 5' end of mouse placental GRH cDNA. The cDNA was generated using the nested RACE (rapid amplification of cDNA ends) protocol (29, 30) and reverse transcribed placental mRNA as template. This PCR-based technique permits cDNAs to be
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 22 November 2015. at 05:54 For personal use only. No other uses without permission. . All rights reserved.
Vol 5 No. 4
MOL ENDO-1991 478
TISSUE H
P
L
H
P
H
L
P
H
L
P
L
750 nt ^^^w
full length
hypothalamic exon 1
common
"placental exon 1"
PROBE Fig. 2. Northern Blots of Total RNA (10 ^g) from Mouse Hypothalamus (H), Placenta (P), and Liver (L) Hybridized with [32P]mouse GRH cDNA Probes Generated by PCR and Representing a Full-Length Hypothalamic Sequence, a 117-Nucleotide Sequence (Fig. 1, Primers 1 and 4) from the Exon 3-4 Region That Is Common to Both Hypothalamus and Placenta, a 69-Nucleotide Sequence (Fig. 1, Primers 5 and 6) from the Hypothalamic First Exon (7), and a 132-Nucleotide Sequence (Fig. 1, Primers B and D) from the 5' End of the Reported (24) Placental First Exon The same membrane was sequentially hybridized with each probe.
amplified from a known sequence within the cDNA to unknown 3' or 5' ends. The use of this protocol resulted in essentially exclusive amplification of an approximately 330-basepair GRH cDNA product from exon 3 to the 5' end, as determined by agarose-gel electrophoresis and Southern blot analysis (data not shown). Single stranded DNA was then generated from this product by asymmetric PCR and used to perform direct sequence analysis (30, 31). Two hundred and ten bases of the placental GRH cDNA 5' end could be distinguished, encompassing the probable beginning of the first exon through the 5' portion of the presumed third exon. Figure 3 shows the sequence of the 5' end of mouse placental GRH corresponding to its first exon. It contains 84 nucleotides and exhibits no homology with our reported 71-nucleo-
10
MOUSE
tide hypothalamic 5' end sequence (7). However, 25 of the 26 nucleotides at its 3' end do coincide with the corresponding nucleotides at the 3' end of the reported 204-base sequence of mouse placental GRH cDNA (24). The length of this unique mouse placental sequence is consistent with the similar size of hypothalamic and placental GRH mRNAs in Northern analysis. The remaining portion of the cDNA sequence, corresponding to the second and a part of the third exon, is identical to that reported by us (7) and Suhr et a/. (24). The tissue specificity of the placental 5' sequence was determined by generating a placenta-specific probe from placental total RNA using primers (Fig. 1, primers 7 and 8) corresponding to nucleotides 1-17 (sense) and 68-84 (antisense; Fig. 3) and performing Northern analyses on RNA from multiple tissues. As shown in
20
30
40
50
ACTGGTGATCCAGGTCGGCTCTCCAGGTTGCAGGTCTCTCCTGGTTGCGG
PLACENTA EXON I 60
70
80
CTCCCTGCTCATCCGGCTCCCACAACATCACAGA I
i
Fig. 3. Sequence of Mouse Placental GRH cDNA First Exon, as Determined by Direct Sequencing of PCR-Generated Single Stranded cDNA Using an Antisense Oligonucleotide (Fig. 1, Primer 3) from the Region of the Third Exon as the Sequencing Primer The sequences contained in brackets (Fig. 1, primers 7 and 8) were used to generate (by PCR) a placenta-specific probe for subsequent studies.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 22 November 2015. at 05:54 For personal use only. No other uses without permission. . All rights reserved.
479
Placental GRH
co O Q.
i2 c Q.
•c =
2
Q.
2
co CD
O)
c
x:
28s 18s 750 nt [c,-c2] PRIMERS
Fig. 4. Top, Northern Blot of Total RNA (5 ^g) from Various Mouse Tissues Hybridized with an 84-Nucleotide [32P]Mouse Placenta-Specific (Exon 1) cDNA Probe (Fig. 1, Primers 7 and 8). Bottom, Methylene Blue Staining of 28S and 18S Ribosomal RNA Demonstrating Similarity of the Quantity of RNA in Each Lane.
Fig. 4, there was a single signal from placental RNA that was similar in size to those obtained with hypothalamus-specific, common, and full-length probes (Fig. 2), indicating that this sequence is contained in mouse placental GRH cDNA. GRH mRNA containing the placental first exon was not seen in any of the other tissues examined. In a separate experiment no signal was observed in hypothalamic RNA, even after a much longer exposure (data not shown). The integrity of the RNA in these samples was confirmed by methylene blue staining of the ribosomal RNA bands (32). In an attempt to demonstrate expression of the placenta-specific sequence by a more sensitive technique, we amplified GRH cDNA derived from placental, hypothalamic, and liver total RNA using a common sequence antisense primer (Fig. 1, primer 2) together with a placental (Fig. 1, primer 8), hypothalamic (Fig. 1, primer 6), or common (Fig. 1, primer 4) sense primer (Fig. 5). PCR products of the expected size were generated from both hypothalamic and placental templates using the two common primers. When the hypothalamic sense primer was used, a strong amplification signal was seen with the hypothalamic template and a barely detectable signal with the placental template. Substitution of the placental sense primer resulted in the generation of a strong signal from the placental template and a weaker signal from the hypothalamic tem-
Fig. 5. Ethidium Bromide-Stained Gel of PCR Amplification Products from Mouse Hypothalamic (H), Placental (P), and Liver (L) cDNA Templates Using an Antisense Primer from the Fourth Exon Region That Is Common to Both Hypothalamic and Placental cDNA (c2; Fig. 1, Primer 2) and Common (Ci; Fig. 1, Primer 4), Hypothalamus-Specific (h; Fig. 1, Primer 6), or Placenta-Specific (p; Fig. 1, Primer 8) Sense Primers MW, Molecular size markers from Haelll-digested 0X174 DNA.
plate. No amplification signal was seen with any of the primers when the liver template was used. Thus, although small amounts of placenta-specific mRNA are present in the hypothalamus and vice versa, they constitute a very small percentage of the total GRH mRNA in each tissue. Since PCR amplification is not truly quantitative, the relative hybridization signals on Northern blotting (Figs. 2 and 4) provide a more accurate reflection of the abundance of each type of mRNA in the individual tissues. Amplification and Sequencing of GRH cDNA 5' end from Dwarf and Lewis Rat Placenta To demonstrate that the above difference in placental and hypothalamic GRH mRNA was not limited to the mouse and to permit studies in a species with a GHdeficient genetic strain that was more fertile and readily available than the GH-deficient mouse strains, we amplified and sequenced the 5' end of rat placental GRH cDNA. Poly(A)+ RNA from dwarf {dw/dw) and Lewis (control) rat placenta was reverse transcribed with an antisense primer (5'-CACAGAGGAAGGAGAAG-3') from the fifth exon of the rat hypothalamic GRH cDNA sequence (25). Amplification and sequencing were performed as described for the mouse, except for the antisense primers used for the first amplification (5'TTGTTCCTGGTTCCTCT-3'; fourth exon) and the second amplification and sequencing (5'-TGGTGAAGATGGCGTCT-3'; third exon). The 5' end of the cDNA sequence (169 nucleotides) was determined and found
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 22 November 2015. at 05:54 For personal use only. No other uses without permission. . All rights reserved.
