Biochem. J. (2014) 459, 565–576 (Printed in Great Britain)

565

doi:10.1042/BJ20131119

Soo Youn LEE*†, Jung Mi KIM*†, Soo Young CHO‡§, Hyun Suk KIM*†, Hee Sun SHIN*†, Jeong Yong JEON*†, Rukhsana KAUSAR*†, Seon Yong JEONG, Young Seek LEE¶ and Myung Ae LEE*†1 *Department of Brain Science, Ajou University School of Medicine, Suwon, Korea †Neuroscience Graduate Program, Department of Biomedical Sciences, Graduate School of Ajou University, Suwon, Korea ‡Mammalian Genetics Unit, Medical Research Council Harwell, Harwell, Oxfordshire OX11 0RD, U.K. §Laboratory of Developmental Biology and Genomics, College of Veterinary Medicine, and Interdisciplinary Program for Bioinformatics, Program for Cancer Biology and BIO-MAX Institute, Seoul National University, Seoul, Korea Department of Medical Genetics, Ajou University School of Medicine, Suwon, Korea ¶Division of Molecular Life Science, Hanyang University, Ansan, Korea

We recently reported that hNSCs (human neural stem cells) have the interesting characteristic of migration towards an intracranial glioma. However, the molecules and mechanisms responsible for tumour tropism are unclear. In the present study, we used microarray and proteomics analyses to identify a novel chemoattractant molecule, TIMP-1 (tissue inhibitor of metalloproteinase-1), secreted from human brain tumour tissues. We demonstrate that TIMP-1 significantly enhances hNSC adhesion and migration in a cell culture system. These effects were critically dependent on CD63, as shRNA-mediated ablation of CD63 expression attenuated the response. TIMP1 significantly increased the number of FAs (focal adhesions) and cytoskeletal reorganization for cell migration in hNSCs, whereas knockdown of CD63 resulted in decreased hNSC

spreading, FAs and migration, even after TIMP-1 treatment. In addition, TIMP-1 binding to CD63 activated β1 integrinmediated signalling through Akt and FAK phosphorylation, leading to pattern changes in distribution of vinculin and F-actin (filamentous actin). Furthermore, inactivation of β1 integrin by use of a blocking antibody or inhibition of PI3K (phosphoinositide 3-kinase) signalling impaired the migration of hNSCs towards TIMP-1. Collectively, our results underline TIMP-1 as a novel and effective key regulator of CD63 and β1 integrin-mediated signalling, which regulates hNSC adhesion and migration.

INTRODUCTION

growth factor α), are recognized as potent gliomatropic agents for NSCs [20]. However, none of these factors were significantly overexpressed in human brain glioma tissues in our microarray and proteomics analyses. Therefore we concluded that other molecules are responsible for these activities in glioma. In the present study, we mined the microarray and proteomics data of human brain tumour tissues and identified TIMP-1 (tissue inhibitor of metalloproteinase-1), up-regulated more than 2-fold in both data sets, as a promising chemotactic molecule of hNSCs (human NSCs). TIMP-1 is a member of the family of tissue inhibitors of MMPs (matrix metalloproteinases), which regulate the ECM (extracellular matrix) turnover and remodelling by inhibiting MMPs. Additionally, mounting evidence suggests that TIMPs can regulate angiogenesis, cell survival, proliferation and apoptosis, independent of their MMP inhibitory activities, through interactions with cell adhesion molecules or growth factor receptors [21–26]. For example, studies have shown that TIMP-1 interacts with CD63 on the cell surface of the human breast epithelial cell line MCF10A and maintains the activated conformation of β1 integrin (one of the main

One of the cardinal features of NSCs (neural stem cells) is their exceptional migratory ability towards neural pathologies in murine models of CNS (central nervous system) injury [1– 5]. In particular, murine and human NSCs possess an inherent tumour tropism that supports their use as a reliable delivery vehicle to target therapeutic gene products to primary and secondary invasive glioma cells throughout the brain [2,6–10], as well as to other types of solid tumours, including melanoma brain metastases, medulloblastoma and neuroblastoma [11–15]. On the basis of the capacity of NSCs to migrate throughout the brain and to target tumour mass, we hypothesized that tumour cells or cells of the surrounding reactive parenchyma secrete soluble factors responsible for the brain tumour tropism of NSCs. Previously, other groups reported that agents, such as stem cell factor-1, monocyte chemoattractant protein-1 and stromal cell-derived factor-1, are potent chemotactic molecules that stimulate NSC migration [1,16–19]. In addition, growth factors, such as hepatocyte growth factor, vascular endothelial growth factor, epidermal growth factor and TGFα (transforming

Key words: brain tumour, CD63, cell migration, β1 integrin, neural stem cell, tissue inhibitor of metalloproteinase-1 (TIMP-1).

