Tissue-engineered nerve constructs under a microgravity system for peripheral nerve regeneration.

Page 1 of 39

Tissue Engineering Part A Tissue-engineered nerve constructs under a microgravity system for peripheral nerve regeneration (doi: 10.1089/ten.TEA.2013.0565) This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof.

1 Tissue-engineered nerve constructs under a microgravity system for peripheral nerve regeneration Hailang Luo1,3,*, Bin Zhu1,4,*, Yongjie Zhang1,2,3, Yan Jin1,2 1. Research and Development Center for Tissue Engineering, Fourth Military Medical University, Xi’an, Shaanxi, 710032, China. 2. Department of Oral Histology and Pathology, School of Stomatology, Fourth Military Medical University, Xi’an, Shaanxi, 710032, China. 3. Engineering technology center for tissue engineering of Xi'an, Shaanxi, 710032, China. 4. Department of Implantation, School of Stomatology, Fourth Military Medical University, Xi’an, Shaanxi, 710032, China

*These authors contributed equally to this paper.

Corresponding author: Prof. Yan Jin and Yongjie Zhang Add.: Research and Development Center for Tissue Engineering, School of Stomatology, Fourth Military Medical University, Xi’an 710032, China Tel.: +86 029 8477 6471 Fax: +86 029 8321 8039 E-mail address: [email protected] (Yan J), [email protected] (Yongjie Z)

Page 2 of 39


2 Abstract Mesenchymal stem cells (MSCs) seeded in a 3D scaffold often present characteristics of low proliferation and migration, which affect the microstructure of tissue-engineered nerves (TENs) and impair the therapeutic effects of nerve defects. By promoting MSC differentiation and mass/nutrient transport, rotary cell culture systems (RCCSs) display potential for advancing the construction of MSC-based TENs. Thus, in this study, we attempted to construct a TEN composed of adipose-derived mesenchymal stem cells (ADSCs) and acellular nerve graft (ANG) utilizing a RCCS. Compared to TENs prepared in a static 3D approach, MTT and cell count results displayed an increased number of ADSCs for TENs in a RCCS. The similarity in cell cycle states and high rates of apoptosis in the static 3D culture demonstrated that the higher proliferation in the RCCS was not due to microgravity regulation but was a result of preferential mass/nutrient transport. Quantitative PCR and ELISA indicated that the RCCS promoted the expression of ADSC neural differentiation-associated genes compared to the static 3D culture. Furthermore, this difference was eliminated by adding the Notch1 signaling pathway inhibitor DAPT to the 3D static culture. TEM, axon immunostaining, and retrograde labeling analysis after sciatic nerve transplantation indicated that the TENs prepared in the RCCS exhibited more regenerative characteristics for repairing peripheral nerves than those prepared in a static 3D approach. Therefore, these findings suggest that the RCCS can modulate the construction, morphology, and function of engineered nerves as a promising alternative for nerve regeneration.

Page 3 of 39


3 Introduction In contrast to the central nervous system, adult mammalian peripheral nerves are capable of regenerating and regaining gradual functional restoration after lesion1. Various surgical approaches have been developed to repair peripheral nerve injury2. End-to-end nerve suture repair is the preferred option for nerve gaps of a few millimeters. However, in cases where tension-free suture repair is not possible, a nerve bridge is required to reconnect the two nerve stumps3. Although autologous transplantation is considered the “gold standard” for the treatment of peripheral nerve defects, morbidity, neuroma formation in the donor region, and potential infections are common side effects. Furthermore, an appropriate size and rapid availability of the graft material are necessary to optimize and simplify the reconstruction procedure4. Therefore, various therapeutic strategies for the functional restoration of truncated nerves are under investigation. As an alternative to autologous nerve grafts, acellular peripheral nerves have been employed with promising results. Biologic scaffolds composed of acellular extracellular matrix (ECM) are commonly used for a variety of reconstructive surgical applications and have been increasingly used in regenerative medicine strategies for tissue and organ replacement5. Furthermore, due to the preservation of native ultrastructure and composition of natural tissues or organs, acellular ECM is considered as a potential scaffold for tissue-engineering construction, i.e., in blood vessels6, the dermis7, the heart8, and the liver9. In peripheral nerves, many studies have reported that acellular nerve grafts are biocompatible and can provide a

Page 4 of 39


4 microarchitecture that is inherently native to axons10. Animal experiments have provided excellent outcomes in sciatic nerve11, cavernous nerve12, and spinal cord13 injuries using acellular nerve grafts. As acellular nerve graft products, Axongen and Shenqiao, which have both been approved by the Food and Drug Administration (FDA) and the China FDA, have further demonstrated the efficacy of such nerve grafts in supporting axon regeneration. Although they have shown potential in regenerating injured peripheral nerves, acellular nerve grafts ideally require more functionalization to support axonal regeneration. Schwann cells, which are important for successful axonal regeneration, have been identified during the spontaneously occurring axon regeneration response after axonotmesis injury14. Early investigations of lesioned glossopharyngeal and hypoglossal nerves of the frog revealed the phenomena of Wallerian degeneration and the subsequent steps in regeneration, including the longitudinal alignment of Schwann cells (SCs) termed “bands of Büngner”15. Although SC therapy is an attractive option for nerve injury, its application is limited due to additional morbidity at the donor sites. Recently, mesenchymal stem cells (MSCs) that possess multi-potent differentiation properties have been used to replace Schwann cells as ideal seed cells in tissue-engineered nerves (TENs)16,17. In previous studies, we constructed a TEN using MSCs and an acellular nerve graft and successfully repaired sciatic nerve defects in SD rat and dog models, which presented stronger therapeutic effects than acellular nerve graft transplantation alone, similar to Schwann cell-based grafts18. Although MSCs have been considered as an alternative for Schwann cells in