MOL ENDO-1991 480
Vol 5 No. 4
to be identical in dwarf and Lewis (control) rats. As shown in Fig. 6, the sequence corresponding to the first exon consisted of 84 nucleotides, the same length as in the mouse. The sequence homology with mouse placental first exon is 81 %, slightly less than the corresponding homology (90%) between the species in the hypothalamic first exon (7, 25). As in the mouse, the rat placental and hypothalamic first exons were completely dissimilar. The next 85-nucleotide sequence, in both dwarf and control rats corresponding to the second exon, is identical to the reported rat hypothalamic sequence, except for a single additional C at position 8 of the second exon. The same additional nucleotide is present in both placental and hypothalamic mouse GRH cDNA sequences.
lation of GRH gene expression on the basis of both structural and physiological studies. In both the mouse and the rat, the 5' untranslated end of placental GRH cDNA has been shown to have a unique sequence from that of hypothalamic GRH cDNA, indicating differences in the site of initiation of transcription and, therefore, in regulation. Measurement of hypothalamic and placental GRH mRNA levels in a genetic model of isolated GH deficiency, the dwarf rat, has revealed, in addition, discordant regulation of GRH mRNA, with marked elevations in hypothalamic GRH mRNA levels in both male and female GH-deficient rats, but no significant difference in placental GRH mRNA between GH-deficient and control pregnant rats. Several previous studies of other releasing hormones in the hypothalamus and placenta have suggested such differences, although only on the basis of either physiological or structural evidence. Glucocorticoids suppress CRH gene expression in the hypothalamus, but increase CRH secretion by the placenta (19-21). No data are yet available, however, concerning sequence differences in CRH mRNA in the two tissues. Studies of GnRH mRNA sequence have revealed that different transcription initiation sites are used in the hypothalamus and placenta, although the precise placental start site is still uncertain, and there are yet no data concerning differential regulation of GnRH mRNA levels (22, 23). The impetus for the present studies arose from the differences in the reported 5' untranslated end of the sequences of mouse hypothalamic (7) and placental (24) GRH cDNA. In the course of determining the tissue specificity of each sequence, we recognized that the reported placental 5' sequence was incorrect and may represent a cloning artifact. The significance of the reported sequence, which does not exhibit homology with any Genbank DNA entry, remains to be determined. The corrected placental 5' sequence is not very different in size from that of the hypothalamic 5' sequence (84 vs. 71 nucleotides, respectively), which is consistent with the size similarity of mouse placental and hypothalamic mRNA observed on Northern blotting (Refs. 7 and 24 and present results). Although PCR amplification revealed both mRNAs to be present in hypothalamus and placenta, quantitative estimates
Hypothalamic and Placental GRH mRNA Levels in Pregnant and Nonpregnant Dwarf and Control Rats Hypothalamic and placental mRNA levels were determined by Northern blotting, using a rat GRH cDNA probe containing only a region common to both hypothalamus and placenta (exons 3-5). In the hypothalamus, GRH mRNA levels in dwarf rats were increased 3.6-fold above control levels in females (P < 0.01) and 1.8-fold in males (P < 0.01; Fig. 7). In addition, GRH mRNA levels were greater in males than in females in control (P < 0.05) animals. Pituitary GH mRNA levels in dwarf female rats were also markedly reduced (2% of controls; P < 0.01; data not shown). In pregnant dwarf rats (16 days gestation), hypothalamic GRH mRNA levels were also markedly greater than in control rats (P < 0.01; Fig. 8). No effect of pregnancy was observed on hypothalamic GRH mRNA levels in either dwarf or control rats. In contrast, GRH mRNA levels in the placenta of dwarf and control animals were indistinguishable from one another, indicating differential regulation of GRH mRNA in placenta compared to hypothalamus.
DISCUSSION The present results provide evidence in support of differences between hypothalamic and placental regu-
10
RAT
20
A
G. . . C . . .A
60
MOUSE
40
50
ACTGGTGCTCCAGGTCAGCTTTCCTGGTTGCAGATCTCTCCTGGTCAAGG
MOUSE
RAT
30
G
70
TGC. .
80
CTCCCAGCTCGCCTGGATCCCACAACTGCACAGT T
AT. C. . C
AT
A
Fig. 6. Sequence of Rat Placental GRH cDNA First Exon, as Determined by Direct Sequencing of PCR-Generated Single Stranded cDNA Using an Antisense Oligonucleotide from Rat Hypothalamic GRH Exon 3 as the Sequencing Primer (see Results for Details) Differences between the sequences of rat and mouse first exons are indicated.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 22 November 2015. at 05:54 For personal use only. No other uses without permission. . All rights reserved.
Placental GRH
481
MALE FEMALE L Dw L Dw
300
100
Lewis male (5)
Dwarf male (5)
Lewis female (5)
Dwarf female (5)
Fig. 7. Comparison of Rat Hypothalamic GRH mRNA Levels (20% of Single Hypothalamus) in 2-Month-Old Male and Female Dwarf (dw) and Control (Lewis) Rats Northern hybridization signals are from tissues of representative individual animals. The bars represent the mean ± SE, as determined by densitometric analyses. The number of observations in each group is in parentheses. *, P < 0.05; **, Pul 1 x TE. Thirty cycles (94 C, 40 sec; 48 C, 1 min; 72 C, 30 min) of asymmetric PCR (31) were performed in 100 n\ PCR cocktail, which contained 100 ng purified DNA as template, the nested adapter primer, and 5 U Taq polymerase. The concentrations of the other components were the same as described above. Excess nucleotides and primers were removed from the PCR products by three rounds of Centricon 30 centrifugation. One fifth of the recovered DNA was sequenced with the T7 Sequencing Kit (Pharmacia) and the GRH-specific antisense primer (Fig. 1, primer 3) used for the second nested round of amplification described above (1.5 pmol), using the manufacturer's recommendations.
Acknowledgments We thank Drs. Kelly Mayo and John Baxter for providing the rat GRH and GH cDNA clones, respectively.