Abbreviations: CNS, central nervous sytem; DMEM, Dulbecco’s modified Eagle’s medium; ECM, extracellular matrix; F-actin, filamentous actin; FA, focal adhesion; FAK, FA kinase; GBM, glioblastoma multiforme; HEK, human embryonic kidney; hMSC, human mesenchymal stem cell; HRP, horseradish peroxidase; mAb, monoclonal antibody; MAPK, mitogen-activated protein kinase; MMP, matrix metalloproteinase; mTOR, mammalian target of rapamycin; NSC, neural stem cell; hNSC, human NSC; pAb, polyclonal antibody; PI3K, phosphoinositide 3-kinase; TIMP-1, tissue inhibitor of metalloproteinase-1. 1 To whom correspondence should be addressed (email [email protected]).  c The Authors Journal compilation  c 2014 Biochemical Society

Biochemical Journal

TIMP-1 modulates chemotaxis of human neural stem cells through CD63 and integrin signalling

www.biochemj.org

ACCELERATED PUBLICATION

566

S. Y. Lee and others

tetraspanin-interacting integrins) in a CD63-dependent manner, resulting in activation of cell survival signalling and inhibition of apoptosis. In addition, Egea et al. [27] reported that TIMP-1 acts as a suppressor of hMSC (human mesenchymal stem cell) growth and osteogenic differentiation through negative modulation of Wnt/β-catenin signalling activity. This effect requires the interaction of TIMP-1 and CD63 on the cell surface, and is independent of MMP-inhibitory activity. Whether the interaction of TIMP-1 and CD63 on the cell surface affects integrin-mediated cytoskeletal reorganization, cell adhesion and/or migration in hNSCs is an important issue that we address in the present study. The present study identifies TIMP-1 as a key molecule that plays a role in hNSC adhesion and migration. We have provided direct evidence that TIMP-1 is an effective regulator of the integrin-mediated signalling pathway that affects hNSC adhesion and migration processes. In particular, we show that TIMP-1 binding to CD63 on the hNSC cell membrane activates β1 integrin, FAK [FA (focal adhesion) kinase] and the PI3K (phosphoinositide 3-kinase) signal transduction pathway. Subsequent changes in FA and cytoskeletal reorganization result in the spreading and migration of hNSCs. Taken together, the present study identifies TIMP-1 as a new chemoattractant molecule of hNSCs, addressing a new paradigm of cell signalling critical for hNSC migration through TIMP-1-mediated modulation of a tetraspanin–integrin complex. In addition, our results provide a promising new molecular pathway mechanism that could be utilized for the future clinical development of an hNSC-based cell-therapeutic strategy for targeting human glioma.

EXPERIMENTAL Cell culture

Immortalized hNSC lines, HB1.F3, HB1.F5 and HB1.A4, were established as described previously [28,29]. These cells lines, as well as the HEK (human embryonic kidney)-293 and NIH 3T3 (mouse fibroblasts cells) lines, were maintained and passaged on uncoated culture dishes in DMEM (Dulbecco’s modified Eagle’s medium; Gibco-BRL Life Sciences) with 10 % FBS (Hyclone), and 10 μg/ml penicillin/streptomycin (Gibco). All cells were incubated at 37 ◦ C with 5 % CO2 .

Reagents and antibodies

The pharmacological PI3K inhibitor LY294002 was purchased from Calbiochem. Recombinant human TIMP-1 was from R&D Systems, and Texas Red-X Phalloidin was from Molecular Probes. We used the following antibodies: mouse mAbs (monoclonal antibodies) against vinculin and β-actin, a rabbit pAb (polyclonal antibody) against TIMP-1 (Millipore), a mouse mAb against TIMP-1 (R&D Systems), a rabbit pAb against CD63 (Abcam), a mouse mAb against human CD63 (Millipore), a mouse mAb against the active form of β1 integrin (HUTS-4; Millipore), a rabbit pAb against β1 integrin (Millipore), antibodies against FAK (BD Biosciences), pSer 473-Akt (Cell Signaling Technology) and pSer2448 -mTOR (mammalian target of rapamycin; Cell Signaling Technology), and a rabbit mAb against pTyr397 -FAK (Invitrogen). For functional studies in the Transwell® assay, we used the following antibody: the functional blocking mAb against the β1 integrin subunit, clone P5D2 (IgG; Chemicon). HRP (horseradish peroxidase)-conjugated secondary antibodies for immunoblotting and FITC-conjugated F(ab )2 -specific secondary antibodies for flow cytometry were purchased from Zymed Laboratories.  c The Authors Journal compilation  c 2014 Biochemical Society