Page 5 of 39


5 repairing peripheral nerve injury, we found that the distribution and viability of MSCs in acellular nerve grafts were impaired due to limited mass transport in 3D static culture conditions. The rotary cell culture system (RCCS), which has been recommended by NASA as an effective tool for simulating microgravity, produces a laminar flow to minimize mechanical stress on cell aggregates and provides adequate mass transport, oxygenation, and support for 3D tissue-like growth19. Several previous studies have reported that RCCSs can enhance MSC proliferation and multi-potent differentiation in 3D scaffolds20,21. Furthermore, one study indicated that simulated microgravity can enhance the differentiation of MSCs into neurons22. The aim of this study was to construct TENs composed of MSCs and ANG in RCCS culture conditions. To evaluate the efficacy of TENs in a RCCS, we compared the cell viability, apoptosis, cycle, and distribution to those of TENs prepared in a static culture. At the same time, we observed the effect of microgravity on MSC neural differentiation. We also examined whether the Notch 1 signaling pathway plays an important regulatory role in MSC differentiation in the RCCS. Finally, we evaluated the regenerative ability of TENs in a RCCS using a SD rat sciatic nerve defect model.

Page 6 of 39


6 Materials and methods Construction of tissue-engineered nerves The protocols used in ANG preparation and autogenous SD rat adipose-derived mesenchymal stem cells (rADSCs) culture were based on our previous studies18. The construction of TENs is described in a previous report. For induction of glial cell differentiation, cells were harvested from the growth flasks by trypsinization with 0.25% trypsin-EDTA and seeded into a 6-well plate spreading with sterilizing slide. When the cells reached 80% confluence, the culture medium was replaced by neuronal induction medium containing a-MEM with butylated hydroxyanisole (BHA, 200 mM final concentration), KCl (5 mM), valproic acid (2 mM), forskolin (10 mM), hydrocortisone (1 mM) and insulin (5 g/ml). After 1 day, the induction medium was replaced by DMEM containing 10% (v/v) FBS and 5 mM FSK, 10 ng/mL recombinant human basic fibroblast growth factor (bFGF), 5 ng/mL recombinant human platelet-derived growth factor (PDGF) and cultured for 3 days, then the cells were collected. Then, glial-differentiated rADSCs were harvested and mixed with 8 mg/mL collagen gel (pH = 6.5, viscosity =850 mpa.s ) at a concentration of 1 × 107 cells/ml at 4°C, and 0.2 ml of the suspension was introduced with a sample micro-injector into both stumps of the prepared ANG under a dissecting microscope. Filled tubes were then allowed to coagulate at 37°C for 1 h. The nerve graft seeding cells were cultured in a RCCS with α-MEM supplemented with 10% FBS for 7 days at 37°C and 5% carbon dioxide (CO2). Nerve graft containing ADSCs were placed into disposable 4 mL RCCS cassettes with a rotation speed of 25 rpm for 4 days.

Page 7 of 39


7 Fresh medium was supplemented daily. TENs prepared under static culture conditions were utilized as a control group. The RCCS used in this study is the NASA-designed high-aspect-ratio vessel bioreactor, which is a non-perfused, horizontally rotating bioreactor for low-shear suspension culture of cells and tissues in a fluid environment. In the rotating vessels, the constructs were freely suspended in the annular space between an outer 5.75-cm-diameter polycarbonate cylinder and an inner 2-cm-diameter hollow cylinder covered with a 175-μm-thick silicone membrane; gas (5% CO2 in air) was pumped through the inner cylinder at 0.7-1.2 L/min and was exchanged by diffusion through the silicone membrane. The vessel rotates around a horizontal axis, with the vessel wall and medium rotating at the same speed, producing a vector-averaged gravity environment that simulates microgravity. The rotation speed of the vessel was adjusted throughout the period of cultivation to balance the forces acting on the growing constructs (i.e., gravity, buoyancy, centrifugal, and drag forces) to maintain each settling construct at a relatively steady position within the vessel. Analysis of ADSC number, viability, cell cycle, apoptosis, and distribution of tissue-engineered nerves To evaluate the number of ADSCs inoculated in ANG, TENs prepared in a RCCS and under static conditions were digested in 1,000U/ml collagenase for 60 min. After centrifugation for 10min at 450 rcf, the supernatant and floating ANG debris were removed. Following a resuspension in 1 ml of PBS, the ADSCs were counted by cell count analysis. At the same time, we collected cells incubated with Annexin-V-FITC

Page 8 of 39


8 and PI in the dark for 15 min. Then, an apoptosis analysis was performed with a FACScan flow cytometer. After 7 days of culture in the RCCS or under static conditions, we moved the nerve grafts into T-6 flasks; 4 ml of α-MEM supplemented with 10% FBS and 800 mg/ml MTT was sufficient to completely cover the nerve grafts. After 3 h of culture at 37°C and 5% CO2, 4ml of DMSO was used to substitute the α-MEM. Then, the culture disk containing the mixtures of nerve grafts and DMSO was shaken for 15 min in the dark. The absorbance was detected by spectrophotometry at a wavelength of 490 nm. To evaluate the difference in cell cycle of ADSCs in the RCCS, 2D static, and 3D static conditions, we collected ADSC supernatant from nerve grafts prepared under the RCCS and 3D static conditions as described previously. ADSCs cultured in 2D static conditions were harvested by 0.25% trypsin treatment for 2 min. Following cessation of the bovine serum reaction, centrifugation at 450 rcf was used to collect the ADSCs, and the supernatant was discarded. After a resuspension in PBS, ADSCs derived from the three groups were subjected to a cell cycle analysis using flow cytometry. For a histological analysis, the nerve grafts were immediately fixed with 4% phosphate-buffered formalin overnight at 4°C. The fixed grafts were then covered with paraffin, and 5-μm sections were cut using a cryotome and collected on coated slides. After dewaxing, the sections were prepared for histopathological analysis using Hoechst33342 staining. Quantitative PCR analysis