Received November 8,1990. Revision received January 8, 1991. Accepted January 15,1991. Address requests for reprints to: Lawrence A. Frohman, M.D., Division of Endocrinology and Metabolism, University of Cincinnati College of Medicine, 231 Bethesda Avenue, Cincinnati, Ohio 45267-0547. This work was supported in part by USPHS Grant DK30667. * Special Fellow of the Leukemia Society of America.
Synthesis and Labeling of Probes
REFERENCES Short-length cDNA probes consisting of common (Fig. 1, primers 1 and 4), hypothalamus-specific (Fig. 1, primers 5 and 6), and placenta-specific (Fig. 1, primers 7 and 8) mouse GRH sequences were generated from total mouse RNA, using PCR as described above, and purified from 2% agarose gels. The cDNA probe corresponding to the specific region of the published mouse placental GRH sequence was generated from mouse placental poly(A)+ RNA, using primers (Fig. 1, primers B and D) based on that sequence (24). The probe, in 4 /J 1 x TE, was boiled for 3 min and quenched on ice. A mixture of 10 mM dithiothreitol, 2.5 mM each of dATP, dGTP, and dTTP, 450 mM HEPES (pH 6.6), 50 mM MgCI2 in 4 rf, 6 fi\ [32P]dCTP (60 /xCi; ICN, Irvine, CA), 5 n\ Klenow enzyme (10 U; Boehringer
1. Frohman LA, Jansson J-0 1986 Growth hormone-releasing hormone. Endocr Rev 7:223-253 2. Gomez-Pan A, Rodriguez-Amao MD 1983 Somatostatin and growth hormone releasing factor: synthesis, location, metabolism and function. Clin Endocrinol Metab 12:469507 3. Mayo KE 1989 Structure and expression of growth hormone-releasing hormone (GHRH) genes. In: Muller EE, Cocchi D, Locatelli V (eds) Advances in Growth Hormone and Growth Factor Research. Springer-Verlag, New York, pp 217-230
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 22 November 2015. at 05:54 For personal use only. No other uses without permission. . All rights reserved.
Vol 5 No. 4
MOL ENDO-1991 484
4. Chomczynski P, Downs TR, Frohman LA 1988 Feedback regulation of growth hormone releasing hormone gene expression by growth hormone in rat hypothalamus. Mol Endocrinol 2:236-241 5. DeGennaro Colonna V, Cattaneo E, Cocchi D, Muller EE, Maggi A 1988 Growth hormone regulation of growth hormone-releasing hormone gene expression. Peptides 9:985-988 6. Downs TR, Chomczynski P, Frohman LA 1990 Effects of thyroid hormone deficiency and replacement on rat hypothalamic growth hormone (GH)-releasing hormone gene expression in vivo are mediated by GH. Mol Endocrinol 4:402-408 7. Frohman MA, Downs TR, Chomczynski P, Frohman LA 1989 Cloning and characterization of mouse growth hormone-releasing hormone (GRH) cDNA: increased GRH mRNA levels in the growth hormone deficient lit/lit mouse. Mol Endocrinol 3:1529-1536 8. Bloch B, Brazeau P, Ling N, Bohlen P, Esch F, Wehrenberg WB, Benoit R, Bloom F, Guillemin R 1983 Immunohistochemical detection of growth hormone releasing factor in brain. Nature 301:607-608 9. Bruhn TO, Mason RT, Vale WW1985 Presence of growth hormone-releasing factor-like immunoreactivity in rat duodenum. Endocrinology 117:1710-1712 10. Frohman LA, Szabo M, Berelowitz M, Stachura ME 1980 Partial purification and characterization of a peptide with growth hormone-releasing activity from extrapituitary tumors in patients with acromegaly. J Clin Invest 65:43-54 11. Baird A, Wehrenberg WB, Bohlen P, Ling N 1985 Immunoreactive and biologically active growth hormone-releasing factor in the rat placenta. Endocrinology 117:1598— 1601 12. Meigan G, Sasaki A, Yoshinaga K 1988 Immunoreactive growth hormone-releasing hormone in rat placenta. Endocrinology 123:1098-1102 13. Tan L, Rousseau P 1982 The chemical identity of the immunoreactive LHRH-like peptide biosynthesized in the human placenta. Life Sci 3:327-337 14. Sasaki A, Tempst P, Liotta AS, Margioris AN, Hood LE, Kent SBH, Sato S, Shinkawa O, Yoshinaga K, Krieger DT 1988 Isolation and characterization of a corticotropinreleasing hormone-like peptide from human placenta. J Clin Endocrinol Metab 67:768-773 15. Petraglia F, Calza L, Giardino L, Sutton S, Marrama P, Rivier J, Genazzani AR, Vale W 1989 Identification of immunoreactive neuropeptide-gamma in human placenta: localization, secretion, and binding sites. Endocrinology 124:2016-2022 16. Rosenfeld MG, Mermod JJ, Amara SG, Swanson LW, Sawchenko PE, Rivier J, Vale WW, Evans RM 1983 Production of a novel neuropeptide encoded by the calcitonin gene via tissue-specific RNA processing. Nature 304:129-135 17. Lowe Jr WL, Roberts Jr CT, Lasky SR, LeRoith D 1987 Differential expression of alternative 5' untranslated regions in mRNAs encoding rat insulin-like growth factor I. Proc Natl Acad Sci USA 84:8946-8950 18. Kilpatrick DL, Zinn SA, Fitzgerald M, Higuchi H, Sabol SL, Meyerhardt J 1990 Transcription of the rat and mouse proenkephalin genes is initiated at distinct sites in spermatogenic and somatic cells. Mol Cell Biol 10:3717-3726 19. Robinson BG, Emanuel RL, Frim DM, Majzoub JA 1988 Glucocorticoid stimulates expression of corticotropin-releasing hormone gene in human placenta. Proc Natl Acad Sci USA 85:5244-5248 20. Jones SA, Brooks AN, Challis JRG 1989 Steroids modu-
21.
22.
23.
24.
25.
26.
27.
28.
29.
30. 31.
32.
33.
34.
35.
36.