Immunohistochemistry

Tissue was fixed in 4 % paraformaldehyde. Frozen tissue sections (20 μm) were cut on to slides coated with gelatin. Tissue sections were washed twice with PBS. Endogenous peroxidase activity was quenched by incubation with 0.3 % hydrogen peroxide for 5 min. Tissue sections were then permeabilized with 0.2 % Triton X-100 in PBS, and blocked with 5 % BSA for 30 min at room temperature (25 ◦ C). Sections were subsequently incubated with a solution containing a 1:50 dilution of mouse anti-human TIMP-1 mAb (R&D Systems) at 4 ◦ C overnight, followed by washing with PBS. The slides were incubated with a biotinylated anti-mouse IgG secondary antibody, and analysed using the Vectastain® Elite ABC Kit (Vector Laboratories), according to the manufacturer’s instructions. Tissue sections were counterstained with haematoxylin QS (Vector Laboratories).

Boyden chamber chemotaxis assay

Recombinant human TIMP-1 was used in the Boyden chamber chemotaxis assay (R&D Systems). TIMP-1 was diluted in DMEM containing 10 % FBS and added to lower compartments of the Boyden chamber (Neuro Probe). DMEM with 10 % FBS was used as a negative control. The lower-chamber wells were overlaid with a polycarbonate (Costar 3422) porous membrane filter (8 μm). The hNSCs were plated in the wells of the upper compartment at a concentration of 5×104 cells per well, and incubated for 24 h at 37 ◦ C. TIMP-1 was then added to the lower chamber, followed by incubation for an additional 12 h to allow cell migration. The cells adhering to the upper surface were wiped off with a filter wiper. After the filter wipe, the remaining cells were fixed with 4 % paraformaldehyde solution and stained with haematoxylin (Sigma). The cells of four randomly selected fields were counted using an Image Analysis System (Olympus BX51, KYLINK), and were expressed as the average number of migrating cells.

Western blot analysis

Cells were lysed with two types of lysis buffer: RIPA lysis buffer [1 % sodium deoxycholoate, 0.1 % SDS, 20 mM Tris/HCl (pH 7.5), 1 % Triton X-100 and 50 mM NaCl], used for extraction of most proteins; or 1 % Brij 96 lysis buffer [1 % Brij 96, 25 mM Hepes (pH 7.5), 150 mM NaCl, 5 mM MgCl2 , 2 mM PMSF and 1× protease inhibitor cocktail], used to extract CD63. Cell lysates were analysed by immunoblotting. Immunoblot signals were detected using the ECL kit (GE Healthcare), and visualized after exposure to a film.

Immunoprecipitation

Cells were lysed with 1 % Brij 96 lysis buffer. The nuclear fraction was discarded after centrifugation at 13 684 g for 10 min, and supernatants were pre-cleared by incubation with agarose beads conjugated to secondary antibody for 4 h at 4 ◦ C. The pre-cleared lysates were incubated with anti-TIMP-1 (1:1000 dilution) or anti-CD63 antibodies (1:1000 dilution) at 4 ◦ C overnight. Agarose beads with immune complexes were collected by centrifugation at 13 684 g for 10 min, and then washed three times with the immunoprecipitation buffer. Immune complexes were eluted from the beads using 2× SDS sample buffer and subjected to SDS/PAGE (10% gel).

TIMP-1 promotes human neural stem cell migration

Figure 1

567

TIMP-1 is overexpressed in human glioblastoma tissues

(A) Schematic diagram showing the reason for choosing TIMP-1 as a novel chemoattractant molecule secreted by human glioma tissues. Diagram shows the number of genes up-regulated at least 2-fold in microarray and proteomic analyses from GBM tissues compared with matched normal brain tissues. (B) Expression profiles of the TIMP1 gene from the microarray data obtained for three GBM tissues compared with matched normal brain tissues. (C) Proteomics results in brain tumours. Top panel, representative 2D gel showing the spots (circles) identified as TIMP-1, with brain tissues from matched normal brain and a GBM patient. Bottom panel, proteomics results by in-gel digestion, MALDI–TOF-MS for the TIMP-1 hit. (D) Immunohistochemical staining was used to detect TIMP-1 protein expression in human glioblastoma tissues. a–c, normal human brain tissues; d–f, human glioblastoma tissues. Magnification, ×100.