Page 9 of 39


9 After7 days of culture, mRNA expression in association with cytokines and the ECM was detected using quantitative real-time PCR. The employed protocols were based on previous reports18. Briefly, the nerve graft was soaked in 1.5 ml of Trizol to dissolve the ADSCs. After adding a 0.3 volume of ethanol and shaking sufficiently, the tubes containing the mixture were centrifuged at 12,000 g for 10 min to separate the RNA that had been dissolved in water. One volume of cold isopropanol was mixed with the separated water to deposit the RNA. After centrifugation at 12,000 g, the supernatant was discarded, and the RNA pellet was washed in 70% ethanol. RNA dissolved in ddH2O2 was used as a template for a reverse transcription reaction using Superscript II RNase H-reverse transcriptase. Neural induction of ADSCs cultured under 2D static conditions was performed according to our previous report. The protocols utilized in the RNA isolation were the same as those used for the nerve graft. Real-time PCR was performed using an ABI Prism 7000 detection system (Applied Biosystems, US). Each reaction was performed in a 20-ml volume containing 50 ng of cDNA, 10 ml of SYBR Green PCR Master Mix, and 150 nM of each PCR primer. All reactions were repeated four times. The mRNA levels were normalized to those of the rat housekeeping gene β-actin. Oligonucleotide primers for real-time PCR were obtained

from

TaKaRa,

including

primers

for

S100

(forward:

GCCCTCATTGATGTCTTCC, reverse: TCCTTTAGTTTCTCGTCCTTC), GFAP (forward:

GGGAGTCGGCGAGTTACCA,

reverse:

CACCGTCT

TTACCACGATGTTC), P75 (forward: CCTCATTCCTGTCTATTGCTCCAT, reverse: TTCCTCACCTCCTCACGCTTG),

Nestin

(forward:

Page 10 of 39


10 AAGTTCCAGCTGGCTGTGGAAGCC,

reverse:

CGTCCAGGTGTCTGCAACCGA), TGGTTCAGGGCGGTGCTCA, Jagged1

(forward:

reverse:

Notch1

(forward:

GCAGACACTGCTTCCCAAAAGG),

CCACAAAGGGCACGGCGAGTG,

reverse:

TGCATGGGGTTTTTGATTTGG) and Hes5 (forward: GTGGCGGTGGAGATGCT, reverse:

CGAAGGCTTTGCTGTGCT).

Glutamate

(forward:

GGACACAGTTGATTATTC, reverse: CAGGTTATCTGCAATGTT) Experiments were replicated five times for each sample. Notch signaling pathway inhibition To observe the effect of the Notch signaling pathway on the neural differentiation of ADSCs seeded in a scaffold, DAPT, a NICD inhibitor, was used to inhibit the Notch pathway of ADSCs cultured in a static 3D ANG. The inhibitor concentration was 10ng/ml. The Notch-inhibited TEN was then compared to those cultured in the RCCS. ELISA analysis ELISA was performed to evaluate the content of secreted growth factors. ELISA plates were coated with monoclonal capture antibodies and were blocked with bovine serum albumin (1 w/v%) and sucrose (5 w/v%) for 1 h. Bound NGF (R&D Systems, USA), GDNF (Shanghaiyihan, China), IGF (R&D Systems, USA), and TGFβ1 (R&D Systems, USA) were detected using biotin-conjugated anti-rat NGF, GDNF, IGF, and TGFβ1 antibodies. Streptavidin-conjugated horseradish peroxidasewas added to the plates, and an enzyme substrate (tetramethylbenzidine and peroxide) was added and

Page 11 of 39


11 allowed to react for 20 min. The reaction was quenched by adding an acidic solution, and the absorbance was read at 450 nm using a PowerWave X340 plate reader (BioTEK Instruments, USA). The experiments were performed for five replicates of each sample. Surgery Three-month old SD rats were anesthetized with methoxyflurane, and the surgical site was shaved and sterilized by 70% ethanol three times. A skin incision was then made along the femoral axis, and the thigh muscles were separated. Using microscissors, the sciatic nerve of twelve rats was transected, and a 1-cm nerve segment was removed. In twelve rats, both stumps of the sciatic nerve gap were bridged using 1cm nerve grafts prepared in the RCCS with 10-0 nylon monofilament. Other twelve rats were performed same surgical procedure using 1 cm nerve graft prepared under static condition. The muscles were then reapposed with 4-0 vicryl sutures, and the skin incision was clamped shut with wound clips. After the surgery, the rats were placed under a warm light, allowed to recover from anesthesia, and then housed separately with access to food and water in a colony room maintained at a constant temperature (19-22°C) and humidity (40-50%) with a 12:12-h light/dark cycle. Histological analysis For a histological analysis of nerve regeneration, twelve surgery rats (six was RCCS group, six were static group) were sacrificed to perform TEM and neurofilament immunostaining analysis at 3 months post-transplantation. The

Page 12 of 39


12 protocols were performed as previously described18. Gold fluorescence tracing Beside axon and myelin regeneration evaluation, twelve surgical SD rats (six was RCCS group, six were static group) were used to conduct gold fluorescence retrograde tracing. Gold fluorescence solution (0.2 ml) was injected into the sciatic nerve trunk 10 mm from the distal end of the nervous scaffold, followed by suture of the incisions. After being kept routinely for 6 days, the rats were perfused sequentially with saline and 4% (v/v) paraformaldehyde in 0.1 M phosphate buffer (pH 7.2) at the left ventricle. The vertebral canal was opened before the lumbar spinal cord was exposed. L4 and L5 were then excised. The procured tissues were post-fixed in buffered 4% paraformaldehyde overnight at 4°C, submerged in a graded sucrose series of 10%, 20%, and 30%, and then cut using a cryostat (40-μm-thick transverse sections for spinal cords). The sections were mounted onto glass slides and were washed two times with deionized water. Finally, the slides were viewed under a fluorescence microscope. Statistical analysis Analysis was performed using the Statistical Program for Social Science (SPSS) 13.0 for Windows. Experiments were replicated five times for each sample in this study. Using one-way ANOVA followed by a Tukey HSD posttest comparison, data (mean ± s.d.) were considered to be statistically signiﬁcant when p-value was p < 0.05.