37.
late corticotropin-releasing hormone production in human fetal membranes and placenta. J Clin Endocrinol Metab 68:825-830 Jingami H, Matsukura S, Numa S, Imura H 1985 Effects of adrenalectomy and dexamethasone administration on the level of prepro-corticotropin-releasing factor messenger ribonucleic acid (mRNA) in the hypothalamus and adrenocorticotropin//3-lipotropin precursor mRNA in the pituitary in rats. Endocrinology 117:1314-1320 Seeburg PH, Adelman JP 1984 Characterization of cDNA for precursor of human luteinizing hormone releasing hormone. Nature 311:666-668 Radovick S, Wondisford FE, Nakayama Y, Yamada M, Cutler Jr GB, Weintraub BD 1990 Isolation and characterization of the human gonadotropin-releasing hormone gene in the hypothalamus and placenta. Mol Endocrinol 4:476-480 Suhr ST, Rahal JO, Mayo KE 1989 Mouse growth hormone-releasing hormone: precursor structure and expression in brain and placenta. Mol Endocrinol 3:1693-1700 Mayo KE, Cerelli GM, Rosenfeld MG, Evans RM 1985 Characterization of cDNA and genomic clones encoding the precursor to rat hypothalamic growth hormone-releasing factor. Nature 314:464-467 Jansson J-O, Downs TR, Beamer WG, Frohman LA 1986 Receptor-associated resistance to growth hormone-releasing hormone in growth hormone deficient dwarf "little" mice. Science 232:511-512 Charlton HM, Clark RG, Robinson ICAF, Goff AEP, Cox BS, Bugnon C, Bloch BA 1988 Growth hormone-deficient dwarfism in the rat: a new mutation. J Endocrinol 119:51 58 Downs TR, Frohman LA, Evidence for a defect in growth hormone (GH)-releasing hormone (GRH) signal transduction in the dwarf (dw/dw) rat pituitary. 72nd Annual Meeting of The Endocrine Society, Atlanta GA, 1990, p 154 (Abstract) Frohman MA, Dush MK, Martin GR 1988 Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci USA 85:8998-9002 Frohman MA, Martin GR 1989 Rapid amplification of cDNA ends using nested primers. Technique 1:165-170 Gyllensten UB, Erlich HA 1988 Generation of singlestranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus. Proc Natl Acad Sci USA 85:7652-7656 Sambrook J, Fritsch EE, Maniatis T 1989 Molecular Cloning-A Laboratory Manual, ed 2. Cold Spring Harbor Laboratory, Cold Spring Harbor Young RA, Hagenbuchle O, Schibler U 1981 A single mouse a-amylase gene specifies two different tissuespecific mRNAs. Cell 23:451-458 Cheng TC, Beamer WG, Phillips III JA, Bartke A, Mallonee RL, Dowling AC 1983 Etiology of growth hormone deficiency in little, Ames and Snell dwarf mice. Endocrinology 113:1669-1678 Carlsson L, Eden S, Jansson J-0 1990 The plasma pattern of growth hormone in conscious rats during late pregnancy. J Endocrinol 124:191-198 Katakami H, Downs TR, Frohman LA 1986 Decreased hypothalamic growth hormone-releasing hormone content and pituitary responsiveness in hypothyroidism. J Clin Invest 77:1704-1711 Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenolchloroform extraction. Anal Biochem 162:156-159
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 22 November 2015. at 05:54 For personal use only. No other uses without permission. . All rights reserved.
Mutsuhiko Mizobuchi, Michael A. Frohman*, Thomas R. Downs, and Lawrence A. Frohman Division of Endocrinology and Metabolism Department of Internal Medicine University of Cincinnati College of Medicine Cincinnati, Ohio 45267 Department of Anatomy University of California School of Medicine (M.A.F.) San Francisco, California 94143
above control levels in both females and males, and pregnancy did not alter the levels in either (dw) or control rats. However, GRH mRNA levels in placenta of {dw) and control animals were similar, indicating differential responses of GRH mRNA to GH deficiency in the two tissues. The differences in transcription initiation sites and in the regulation of expression in the two tissues suggest that the absence of effects of GH deficiency on placental GRH mRNA may be related to the use of different upstream sequences as regulatory regions in hypothalamus and placenta. (Molecular Endocrinology 5: 476-484, 1991)
Hypothalamic GRH gene expression has been shown to be negatively regulated by GH in both rat and mouse. The recent reports of different 5' untranslated sequences in mouse GRH cDNA from hypothalamus and placenta have raised the possibility of tissue-specific regulation of the GRH gene. To provide support for this possibility, we have studied rodent models with GH deficiency due to genetic defects in the pituitary. Complementary DNA probes for the hypothalamic and placental 5' regions were used to determine the tissue specificity of each mRNA. Although the hypothalamic form of GRH mRNA was detected in placenta, it constituted less than 0.7% of total placental GRH mRNA. A placental 5' probe (based on the previously reported sequence) hybridized only with a larger mRNA species and was not tissue specific, indicating that it was not related to GRH and was derived possibly from a cloning artifact. The correct 5' sequence of mouse placental GRH cDNA was determined and shown to be distinct from both that previously reported and the hypothalamic sequence. Although the placental form of GRH mRNA was detected in hypothalamus using the polymerase chain reaction, its levels were undetectable by Northern blotting. The 5' end of rat placental GRH cDNA was similarly sequenced and shown to exhibit no homology with the rat 5' hypothalamic sequence, but a high degree of homology with the corresponding mouse placental sequence. In GH-deficient dwarf (dw/dw) rats, hypothalamic GRH mRNA levels were significantly increased
INTRODUCTION
GH-releasing hormone (GRH) is a hypophysiotropic peptide that stimulates the synthesis and secretion of GH in anterior pituitary somatotrophs. Although the tissue distribution of GRH and its biological effects have been extensively reported in humans and animals (1, 2), there is only limited experimental data concerning the regulation of GRH gene expression, primarily related to inhibitory feedback effects of GH on hypothalamic GRH mRNA (3-7). GRH is synthesized primarily in neuronal perikarya in the hypothalamic arcuate nucleus and stored in nerve terminals in the median eminence (8). However, immunoreactive GRH has been found in extrahypothalamic sites, including the gastrointestinal tract (9), certain neoplasms (10), and the placenta (11, 12), which is also a rich source of other hypothalamic neuropeptides (13-15).
0888-8809/91/0476-0484S03.00/0 Molecular Endocrinology Copyright© 1991 by The Endocrine Society
476
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 22 November 2015. at 05:54 For personal use only. No other uses without permission. . All rights reserved.