Establishment of CD63-knockdown cell lines

Knockdown of CD63 expression was performed using the short hairpin-activated gene silencing system [30]. The plasmid pREP4, encoding the CD63 shRNA sequence, was expressed under the REP4 promoter (Invitrogen), which allows for long-term suppression of gene expression. This CD63 shRNA has previously demonstrated specific suppression of CD63 gene expression [31]. The DNA sequence encoding the CD63 shRNA was: 5 -GGTCTAGAAAAAAGGACTCGGTCCTTCGACACGGAAGAGACTCAAGCTTCAATCCCTTCCATGTCGAAGAACCGAGTCCGGTGTTTCGTCCTTTCCACAA-3 . At 3 days after transfection with pREP4 constructs, cells were washed and then grown in the presence of 200 μg/ml hygromycin B for 9 days for selection. The cells selected were maintained in DMEM containing 30 μg/ml hygromycin B. Flow cytometry

Cells were incubated with 2 μg/ml anti-CD63 mAb (Abcam, ab8219) in FACS buffer (1× PBS, 2 % FBS and 0.1 % sodium azide) for 1 h, washed with ice-cold PBS and then incubated with saturating concentrations of FITC-conjugated goat antimouse IgG (KPL) for 30 min at room temperature. After washing

with FACS buffer, immunofluorescence of the cell surface was analysed by flow cytometry using a FACScan (Becton Dickinson). Data was analysed by winMDI version 2.9. Immunofluorescent live-cell staining

The cellular localizations of CD63 proteins were examined by immunocytochemistry. HB1.F3 cells (1.25×105 ) were seeded overnight on to coverslips (SPL Life Sciences) coated with polyD-lysine hydrobromide and laminin (Sigma). Coverslips were washed three times with PBS and blocked with PBS containing 10 % normal horse serum (Vector Laboratories) and 1 % BSA (Sigma) for 1 h. Cells were then stained with an anti-CD63 (Chemicon) mAb at a dilution of 1:100 in 1 % BSA for 1 h on ice, followed by three washes with PBS for 5 min. After incubating with FITC-conjugated secondary antibody (Vector Laboratories) at a dilution of 1:350 in 1 % BSA for 1 h, coverslips were washed three times with PBS for 5 min. Cells were fixed with 4 % paraformaldehyde for 15 min. After three more washes with PBS, coverslips were mounted on the slides using mounting medium (Vectashield, Vector Laboratories). Fluorescently labelled samples were visualized with an AX10 Imager M1 microscope (Carl Zeiss) equipped with an AxioCam MRm.  c The Authors Journal compilation  c 2014 Biochemical Society

568

S. Y. Lee and others

Statistical analysis

Results are expressed as means + − S.E.M. for replicate experiments. Statistical analysis was performed using PASW Statistics Version 17.0 (SPSS) by the parametric analysis of variance test, as appropriate. A value of P < 0.05 was considered statistically significant. RESULTS TIMP-1 is overexpressed in human brain tumours

From our previous report showing that hNSCs migrate towards an intracranial glioma [32], we hypothesized that glioma tissues secrete chemoattractant molecules, which attract hNSCs. However, little is known about the factors responsible for hNSC migration. To identify the chemoattractant molecules secreted from glioma tissues, we analysed our previously deposited microarray (GSE30563) and proteomics analyses [33] of GBM (glioblastoma multiforme) tissues, the most aggressive and Grade V human brain tumours, for potential differentially regulated candidates (Figure 1). Although our microarray analyses (GSE30563) from brain tissues of three GBM patients revealed a list of 13 secretory genes that were co-modulated at least 2fold compared with matched normal brain tissues, proteomic analyses from eight GBM tissues showed only four secretory proteins [33] (Figure 1A). Following this, we identified TIMP-1 as the only common factor between both analyses that was upregulated more than 2-fold in brain tumour tissues (Figures 1A– 1C). To confirm this result, we examined TIMP-1 expression in human brain tumour tissues by immunohistochemical analysis (Figure 1D). Positive immunohistochemical staining for TIMP-1 was restricted to tumour cells from GBM patients, whereas it was completely absent in normal brain tissue (Figure 1D). These data confirm that TIMP-1 is significantly up-regulated in human brain GBM tissues compared with normal brain tissues. TIMP-1 specifically increases the migration of hNSCs