Tissue Engineering Part A Tissue-engineered nerve constructs under a microgravity system for peripheral nerve regeneration (doi: 10.1089/ten.TEA.2013.0565) This article has been peer-reviewed and accepted for publication, but has yet to undergo copyediting and proof correction. The final published version may differ from this proof. Page 13 of 39

13

Page 14 of 39


14 Results Viability and distribution analysis of tissue-engineered nerves prepared in the RCCS After 7 days of culture, tissue-engineered peripheral nerves composed of ANG and ADSCs were digested with collagenase to collect and count the ADSCs. The results indicated that the number of ADSCs in the RCCS group was 2.1-fold higher than that of the static group (Fig. 1A). MTT was also used to compare the ADSC viability between the RCCS group and static group. The absorbance value in the RCCS group was 2.7-fold higher than that of the static group (Fig. 1B). We further detected the cell cycle in the three groups to observe whether the microgravity directly activated ADSC proliferation. The results indicated that the percentage of S phase in the RCCS group (23.5% ± 4.4%, Fig. 1H) was higher than that of the 3D static group (19.5% ± 7.6%, Fig. 1G) but lower than that of the 2D static group (31.3 ± 8.5%, Fig. 1I). The results demonstrated that microgravity was unable to directly activate ADSC proliferation. The larger number of ADSCs compared to the 3D static group may lead to higher nutrient and mass transport in the RCCS group. To evaluate this possibility, we compared the apoptosis rate of ADSCs in the RCCS and static 3D groups. We found that the ADSC survival rate in the RCCS (55.3% ± 11.3%, Fig. 1C), was significantly higher than that of the 3D static group (21.6% ± 7.4%, Fig. 1D). The results support the viewpoint that the RCCS maintains a relatively high proliferation rate through a higher nutrient transport rather than by stimulating ADSC division. In addition to its effect on viability and apoptosis, preferential nutrient transport is also beneficial for cell migration and distribution in a 3D scaffold. Thus, the TENs constructed with

Page 15 of 39


15 ANG and ADSCs were subjected to Hoechst33342 histological analysis. We found that the ADSCs were evenly distributed throughout the entire graft when cultured in the RCCS. However, the ADSC distribution was irregular in the static culture group; for example, some regions of the ANG graft exhibited cell aggregation, whereas other regions had no cells at all (Figs. 1E, 1F). Neural differentiation analysis of tissue-engineered nerves prepared in a RCCS Previous studies have shown that ADSCs can potentially differentiate into glial cells by renetic acid23 or β- mercaptoethanol induction24,25. To determine whether microgravity was capable of promoting neural differentiation in a RCCS, we detected and compared neural differentiation-associated genes, such as S100, GFAP, P75, and Nestin, in the RCCS, 2D static, and 3D static groups. Quantitative PCR indicated that the expression of S100 and GFAP in the RCCS was evidently higher than in the 3D static group, but Nestin and P75 were not significantly different (Fig. 2A-2D). The expression of S100, Nestin, glutamate, and P75 in the 2D static group was lower than in the RCCS and 3D static groups (Fig. 2A-2D). We further assayed the secretion of neurotrophic growth factors, which play an important role in maintaining neural functions and repairing nerve injury. ELISA results indicated that NGF and GDNF in the RCCS culture medium, at 1,320 ± 367 and 887 ± 115 pg/ml, were more highly expressed than in the 3D static culture medium, at 864 ± 166 and 556 ± 211 pg/ml, or the 2D static culture medium, at 650 ± 143 and 213 ± 83 pg/ml. The paracrine of IGF and TGFβ1 was also more highly expressed in the RCCS group, at 645 ± 112 and 450 ± 105 pg/ml, than in the 2D static group, at 230 ± 54 and 189 ± 23 pg/ml, and the 3D

Page 16 of 39


16 static group, at 244 ±79 and 135 ±43 pg/ml (Fig. 3A-3D). Notch 1 as an important mediator for promoting the neural differentiation of ADSCs in a RCCS According to previous studies, Notch 1 expression in murine oval liver stem cells is down-regulated by microgravity26. Therefore, in this study, we examined whether Notch 1 plays an important role as a mediator for promoting ADSC differentiation under RCCS culture conditions. The expression of Notch1, Jagged1, and Hes5 in the RCCS group was lower by 4.2-, 4.4-, and 2.9-fold, respectively, compared to the 3D static group (Fig. 4A-4C). However, differences were not observed between the 2D and 3D static cultures. After inhibiting the Notch 1 signaling of ADSCs in the 3D static group, we compared the expression of neural differentiation-associated genes with that of the RCCS group. The results indicated that the Notch-inhibited ADSCs in the 3D static culture up-regulated S100, GFAP, P75, glutamate, and Nestin expressions to a level that was not significantly different from that of the RCCS culture conditions (Fig. 4D-4G). Evaluation of nerve regeneration Our previous study showed that 1 cm sciatic nerve defect was repaired by tissue engineered nerve composed of ANG and ADSCs at 3 months post-surgery. Thus 3 months after transplantation, in this study, axon immunostaining was performed to detect peripheral axon regeneration18. The results indicated that the axon had crossed the middle site of the nerve graft in both groups. However, the analysis indicated that the number of positively stained axons in the static group was lower than that of the

Page 17 of 39


17 RCCS group at 3 months post-transplantation (Figs. 5A, 5B, 5E, 5F, 6A). TEM analysis also showed the number of regenerated myelinated axon in RCCS group was higher than that of the static group, but the area of the regenerated axon was not difference between groups (Figs. 5C, 5G, 6B). At 3 months post-transplantation, we injected 0.5 ml of fluorescent gold into the sciatic nerve distal site. After 7 days, the SD rats were sacrificed and examined for retrograde neuron staining of the L5 segment of the spinal cord to determine whether the axonal regeneration resulted in anatomical reconnection of the transected nerve. The motoneuron cell bodies with fluorescent gold displayed gold in the ipsilateral anterior horn of grey matter on the surgery side under confocal fluorescent microscopy in both groups. However, the number of positivelystained neuronsin the static group was lower than in the RCCS group (Figs. 5D, 5H, 6C).