477
Placental GRH
Studies in several species have indicated that the expression of genes may be regulated in a tissuespecific manner, as manifested by alternate mRNA splicing (16, 17) or differences in transcription initiation sites (18). Recent studies in the placenta have raised the possibility that releasing hormone gene expression may be differentially regulated from that in the hypothalamus, based on the observations that glucocorticoids have opposite effects on hypothalamic and placental CRH secretion (19-21) and that placental GnRH gene transcription is initiated at a site distinct from that in the hypothalamus (22, 23). We and others have recently reported the cloning of mouse GRH cDNA from the hypothalamus (7) and placenta (24), respectively. The sequences reported by the two groups, corresponding to exons 2-5 of rat GRH cDNA and which contain the entire coding region, were identical and exhibited extensive cross-species homology. However, the reported sequences of the 5' untranslated end of the cDNAs, corresponding to exon 1, were of different length (71 nucleotides in hypothalamus and 204 in placenta) and did not exhibit any homology with one another, although the 5' end of mouse hypothalamic GRH cDNA showed a high degree of homology with exon 1 of the rat sequence (25). This difference suggested that GRH gene expression might be differentially regulated in hypothalamus and placenta. Since GH deficiency leads to an increase in hypothalamic GRH gene expression, such a model provides a setting in which to explore possible tissue differences in GRH gene regulation. In the present study we have examined the tissue specificity of the different forms of GRH mRNA and have searched for differential regulation of the GRH gene in rodent strains that are GH deficient due to a primary genetic defect in the pituitary (26-28).
RESULTS Northern Analysis of Mouse GRH mRNA in Hypothalamus, Placenta, and Liver A schematic representation of mouse hypothalamic and placental GRH cDNAs, indicating the location and orientation of each of the primers used in the present study, is provided in Fig. 1. Complementary DNA probes corresponding to the tissue-specific region (5' end) of the mouse hypothalamic (Fig. 1, primers 5 and 6) and placental (Fig. 1, primers A and C and primers B and D) sequences and to a region within the common sequence of the two cDNAs corresponding to portions of exons 3 and 4 (Fig. 1, primers 1 and 4) were generated by the polymerase chain reaction (PCR). They, together with a full-length hypothalamic GRH cDNA probe, were used for Northern blot analysis of total RNA from mouse hypothalamus, placenta, and liver. As previously reported (7), the full-length mouse hypothalamic GRH probe detected a single band of approximately 750 bases in both hypothalamic and
HYPOTHALAMUS (Frohman et al [7]) A B
PLACENTA (Suhr et al [24])
CD
II
III
IV
V
PLACENTA (Present report)
Fig. 1. Schematic Representation of Mouse Hypothalamic (7) and Placental (Ref. 24 and Present Report) GRH cDNAs Together with the Primers Used in the Present Study Exons are indicated in Roman numerals; exons II—V are common to hypothalamus and placenta. The primers used for generation of specific probes and for sequencing are shown in relation to their exonal location and orientation.
placental RNA (Fig. 2). GRH mRNA was much more abundant in placental RNA than in hypothalamic RNA. However, accurate quantitative comparisons are not possible, since GRH mRNA is not homogeneously distributed in the hypothalamus. Similar results were observed using a probe representing the common region of the GRH cDNA, a single species of mRNA that was more abundant in placental than in hypothalamic RNA and was not detectable in liver RNA. In contrast, the hypothalamus-specific probe detected much less GRH mRNA in placental than in hypothalamic RNA. On the basis of the relative intensities of the hybridization signals in placenta and hypothalamus (densitometric analysis) using the common (12:1) and hypothalamusspecific (1:13) probes, the results indicate that the hypothalamic form of GRH mRNA can account for no more than 0.7% of the total GRH mRNA present in placenta. Northern analysis using the probe generated with primers based on the reported placental 5' end sequence (Fig. 1, primers B and D) detected only a single signal of approximately 3.0 kilobases, present in hypothalamus, placenta, and liver (Fig. 2). The absence of a signal of the correct size (750 bases) using this probe indicates that its sequence is unrelated to GRH and may represent a cloning artifact. This was confirmed by our inability to amplify a PCR product from placental or hypothalamic cDNA of CF1 or C57BL/6J x SJL/J mice using either of two nonoverlapping 5' (sense) primers (Fig. 1, primers A and B) based on the reported placental sequence (24) together with any of three common region (antisense) primers (Fig. 1, primers 1, 2, and 3; data not shown). Amplification and Direct Sequencing of Mouse Placental GRH cDNA 5' End On the basis of the above results, we chose to amplify and sequence the 5' end of mouse placental GRH cDNA. The cDNA was generated using the nested RACE (rapid amplification of cDNA ends) protocol (29, 30) and reverse transcribed placental mRNA as template. This PCR-based technique permits cDNAs to be
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 22 November 2015. at 05:54 For personal use only. No other uses without permission. . All rights reserved.
Vol 5 No. 4
MOL ENDO-1991 478
TISSUE H
P
L
H
P
H
L
P
H
L
P
L
750 nt ^^^w
full length
hypothalamic exon 1
common
"placental exon 1"
PROBE Fig. 2. Northern Blots of Total RNA (10 ^g) from Mouse Hypothalamus (H), Placenta (P), and Liver (L) Hybridized with [32P]mouse GRH cDNA Probes Generated by PCR and Representing a Full-Length Hypothalamic Sequence, a 117-Nucleotide Sequence (Fig. 1, Primers 1 and 4) from the Exon 3-4 Region That Is Common to Both Hypothalamus and Placenta, a 69-Nucleotide Sequence (Fig. 1, Primers 5 and 6) from the Hypothalamic First Exon (7), and a 132-Nucleotide Sequence (Fig. 1, Primers B and D) from the 5' End of the Reported (24) Placental First Exon The same membrane was sequentially hybridized with each probe.
amplified from a known sequence within the cDNA to unknown 3' or 5' ends. The use of this protocol resulted in essentially exclusive amplification of an approximately 330-basepair GRH cDNA product from exon 3 to the 5' end, as determined by agarose-gel electrophoresis and Southern blot analysis (data not shown). Single stranded DNA was then generated from this product by asymmetric PCR and used to perform direct sequence analysis (30, 31). Two hundred and ten bases of the placental GRH cDNA 5' end could be distinguished, encompassing the probable beginning of the first exon through the 5' portion of the presumed third exon. Figure 3 shows the sequence of the 5' end of mouse placental GRH corresponding to its first exon. It contains 84 nucleotides and exhibits no homology with our reported 71-nucleo-
10
MOUSE
tide hypothalamic 5' end sequence (7). However, 25 of the 26 nucleotides at its 3' end do coincide with the corresponding nucleotides at the 3' end of the reported 204-base sequence of mouse placental GRH cDNA (24). The length of this unique mouse placental sequence is consistent with the similar size of hypothalamic and placental GRH mRNAs in Northern analysis. The remaining portion of the cDNA sequence, corresponding to the second and a part of the third exon, is identical to that reported by us (7) and Suhr et a/. (24). The tissue specificity of the placental 5' sequence was determined by generating a placenta-specific probe from placental total RNA using primers (Fig. 1, primers 7 and 8) corresponding to nucleotides 1-17 (sense) and 68-84 (antisense; Fig. 3) and performing Northern analyses on RNA from multiple tissues. As shown in
20
30
40
50
ACTGGTGATCCAGGTCGGCTCTCCAGGTTGCAGGTCTCTCCTGGTTGCGG
PLACENTA EXON I 60
70
80
CTCCCTGCTCATCCGGCTCCCACAACATCACAGA I
i
Fig. 3. Sequence of Mouse Placental GRH cDNA First Exon, as Determined by Direct Sequencing of PCR-Generated Single Stranded cDNA Using an Antisense Oligonucleotide (Fig. 1, Primer 3) from the Region of the Third Exon as the Sequencing Primer The sequences contained in brackets (Fig. 1, primers 7 and 8) were used to generate (by PCR) a placenta-specific probe for subsequent studies.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 22 November 2015. at 05:54 For personal use only. No other uses without permission. . All rights reserved.