As the only candidate identified in our search for factors involved in the regulation of migratory processes in brain tumours, we next examined the migratory potency of TIMP-1 on hNSCs. To this end, we used concentrations ranging from 50 to 500 ng/ml TIMP-1, and measured the corresponding response of hNSCs in a migration assay. As shown in Figures 2(A) and 2(B), the dose–response of HB1.F3 cells to TIMP-1 followed a typical bellshaped curve, which is a characteristic of most chemotactic factors [34]. The stimulatory effects on migration ranged from 1.7- to 2.6fold, with the strongest response at a concentration of 100 ng/ml TIMP-1 (Figures 2A and 2B). These results demonstrate that TIMP-1 can induce hNSC migration. We next examined the celltype specificity of this activity of TIMP-1. Thus we compared the in vitro migratory capacities of the hNSC line HB1.F3 with the mouse fibroblast cell line NIH 3T3 (Figure 2C), and the human embryonic kidney cell line HEK-293 (Figure 2D), in the presence of TIMP-1. Confirming the previous results, TIMP-1 stimulated migration of HB1.F3 cells at a concentration of 100 ng/ml (2.7– 3.7-fold stimulation), but a similar effect on migration was not observed for NIH 3T3 or HEK-293 cells, suggesting that the migratory response to TIMP-1 is hNSC-specific (Figures 2C and 2D). In addition, the baseline migratory activities of both NIH 3T3 and HEK-293 cells were much lower than that of hNSCs. These results are in agreement with our previous studies which showed that, although hNSCs xenografted to the cortex of a rat brain had the remarkable capacity to migrate to the damaged region of the  c The Authors Journal compilation  c 2014 Biochemical Society

Figure 2

TIMP-1 induces hNSC migration

(A) Chemotactic migration of hNSCs was induced by TIMP-1 at various concentrations in Boyden chamber assays. The hNSCs signficantly migrated at a TIMP-1 concentration of 100 ng/ml (top panel). (B) Representative images from the migration assay (A). (C and D) Migration assay in a hNSC-type specific manner. The migratory properties of hNSCs (HB1.F3) were compared with mouse fibroblast cells (NIH 3T3) (C) or HEK-293 cells (D) in the presence of TIMP-1 using the Boyden chamber assay.

brain, NIH 3T3 cells did not migrate and remained localized at the area of the injection site [32]. TIMP-1 stimulation promotes the formation of a CD63–β1 integrin signalling complex at the hNSC plasma membrane

We hypothesized that the specificity of the chemoattractant activity of TIMP-1 on hNSCs may be due to hNSC-specific expression of TIMP-1 receptors. Previous studies have identified CD63, a member of the tetraspanin family, as a TIMP-1interacting cell-surface protein [31]. TIMP-1 stimulation activated β1 integrin on the cell surface in a CD63-dependent manner [31,35]. Therefore we next compared the expression patterns of tetraspanin family members (CD9, CD81 and CD63) and integrins (β1, α3 and α6) by microarray analysis (GSE30563) in three different hNSC lines (Figure 3A). The hNSC lines all showed high expression levels of CD63 and β1 integrin (Figure 3A). However, α integrins could not be detected in hNSCs. We then examined the mRNA and protein levels of CD63 and β1 integrin in hNSCs, NIH 3T3 cells and HEK-293 cells by Western blot analysis using anti-CD63 and anti-(β1 integrin) antibodies (Figure 3B). High levels of CD63 and β1 integrin proteins were detected in hNSCs, but neither could be detected in NIH 3T3 cells. Only β1 integrin protein, but not CD63, was present at a low level in HEK-293