Page 18 of 39


18 Discussion In the clinic, complete restoration of the physiological function of severe peripheral nerve defects is rarely achieved simply by the treatment of hollow tubes2. One must closely imitate the native regenerating nerve to improve the performance of nerve conduits and to ensure a substantially better recovery after transplantation18. To accomplish this aim, in previous studies, we constructed a tissue-engineered peripheral nerve composed of ANG and ADSCs, which imitate the natural peripheral nerve regenerative characteristics18,27. Although we were successful in repairing long sciatic nerve defects in SD rat and dog models, the irregular distribution of the ADSCs in the scaffold may impair the treatment effects due to the limited nutrient diffusion in 3D structures. The RCCS, which has been recommended by NASA as an effective tool for simulating microgravity, produces laminar flow to minimize mechanical stress on cell aggregates and provides adequate mass transport, oxygenation, and support for 3D tissue growth28,29. Thus, in this study, we constructed a TEN composed of ANG and ADSCs in a RCCS. In vitro, the number of proliferated ADSCs was evidently higher in the RCCS group than in the static group, and the distribution of ADSCs in ANG was more uniform in the RCCS group. The ADSCs exhibited more neural differentiation under microgravity conditions, and this process was controlled by down-regulating the Notch 1 signaling pathway. In vivo, the results of sciatic nerve repair indicated that the TEN prepared in the RCCS possessed more peripheral nerve regenerative capacity than that produced under static culture conditions.

Page 19 of 39


19 The tissue engineering of complex tissues consisting of large 3D structures remains a critical challenge. The amount of oxygen required for cell survival is limited to a diffusion distance of approximately 150-200 mm from the supplying blood vessel30. Specifically, due to their poor nutrient/metabolite mass transport, 3D static culture systems result in concentration gradients with cell growth and tissue formation that are typically confined to the surface of the scaffold31. In vitro, 3D tissue-engineered complexes face more limitations due to a lack of chemotaxis to promote seed cell migration toward regions far from the surface of the scaffold. Thus, the micro-porous structure of ANG is difficult to recellularize in tissue engineering, even though this microstructure is the same as the natural peripheral nerve structure. By providing a more controlled culture environment with enhanced mass transport, RCCSs have been utilized for 3D culture in scaffolds or micro-carriers for the formation of cartilage and bone in vitro20,28. However, the construction of TENs in RCCSs remains unexplored. Our study has shown that compared to static culture conditions, the ADSC distribution was more regular and the cell numbers in the middle regions did not differ from those near the surface. This result demonstrates that the RCCS was capable of achieving a uniform ADSC distribution in ANG by enhancing nutrient and mass transport. In recent years, MSCs have been used as an alternative to Schwann cells in constructing TENs32,33. The therapeutic effect of MSC nerves occurs through axon prolongation induction and neurotrophic factor paracrine32. Therefore, sufficient cell numbers and viability are essential prerequisites to restore injured nerve function.

Page 20 of 39


20 However, our previous studies demonstrated that in vitro, ADSCs seeded in ANG lost most of their proliferation capacity when cultivated in a static 3D culture. Therefore, we investigated the behavior of ADSCs after inoculation in ANG for 7 days with a RCCS. Although a previous study demonstrated that microgravity may inhibit MSC proliferation34, our results indicated that the number of ADSCs was significantly higher in the RCCS group compared to the 3D static culture group. To determine whether microgravity directly regulated the ADSC proliferation, we compared the cell cycle for the RCCS, 3D static, and 2D static groups. In contrast to ADSC proliferation, there is no evident difference in the cell cycle between the RCCS and 3D static groups. When compared with the 2D static group, the percentage of S phase was evidently lower in the RCCS group. These results demonstrate that microgravity does not promote ADSC proliferation. The larger number of ADSCs in the RCCS group resulted from the improved nutrient and mass transport in that group. The lower survival rate observed for the 3D static group compared to the RCCS group also supports this finding. Previous studies have demonstrated that microgravity can enhance the osteogenic differentiation of MSCs20,35. Thus, we examined whether neural differentiation of ADSCs was enhanced in the RCCS. We found that neural differentiation-associated genes were more highly expressed in the 3D static group than in the 2D static group. These results demonstrate that ANG itself has the capacity to induce BMSC differentiation, similar to phenomena identified in cartilage-, tendon-, and liver-specific ECM25,36. Previous studies have reported that tissue-specific ECM can

Page 21 of 39


21 retain its natural tissue microstructure and components, which can play important roles in promoting tissue-specific differentiation37. However, when compared to the RCCS group, the levels of neural differentiation-associated genes, such as S100 and GFAP, were significantly lower in the 3D static group. Considering that the percentage of S phase in the RCCS group was slightly higher compared to the 3D static culture, we suggest that microgravity can directly regulate the neural differentiation of ADSCs. We also found that IGF, NGF, GDNF, and TGFβ1, critical factors in peripheral nerve development and regeneration, were more highly expressed in the RCCS group than in the 2D or 3D static groups. These results further demonstrate that the increased neural differentiation in the RCCS was not dependent on high cell viability due to preferential mass and nutrient transport but was directly regulated by microgravity through the ADSC signaling pathway. Notch is a critical signaling pathway that plays an important role in regulating glial and neuron differentiation38. A recent analysis indicated that Notch signaling is involved in regulating the differentiation of MSCs39. The expression of Notch 1, Jagged1, and Hes5 is decreased in MSCs in the neural differentiation process. This result suggests that the Notch signaling pathway may negatively regulate the neural differentiation of MSCs. Previous studies have reported that Notch 1 expression in murine oval liver stem cells is down-regulated by microgravity26. Similar to this result, Notch 1 was also down-regulated in ADSCs when cultured under microgravity. Because the expression of Notch 1 was not significantly different between the 2D and 3D static groups, the Notch 1 down-regulation was not a result of the 3D culture