479
Placental GRH
co O Q.
i2 c Q.
•c =
2
Q.
2
co CD
O)
c
x:
28s 18s 750 nt [c,-c2] PRIMERS
Fig. 4. Top, Northern Blot of Total RNA (5 ^g) from Various Mouse Tissues Hybridized with an 84-Nucleotide [32P]Mouse Placenta-Specific (Exon 1) cDNA Probe (Fig. 1, Primers 7 and 8). Bottom, Methylene Blue Staining of 28S and 18S Ribosomal RNA Demonstrating Similarity of the Quantity of RNA in Each Lane.
Fig. 4, there was a single signal from placental RNA that was similar in size to those obtained with hypothalamus-specific, common, and full-length probes (Fig. 2), indicating that this sequence is contained in mouse placental GRH cDNA. GRH mRNA containing the placental first exon was not seen in any of the other tissues examined. In a separate experiment no signal was observed in hypothalamic RNA, even after a much longer exposure (data not shown). The integrity of the RNA in these samples was confirmed by methylene blue staining of the ribosomal RNA bands (32). In an attempt to demonstrate expression of the placenta-specific sequence by a more sensitive technique, we amplified GRH cDNA derived from placental, hypothalamic, and liver total RNA using a common sequence antisense primer (Fig. 1, primer 2) together with a placental (Fig. 1, primer 8), hypothalamic (Fig. 1, primer 6), or common (Fig. 1, primer 4) sense primer (Fig. 5). PCR products of the expected size were generated from both hypothalamic and placental templates using the two common primers. When the hypothalamic sense primer was used, a strong amplification signal was seen with the hypothalamic template and a barely detectable signal with the placental template. Substitution of the placental sense primer resulted in the generation of a strong signal from the placental template and a weaker signal from the hypothalamic tem-
Fig. 5. Ethidium Bromide-Stained Gel of PCR Amplification Products from Mouse Hypothalamic (H), Placental (P), and Liver (L) cDNA Templates Using an Antisense Primer from the Fourth Exon Region That Is Common to Both Hypothalamic and Placental cDNA (c2; Fig. 1, Primer 2) and Common (Ci; Fig. 1, Primer 4), Hypothalamus-Specific (h; Fig. 1, Primer 6), or Placenta-Specific (p; Fig. 1, Primer 8) Sense Primers MW, Molecular size markers from Haelll-digested 0X174 DNA.
plate. No amplification signal was seen with any of the primers when the liver template was used. Thus, although small amounts of placenta-specific mRNA are present in the hypothalamus and vice versa, they constitute a very small percentage of the total GRH mRNA in each tissue. Since PCR amplification is not truly quantitative, the relative hybridization signals on Northern blotting (Figs. 2 and 4) provide a more accurate reflection of the abundance of each type of mRNA in the individual tissues. Amplification and Sequencing of GRH cDNA 5' end from Dwarf and Lewis Rat Placenta To demonstrate that the above difference in placental and hypothalamic GRH mRNA was not limited to the mouse and to permit studies in a species with a GHdeficient genetic strain that was more fertile and readily available than the GH-deficient mouse strains, we amplified and sequenced the 5' end of rat placental GRH cDNA. Poly(A)+ RNA from dwarf {dw/dw) and Lewis (control) rat placenta was reverse transcribed with an antisense primer (5'-CACAGAGGAAGGAGAAG-3') from the fifth exon of the rat hypothalamic GRH cDNA sequence (25). Amplification and sequencing were performed as described for the mouse, except for the antisense primers used for the first amplification (5'TTGTTCCTGGTTCCTCT-3'; fourth exon) and the second amplification and sequencing (5'-TGGTGAAGATGGCGTCT-3'; third exon). The 5' end of the cDNA sequence (169 nucleotides) was determined and found
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 22 November 2015. at 05:54 For personal use only. No other uses without permission. . All rights reserved.
MOL ENDO-1991 480
Vol 5 No. 4
to be identical in dwarf and Lewis (control) rats. As shown in Fig. 6, the sequence corresponding to the first exon consisted of 84 nucleotides, the same length as in the mouse. The sequence homology with mouse placental first exon is 81 %, slightly less than the corresponding homology (90%) between the species in the hypothalamic first exon (7, 25). As in the mouse, the rat placental and hypothalamic first exons were completely dissimilar. The next 85-nucleotide sequence, in both dwarf and control rats corresponding to the second exon, is identical to the reported rat hypothalamic sequence, except for a single additional C at position 8 of the second exon. The same additional nucleotide is present in both placental and hypothalamic mouse GRH cDNA sequences.
lation of GRH gene expression on the basis of both structural and physiological studies. In both the mouse and the rat, the 5' untranslated end of placental GRH cDNA has been shown to have a unique sequence from that of hypothalamic GRH cDNA, indicating differences in the site of initiation of transcription and, therefore, in regulation. Measurement of hypothalamic and placental GRH mRNA levels in a genetic model of isolated GH deficiency, the dwarf rat, has revealed, in addition, discordant regulation of GRH mRNA, with marked elevations in hypothalamic GRH mRNA levels in both male and female GH-deficient rats, but no significant difference in placental GRH mRNA between GH-deficient and control pregnant rats. Several previous studies of other releasing hormones in the hypothalamus and placenta have suggested such differences, although only on the basis of either physiological or structural evidence. Glucocorticoids suppress CRH gene expression in the hypothalamus, but increase CRH secretion by the placenta (19-21). No data are yet available, however, concerning sequence differences in CRH mRNA in the two tissues. Studies of GnRH mRNA sequence have revealed that different transcription initiation sites are used in the hypothalamus and placenta, although the precise placental start site is still uncertain, and there are yet no data concerning differential regulation of GnRH mRNA levels (22, 23). The impetus for the present studies arose from the differences in the reported 5' untranslated end of the sequences of mouse hypothalamic (7) and placental (24) GRH cDNA. In the course of determining the tissue specificity of each sequence, we recognized that the reported placental 5' sequence was incorrect and may represent a cloning artifact. The significance of the reported sequence, which does not exhibit homology with any Genbank DNA entry, remains to be determined. The corrected placental 5' sequence is not very different in size from that of the hypothalamic 5' sequence (84 vs. 71 nucleotides, respectively), which is consistent with the size similarity of mouse placental and hypothalamic mRNA observed on Northern blotting (Refs. 7 and 24 and present results). Although PCR amplification revealed both mRNAs to be present in hypothalamus and placenta, quantitative estimates
Hypothalamic and Placental GRH mRNA Levels in Pregnant and Nonpregnant Dwarf and Control Rats Hypothalamic and placental mRNA levels were determined by Northern blotting, using a rat GRH cDNA probe containing only a region common to both hypothalamus and placenta (exons 3-5). In the hypothalamus, GRH mRNA levels in dwarf rats were increased 3.6-fold above control levels in females (P < 0.01) and 1.8-fold in males (P < 0.01; Fig. 7). In addition, GRH mRNA levels were greater in males than in females in control (P < 0.05) animals. Pituitary GH mRNA levels in dwarf female rats were also markedly reduced (2% of controls; P < 0.01; data not shown). In pregnant dwarf rats (16 days gestation), hypothalamic GRH mRNA levels were also markedly greater than in control rats (P < 0.01; Fig. 8). No effect of pregnancy was observed on hypothalamic GRH mRNA levels in either dwarf or control rats. In contrast, GRH mRNA levels in the placenta of dwarf and control animals were indistinguishable from one another, indicating differential regulation of GRH mRNA in placenta compared to hypothalamus.
DISCUSSION The present results provide evidence in support of differences between hypothalamic and placental regu-
10
RAT
20
A
G. . . C . . .A
60
MOUSE
40
50
ACTGGTGCTCCAGGTCAGCTTTCCTGGTTGCAGATCTCTCCTGGTCAAGG
MOUSE
RAT
30
G
70
TGC. .
80
CTCCCAGCTCGCCTGGATCCCACAACTGCACAGT T
AT. C. . C
AT
A
Fig. 6. Sequence of Rat Placental GRH cDNA First Exon, as Determined by Direct Sequencing of PCR-Generated Single Stranded cDNA Using an Antisense Oligonucleotide from Rat Hypothalamic GRH Exon 3 as the Sequencing Primer (see Results for Details) Differences between the sequences of rat and mouse first exons are indicated.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 22 November 2015. at 05:54 For personal use only. No other uses without permission. . All rights reserved.
Placental GRH
481
MALE FEMALE L Dw L Dw
300
100
Lewis male (5)
Dwarf male (5)
Lewis female (5)
Dwarf female (5)
Fig. 7. Comparison of Rat Hypothalamic GRH mRNA Levels (20% of Single Hypothalamus) in 2-Month-Old Male and Female Dwarf (dw) and Control (Lewis) Rats Northern hybridization signals are from tissues of representative individual animals. The bars represent the mean ± SE, as determined by densitometric analyses. The number of observations in each group is in parentheses. *, P < 0.05; **, Pul 1 x TE. Thirty cycles (94 C, 40 sec; 48 C, 1 min; 72 C, 30 min) of asymmetric PCR (31) were performed in 100 n\ PCR cocktail, which contained 100 ng purified DNA as template, the nested adapter primer, and 5 U Taq polymerase. The concentrations of the other components were the same as described above. Excess nucleotides and primers were removed from the PCR products by three rounds of Centricon 30 centrifugation. One fifth of the recovered DNA was sequenced with the T7 Sequencing Kit (Pharmacia) and the GRH-specific antisense primer (Fig. 1, primer 3) used for the second nested round of amplification described above (1.5 pmol), using the manufacturer's recommendations.
Acknowledgments We thank Drs. Kelly Mayo and John Baxter for providing the rat GRH and GH cDNA clones, respectively.
Received November 8,1990. Revision received January 8, 1991. Accepted January 15,1991. Address requests for reprints to: Lawrence A. Frohman, M.D., Division of Endocrinology and Metabolism, University of Cincinnati College of Medicine, 231 Bethesda Avenue, Cincinnati, Ohio 45267-0547. This work was supported in part by USPHS Grant DK30667. * Special Fellow of the Leukemia Society of America.
Synthesis and Labeling of Probes
REFERENCES Short-length cDNA probes consisting of common (Fig. 1, primers 1 and 4), hypothalamus-specific (Fig. 1, primers 5 and 6), and placenta-specific (Fig. 1, primers 7 and 8) mouse GRH sequences were generated from total mouse RNA, using PCR as described above, and purified from 2% agarose gels. The cDNA probe corresponding to the specific region of the published mouse placental GRH sequence was generated from mouse placental poly(A)+ RNA, using primers (Fig. 1, primers B and D) based on that sequence (24). The probe, in 4 /J 1 x TE, was boiled for 3 min and quenched on ice. A mixture of 10 mM dithiothreitol, 2.5 mM each of dATP, dGTP, and dTTP, 450 mM HEPES (pH 6.6), 50 mM MgCI2 in 4 rf, 6 fi\ [32P]dCTP (60 /xCi; ICN, Irvine, CA), 5 n\ Klenow enzyme (10 U; Boehringer
1. Frohman LA, Jansson J-0 1986 Growth hormone-releasing hormone. Endocr Rev 7:223-253 2. Gomez-Pan A, Rodriguez-Amao MD 1983 Somatostatin and growth hormone releasing factor: synthesis, location, metabolism and function. Clin Endocrinol Metab 12:469507 3. Mayo KE 1989 Structure and expression of growth hormone-releasing hormone (GHRH) genes. In: Muller EE, Cocchi D, Locatelli V (eds) Advances in Growth Hormone and Growth Factor Research. Springer-Verlag, New York, pp 217-230
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 22 November 2015. at 05:54 For personal use only. No other uses without permission. . All rights reserved.