Page 22 of 39


22 condition but was due to the microgravity. Further NICD inhibition impaired the neural differentiation of ADSCs and resulted in identical differentiation levels in the RCCS and 3D static culture. These results suggest that the Notch signaling pathway mediates the microgravity effect on neural differentiation. In order to improve the performance of nerve grafts and ensure a substantially better recovery after transplantation it is essential to more provide peripheral nerve regenerative chareacteristics. Schwann cells which differentiate myelin in the intact nerve, play a pivotal role during axonal regeneration. Following lesion-induced Wallerian degeneration, Schwann cells start to proliferate, forming longitudinal cell strands termed bands of Bungner40. Compared to static group, our results showed that ADSCs cultured in the RCCS maintained a higher proliferation and more regular distribution in ANG. Furthermore, ADSCs in RCCS group were more potential to glial-differentiation. Thus we supposed that TEN prepared in RCCS was more capable of repairing peripheral nerve defect than those prepared in a static 3D approach. So, in vivo, SD rat sciatic nerve repair was employed as an animal model to compare the therapeutic effects of TENs prepared in the RCCS and static groups. Although it has been reported that 10-mm sciatic nerve defects can be repaired by various types of nerve grafts4,18, this system allowed us to evaluate the regenerative capacity. After 3 months, the grafts of both groups retained their integrity and exhibited no difference based on a general observation. The results suggest that both grafts had good biocompatibility and avoided degradation due to the host response. However, TEM, retrograde tracing, and immunostaining of the axons demonstrated that the TEN

Page 23 of 39


23 prepared in the RCCS possessed more nerve-regenerative features, inducing axon prolongation and injured peripheral nerve reconstruction. These results demonstrate that the RCCS is a suitable approach for ADSCs and acellular extracellular matrix-based tissue-engineering construction and has potential as a valuable tissue-engineering approach for the preparation of transplantable peripheral nerve grafts.

Page 24 of 39


24 Conclusion In this study, we employed a RCCS to construct a TEN composed of ANG and ADSCs under simulated microgravity. Compared with a 3D static culture, the ADSCs maintained a higher proliferation and more regular distribution in ANG when cultured in the RCCS. This behavior did not result from microgravity stimulation but from adequate oxygenation and mass transport. However, microgravity was able to promote the neural differentiation of ADSCs by down-regulating the Notch signaling pathway. The results observed for sciatic nerve transplantation demonstrate that the RCCS provides TENs more regenerative characteristics, thus promoting defective nerve regeneration.


25

Acknowledgments

This study was supported by the funding support from National High Technology

Research and Development Program of China (2012AA020507) and from Nature

Science Foundation of China (31000444 and 81071265).

Page 26 of 39


26 Reference 1. Belkas, J.S., Shoichet, M.S., Midha, R. Peripheral nerve regeneration through guidance tubes. Neurol Res 26, 151, 2004. 2. Bellamkonda, R.V., Peripheral nerve regeneration: an opinion on channels, scaffolds and anisotropy. Biomaterials 27, 3515, 2006. 3. Kandenwein, J.A., Kretschmer, T., Engelhardt, M., Richter, H.P., Antoniadis, G. Surgical interventions for traumatic lesions of the brachial plexus: a retrospective study of 134 cases. J Neurosurg 103, 614, 2005. 4. Alluin, O., Wittmann, C., Marqueste, T., Chabas, J.F., Garcia, S., Lavaut, M.N., Guinard, D., Feron, F., Decherchi P. Functional recovery after peripheral nerve injury and implantation of a collagen guide. Biomaterials 30, 363, 2009. 5. Crapo, P.M., Gilbert, T.W., Badylak, S.F. An overview of tissue and whole organ decellularization processes. Biomaterials 32, 3233, 2011. 6. Funamoto, S., Nam, K., Kimura, T., Murakoshi, A., Hashimoto, Y., Niwaya, K., Kitamura, S., Fujisato, T., Kishida, A. The use of high-hydrostatic pressure treatment to decellularize blood vessels. Biomaterials 31, 3590, 2010. 7. Chen, R.N., Ho, H.O., Tsai, Y.T., Sheu, M.T. Process development of an acellular dermal matrix (ADM) for biomedical applications. Biomaterials 25, 2679, 2004. 8. Ott, H.C., Matthiesen, T.S., Goh, S.K., Black, L.D., Kren, S.M., Netoff, T.I., Taylor, D.A. Perfusion-decellularized matrix: using nature's platform to engineer a bioartificial heart. Nat Med 14, 213, 2008. 9. Uygun, B.E., Soto-Gutierrez, A., Yagi, H., Izamis, M.L., Guzzardi, M.A.,

Page 27 of 39


27 Shulman, C., Milwid, J., Kobayashi, N., Tilles, A., Berthiaume, F., Hertl, M., Nahmias, Y., Yarmush, M.L., Uygun, K. Organ reengineering through development of a transplantable recellularized liver graft using decellularized liver matrix. Nat Med 16, 814, 2010. 10. Hudson, T.W., Zawko. S., Deister, C., Lundy, S., Hu, C.Y., Lee, K., Schmidt, C.E. Optimized acellular nerve graft is immunologically tolerated and supports regeneration. Tissue Eng 10, 1641, 2004. 11. Neubauer, D., Graham, J.B., Muir, D. Chondroitinase treatment increases the effective length of acellular nerve grafts. Exp Neurol 207, 163, 2007. 12. Connolly. S.S., Yoo, J.J., Abouheba, M., Soker, S., McDougal, W.S., Atala, A. Cavernous nerve regeneration using acellular nerve grafts. World J Urol 26, 333, 2008. 13. Li, C., Zhang, X., Cao, R., Yu, B., Liang, H., Zhou, M., Li, D., Wang, Y., Liu, E. Allografts of the acellular sciatic nerve and brain-derived neurotrophic factor repair spinal cord injury in adult rats. PLoS One 7, 42813, 2012. 14. Woodhoo, A., Sommer, L., Development of the Schwann cell lineage: from the neural crest to the myelinated nerve. Glia 56, 1481, 2008. 15. Navarro, X., Vivó, M., Valero-Cabré, A. Neural plasticity after peripheral nerve injury and regeneration. Prog Neurobiol 82, 163, 2007. 16. Keilhoff, G., Goihl, A., Stang, F., Wolf, G., Fansa, H. Peripheral nerve tissue engineering: autologous Schwann cells vs. transdifferentiated mesenchymal stem cells. Tissue Eng 12, 1451, 2006.