Vol 5 No. 4
MOL ENDO-1991 484
4. Chomczynski P, Downs TR, Frohman LA 1988 Feedback regulation of growth hormone releasing hormone gene expression by growth hormone in rat hypothalamus. Mol Endocrinol 2:236-241 5. DeGennaro Colonna V, Cattaneo E, Cocchi D, Muller EE, Maggi A 1988 Growth hormone regulation of growth hormone-releasing hormone gene expression. Peptides 9:985-988 6. Downs TR, Chomczynski P, Frohman LA 1990 Effects of thyroid hormone deficiency and replacement on rat hypothalamic growth hormone (GH)-releasing hormone gene expression in vivo are mediated by GH. Mol Endocrinol 4:402-408 7. Frohman MA, Downs TR, Chomczynski P, Frohman LA 1989 Cloning and characterization of mouse growth hormone-releasing hormone (GRH) cDNA: increased GRH mRNA levels in the growth hormone deficient lit/lit mouse. Mol Endocrinol 3:1529-1536 8. Bloch B, Brazeau P, Ling N, Bohlen P, Esch F, Wehrenberg WB, Benoit R, Bloom F, Guillemin R 1983 Immunohistochemical detection of growth hormone releasing factor in brain. Nature 301:607-608 9. Bruhn TO, Mason RT, Vale WW1985 Presence of growth hormone-releasing factor-like immunoreactivity in rat duodenum. Endocrinology 117:1710-1712 10. Frohman LA, Szabo M, Berelowitz M, Stachura ME 1980 Partial purification and characterization of a peptide with growth hormone-releasing activity from extrapituitary tumors in patients with acromegaly. J Clin Invest 65:43-54 11. Baird A, Wehrenberg WB, Bohlen P, Ling N 1985 Immunoreactive and biologically active growth hormone-releasing factor in the rat placenta. Endocrinology 117:1598— 1601 12. Meigan G, Sasaki A, Yoshinaga K 1988 Immunoreactive growth hormone-releasing hormone in rat placenta. Endocrinology 123:1098-1102 13. Tan L, Rousseau P 1982 The chemical identity of the immunoreactive LHRH-like peptide biosynthesized in the human placenta. Life Sci 3:327-337 14. Sasaki A, Tempst P, Liotta AS, Margioris AN, Hood LE, Kent SBH, Sato S, Shinkawa O, Yoshinaga K, Krieger DT 1988 Isolation and characterization of a corticotropinreleasing hormone-like peptide from human placenta. J Clin Endocrinol Metab 67:768-773 15. Petraglia F, Calza L, Giardino L, Sutton S, Marrama P, Rivier J, Genazzani AR, Vale W 1989 Identification of immunoreactive neuropeptide-gamma in human placenta: localization, secretion, and binding sites. Endocrinology 124:2016-2022 16. Rosenfeld MG, Mermod JJ, Amara SG, Swanson LW, Sawchenko PE, Rivier J, Vale WW, Evans RM 1983 Production of a novel neuropeptide encoded by the calcitonin gene via tissue-specific RNA processing. Nature 304:129-135 17. Lowe Jr WL, Roberts Jr CT, Lasky SR, LeRoith D 1987 Differential expression of alternative 5' untranslated regions in mRNAs encoding rat insulin-like growth factor I. Proc Natl Acad Sci USA 84:8946-8950 18. Kilpatrick DL, Zinn SA, Fitzgerald M, Higuchi H, Sabol SL, Meyerhardt J 1990 Transcription of the rat and mouse proenkephalin genes is initiated at distinct sites in spermatogenic and somatic cells. Mol Cell Biol 10:3717-3726 19. Robinson BG, Emanuel RL, Frim DM, Majzoub JA 1988 Glucocorticoid stimulates expression of corticotropin-releasing hormone gene in human placenta. Proc Natl Acad Sci USA 85:5244-5248 20. Jones SA, Brooks AN, Challis JRG 1989 Steroids modu-
21.
22.
23.
24.
25.
26.
27.
28.
29.
30. 31.
32.
33.
34.
35.
36.
37.
late corticotropin-releasing hormone production in human fetal membranes and placenta. J Clin Endocrinol Metab 68:825-830 Jingami H, Matsukura S, Numa S, Imura H 1985 Effects of adrenalectomy and dexamethasone administration on the level of prepro-corticotropin-releasing factor messenger ribonucleic acid (mRNA) in the hypothalamus and adrenocorticotropin//3-lipotropin precursor mRNA in the pituitary in rats. Endocrinology 117:1314-1320 Seeburg PH, Adelman JP 1984 Characterization of cDNA for precursor of human luteinizing hormone releasing hormone. Nature 311:666-668 Radovick S, Wondisford FE, Nakayama Y, Yamada M, Cutler Jr GB, Weintraub BD 1990 Isolation and characterization of the human gonadotropin-releasing hormone gene in the hypothalamus and placenta. Mol Endocrinol 4:476-480 Suhr ST, Rahal JO, Mayo KE 1989 Mouse growth hormone-releasing hormone: precursor structure and expression in brain and placenta. Mol Endocrinol 3:1693-1700 Mayo KE, Cerelli GM, Rosenfeld MG, Evans RM 1985 Characterization of cDNA and genomic clones encoding the precursor to rat hypothalamic growth hormone-releasing factor. Nature 314:464-467 Jansson J-O, Downs TR, Beamer WG, Frohman LA 1986 Receptor-associated resistance to growth hormone-releasing hormone in growth hormone deficient dwarf "little" mice. Science 232:511-512 Charlton HM, Clark RG, Robinson ICAF, Goff AEP, Cox BS, Bugnon C, Bloch BA 1988 Growth hormone-deficient dwarfism in the rat: a new mutation. J Endocrinol 119:51 58 Downs TR, Frohman LA, Evidence for a defect in growth hormone (GH)-releasing hormone (GRH) signal transduction in the dwarf (dw/dw) rat pituitary. 72nd Annual Meeting of The Endocrine Society, Atlanta GA, 1990, p 154 (Abstract) Frohman MA, Dush MK, Martin GR 1988 Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci USA 85:8998-9002 Frohman MA, Martin GR 1989 Rapid amplification of cDNA ends using nested primers. Technique 1:165-170 Gyllensten UB, Erlich HA 1988 Generation of singlestranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus. Proc Natl Acad Sci USA 85:7652-7656 Sambrook J, Fritsch EE, Maniatis T 1989 Molecular Cloning-A Laboratory Manual, ed 2. Cold Spring Harbor Laboratory, Cold Spring Harbor Young RA, Hagenbuchle O, Schibler U 1981 A single mouse a-amylase gene specifies two different tissuespecific mRNAs. Cell 23:451-458 Cheng TC, Beamer WG, Phillips III JA, Bartke A, Mallonee RL, Dowling AC 1983 Etiology of growth hormone deficiency in little, Ames and Snell dwarf mice. Endocrinology 113:1669-1678 Carlsson L, Eden S, Jansson J-0 1990 The plasma pattern of growth hormone in conscious rats during late pregnancy. J Endocrinol 124:191-198 Katakami H, Downs TR, Frohman LA 1986 Decreased hypothalamic growth hormone-releasing hormone content and pituitary responsiveness in hypothyroidism. J Clin Invest 77:1704-1711 Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenolchloroform extraction. Anal Biochem 162:156-159
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 22 November 2015. at 05:54 For personal use only. No other uses without permission. . All rights reserved.