Page 28 of 39


28 17. Ladak, A., Olson, J., Tredget, E.E., Gordon, T. Differentiation of mesenchymal stem cells to support peripheral nerve regeneration in a rat model. Exp Neurol 228, 242, 2011. 18. Zhang, Y., Luo, H., Zhang, Z., Lu, Y., Huang, X., Yang, L., Xu, J., Yang, W., Fan, X., Du, B., Gao, P., Hu, G., Jin, Y. A nerve graft constructed with xenogeneic acellular nerve matrix and autologous adipose-derived mesenchymal stem cells. Biomaterials 31, 5312, 2010. 19. Cummings, L.J., Waters, S.L. Tissue growth in a rotating bioreactor. Part II: fluid flow and nutrient transport problems. Math Med Biol 24, 169, 2007. 20. Yu, B., Yu, D., Cao, L., Zhao, X., Long, T., Liu, G., Tang, T., Zhu, Z. Simulated microgravity using a rotary cell culture system promotes chondrogenesis of human adipose-derived mesenchymal stem cells via the p38 MAPK pathway. Biochem Biophys Res Commun 414, 412, 2011. 21. Shimony, N., Avrahami, I., Gorodetsky, R., Elkin, G., Tzukert, K., Zangi, L., Levdansky, L., Krasny, L., Haviv, Y.S. A 3D rotary renal and mesenchymal stem cell culture model unveils cell death mechanisms induced by matrix deficiency and low shear stress. Nephrol Dial Transplant 23, 2071, 2008. 22. Chen, J., Liu, R., Yang, Y., Li, J., Zhang, X., Li, J., Wang, Z., Ma, J. The simulated microgravity enhances the differentiation of mesenchymal stem cells into neurons. Neurosci Lett 505, 171, 2011. 23. Safford, K.M., Safford, S.D., Gimble, J.M., Shetty, A.K., Rice, H.E. Characterization of neuronal/glial differentiation of murine adipose-derived adult

Page 29 of 39


29 stromal cells. Exp Neurol 187, 319, 2004. 24. Kingham, P.J., Kalbermatten, D.F., Mahay, D., Armstrong, S.J., Wiberg, M., Terenghi, G. Adipose-derived stem cells differentiate into a Schwann cell phenotype and promote neurite outgrowth in vitro. Exp Neurol 207, 267, 2007. 25. Dezawa, M., Takahashi, I., Esaki, M., Takano, M., Sawada, H. Sciatic nerve regeneration in rats induced by transplantation of in vitro differentiated bone-marrow stromal cells. Eur J Neurosci 14, 1771, 2001. 26. Majumder, S., Siamwala, J.H., Srinivasan, S., Sinha, S., Sridhara, S.R., Soundararajan, G., Seerapu, H.R., Chatterjee, S. Simulated microgravity promoted differentiation of bipotential murine oval liver stem cells by modulating BMP4/Notch1 signaling. J Cell Biochem 112, 1898, 2011. 27. Luo, H., Zhang, Y., Zhang, Z., Jin, Y. The protection of MSCs from apoptosis in nerve regeneration by TGFβ1 through reducing inflammation and promoting VEGF-dependent angiogenesis. Biomaterials 33, 4277, 2012. 28. Hwang, Y.S., Cho, J., Tay, F., Heng, J.Y., Ho, R., Kazarian, S.G., Williams, D.R., Boccaccini, A.R., Polak, J.M., Mantalaris, A. The use of murine embryonic stem cells, alginate encapsulation, and rotary microgravity bioreactor in bone tissue engineering. Biomaterials 30, 499, 2009. 29. Lei, X.H., Ning, L.N., Cao, Y.J., Liu, S., Zhang, S.B., Qiu, Z.F., Hu, H.M., Zhang, H.S., Liu, S., Duan, E.K. NASA-approved rotary bioreactor enhances proliferation of human epidermal stem cells and supports formation of 3D epidermis-like structure. PLoS One 6, 26603, 2011.

Page 30 of 39


30 30. Hendrickx, B., Vranckx, J.J., Luttun, A. Cell-based vascularization strategies for skin tissue engineering. Tissue Eng Part B Rev 17, 13, 2011. 31. Lovett, M., Lee, K., Edwards, A., Kaplan, D.L. Vascularization strategies for tissue engineering. Tissue Eng Part B Rev 15, 353, 2009. 32. Ribeiro-Resende, V.T., Pimentel-Coelho, P.M., Mesentier-Louro, .LA., Mendez, R.M., Mello-Silva, J.P., Cabral-da-Silva, M.C., de Mello, F.G., de Melo Reis, R.A., Mendez-Otero, R. Trophic activity derived from bone marrow mononuclear cells increases peripheral nerve regeneration by acting on both neuronal and glial cell populations. Neuroscience 17, 540, 2009. 33. Hu, J., Zhu, Q.T., Liu, X.L., Xu, Y.B., Zhu, J.K. Repair of extended peripheral nerve lesions in rhesus monkeys using acellular allogenic nerve grafts implanted with autologous mesenchymal stem cells. Exp Neurol 204, 658, 2007. 34. Dai, Z.Q., Wang, R., Ling, S.K., Wan, Y.M., Li, Y.H. Simulated microgravity inhibits the proliferation and osteogenesis of rat bone marrow mesenchymal stem cells. Cell Prolif 40, 671, 2007. 35. Wu, X., Li, S.H., Lou, L.M., Chen, Z.R. The effect of the microgravity rotating culture system on the chondrogenic differentiation of bone marrow mesenchymal stem cells. Mol Biotechnol 54, 331, 2013. 36. Wang, Q., Zheng, Y.P., Wang, X.Y., Huang, Y.P., Liu, M.Q., Wang, S.Z., Zhang, Z.K., Guo, X. Ultrasound evaluation of site-specific effect of simulated microgravity on articular cartilage. Ultrasound Med Biol 36, 1089, 2010. 37. Mecham, R.P., Madaras, J.G., Senior, R.M. Extracellular matrix-specific

Page 31 of 39


31 induction of elastogenic differentiation and maintenance of phenotypic stability in bovine ligament fibroblasts. J Cell Biol. 98, 1804, 1984. 38. Gaiano, N., Fishell, G. The role of notch in promoting glial and neural stem cell fates. Annu Rev Neurosci 25, 471, 2002. 39. Yanjie, J., Jiping, S., Yan, Z., Xiaofeng, Z., Boai, Z., Yajun, L. Effects of Notch-1 signalling pathway on differentiation of marrow mesenchymal stem cells into neurons in vitro. Neuroreport 18, 1443, 2007. 40. Ribeiro-Resende, V.T., Koenig, B., Nichterwitz, S., Oberhoffner, S., Schlosshauer, B. Strategies for inducing the formation of bands of Büngner in peripheral nerve regeneration. Biomaterials 30, 5251, 2009.

Legends Fig.1 Analysis of cell numbers in the scaffold for the RCCS and 3D static culture (A). Comparison of cell viability between the RCCS and 3D static culture by MTT. Cell survival analysis by flow cytometry. C denotes the RCCS group, and D denotes the 3D static group. ADSCs were stained by hoechst33342 to observe the Cell distribution in the ANG for the RCCS (E) and 3D static culture (F). Cell cycle analysis by flow cytometry. G, H, and I represent the 3D static group, RCCS group, and 2D static group, respectively. *p < 0.05.

Fig.2 Quantitative PCR analysis of neural differentiation-associated gene expression, S100 (A), Nestin (B), P75 (C), GFAP (D), and Glutamate (E). Experiments were

Page 32 of 39


32 replicated five times for each sample. *p < 0.05.

Fig.3 ELISA analysis of neural trophic factor secretion by ADSCs for the 2D static, 3D static, and RCCS groups. A, B, C, and D represent NGF, GDNF, IGF, and TGFβ1, respectively. Experiments were replicated five times for each sample. *p < 0.05.

Fig.4 Quantitative PCR analysis of the Notch signaling pathway. The gene expression of Notch1 (A), Jagged1(B), and Hes5 (C) was detected for the 3D static, 2D static, and RCCS groups. After inhibiting the Notch pathway of ADSCs in TENs prepared in a 3D static culture, the levels of neural differentiation-associated genes, such as Glutamate (D), S100 (E), Nestin (F), P75 (G), and GFAP (H), were compared with those for the RCCS. Experiments were replicated five times for each sample. *p < 0.05.

Fig.5 Evaluation of sciatic nerve regeneration for TENs prepared under the RCCS and 3D

static

culture

conditions.

Axon

regeneration

was

evaluated

by

neurofilament immunostaining. Brown staining represented regenerated axon. A and B were 3D static cultured TEN group, C and D were RCCS cultured TEN group. Myelin sheath regeneration was observed by TEM analysis (C, G). Fluorescence gold retrograde labeling analysis to evaluate axon regeneration at 90 days after surgery. Red arrows denote regenerated axons (D, H).

Page 33 of 39


33 Fig.6 Quantitative evaluation of regenerated axon, myelin sheaths, and fluorescence gold labeled neuron. The number of regenerated axon in RCCS group was significant higher than in static group (A). However, the area of regenerated myelin sheaths was not significant difference between 2 groups (B). Fluorescence gold labeling neuron showed that the fluorescence stained neuron in RCCS group was evidently higher than in static group (C). Experiments were replicated three times for each sample. *p < 0.05.


Page 34 of 39

34


35


Page 36 of 39

36


37


Page 38 of 39

38


39

Tissue engineered constructs for peripheral nerve surgery.

Peripheral nerve regeneration.

Advances in peripheral nerve regeneration.

Enhancement of peripheral nerve regeneration.

Abstract 9: selectively permeable nanofiber constructs to prevent inflammatory scarring and enhance nerve regeneration in peripheral nerve injury.

Biologic strategies to improve nerve regeneration after peripheral nerve repair.

A novel electrospun nerve conduit enhanced by carbon nanotubes for peripheral nerve regeneration.

Peripheral nerve regeneration in experimental diabetes.

The potential roles for adipose tissue in peripheral nerve regeneration.

Aligned bacterial PHBV nanofibrous conduit for peripheral nerve regeneration.

Regeneration microelectrode array for peripheral nerve recording and stimulation.

Decellularized grafts with axially aligned channels for peripheral nerve regeneration.

3D-engineering of Cellularized Conduits for Peripheral Nerve Regeneration.

Development of multifunctional films for peripheral nerve regeneration.

Proliferative effects of melatonin on Schwann cells: implication for nerve regeneration following peripheral nerve injury.

Cyclic AMP signaling: a molecular determinant of peripheral nerve regeneration.

collagen receptor acts in peripheral nerve regeneration.

Nerve conduits for peripheral nerve surgery.

Peripheral Nerve Regeneration Strategies: Electrically Stimulating Polymer Based Nerve Growth Conduits.

Peripheral nerve regeneration inside collagen-based artificial nerve guides in humans.

Peripheral nerve regeneration following transection injury to rat sciatic nerve by local application of adrenocorticotropic hormone.

Autophagy Promotes Peripheral Nerve Regeneration and Motor Recovery Following Sciatic Nerve Crush Injury in Rats.

Improved peripheral nerve regeneration with sustained release nerve growth factor microspheres in small gap tubulization.

Role of lumbricus extract in the nerve amplification effect during peripheral nerve regeneration.