TIMP-1 promotes human neural stem cell migration

Figure 3

569

CD63 forms complexes with TIMP-1 and active β1 integrin in hNSCs

(A) Expression profiles of the tetraspanin superfamily and integrin genes from the microarray data obtained for three hNSC lines, HB1.F3, HB1.A4 and HB1.F5. (B) Expression of CD63 and β1 integrin proteins were analysed in each cell line by Western blotting. (C–E) Interaction of CD63 with TIMP-1 or β1 integrin. (C) Lysates of HB1.F3 cells in the presence of 400 ng/ml recombinant TIMP-1 were immunoprecipitated with an anti-TIMP-1 pAb, followed by immunoblot analysis using an anti-CD63 pAb under reducing conditions. (D) HB1.F3 cell lysates were immunoprecipitated with an anti-CD63 mAb, followed by immunoblotting with an anti-β1 integrin pAb under non-reducing conditions, an anti-TIMP-1 pAb under reducing conditions or an anti-CD63 pAb under reducing conditions respectively. (E) Anti-(active β1 integrin) immunoprecipitates of HB1.F3 cell lysates in the absence ( − T) or presence ( + T) of 400 ng/ml TIMP-1 were analysed by Western blotting with an anti-CD63 pAb under reducing conditions or an anti-(β1 integrin) pAb under non-reducing conditions respectively. IP, immunoprecipitate; WB, Western blot.

cells. These results indicate that the powerful migratory ability of hNSCs in response to TIMP-1 may be due to the high levels of CD63 and β1 integrin found on these cells. Next, we investigated the potential interaction between TIMP-1 and the CD63–β1 integrin complex in hNSCs. We first examined this interaction by immunoprecipitation in HB1.F3 cell lysates. As shown in Figure 3(C), an immunocomplex of CD63 with recombinant TIMP-1 was detected from lysates of HB1.F3 cells. Secondly, we examined CD63 interactions with β1 integrin in the presence of TIMP-1. As shown in Figure 3(D), anti-CD63 antibodies co-immunoprecipitated β1 integrin (Figure 3D, middle panel) and recombinant TIMP-1 (Figure 3D, top panel) from lysates of HB1.F3 cells in the presence of recombinant TIMP1, compared with cells without recombinant TIMP-1. These results suggested that the proteins were forming a complex only in the TIMP-1 treatment. Furthermore, to examine the effect of TIMP-1 on β1 integrin activity and interaction with CD63, we measured the activity of β1 integrins and interaction with CD63 in hNSC cell lysates with or without TIMP-1 stimulation by the immunoprecipitation assay, using HUTS-4, a mAb against active conformations of β1 integrins. TIMP1 treatment not only increased active β1 integrin (Figure 3E, bottom panel), but also significantly boosted interaction with CD63 and β1 integrins (Figure 3E, top panel). Of interest,

although the CD63 protein modified with heavy glycosylations [31] exhibited a diffuse distribution (30–60 kDa) on SDS/PAGE under reducing conditions (Figure 3D, bottom panel), only the highly glycosylated form of CD63 interacted strongly with active β1 integrin (Figure 3E, top panel). Taken together, these results demonstrate a critical role for CD63 in mediating TIMP1 association with the cell surface and activation of integrin β1 signalling to mediate hNSC migration.

TIMP-1–CD63 complexes modulate cell spreading and the rearrangement of the cytoskeleton in hNSCs

Spreading is an essential step of cell motility that occurs in vitro when cells transition from round cells in suspension to polarized cells on matrix substrates, involving FA formation, as well as cytoskeletal reorganization. We took advantage of this phenomenon to evaluate the contribution of TIMP-1–CD63 complexes to FA dynamics. We used a vector-based shRNA strategy to silence the expression of CD63 protein [30]. HB1.F3 cells were stably transfected with the pREP4 vector encoding the CD63-targeting shRNA, leading to the efficient down-regulation of CD63 expression (Figures 4A–4C). These antisense CD63HB1.F3 cells and vector-transduced cells were referred to as  c The Authors Journal compilation  c 2014 Biochemical Society

570

Figure 4

S. Y. Lee and others

CD63 is required for efficient cell spreading

(A) Cell lysates of HB1.F3 clones stably transfected with control vector (P1 and P2) or with shRNA vector targeting CD63 (shCD1 and shCD2) were subjected to immunoblot analysis with an anti-CD63 antibody under non-reducing conditions. The bottom panel shows the tubulin levels of the same blot re-probed with an anti-tubulin antibody. (B) Immunofluorescent live-cell staining for CD63 expression in P1 and shCD1 cells stained with an anti-CD63 antibody/FITC-conjugated secondary antibody. (C) FACS analysis of CD63 expression on the surface of hNSC, P and shCD cells. (D) Time-dependent spreading of P1 and shCD1 cells on laminin-coated culture plates. Cell adhesions were monitored for 24 h after plating with ( + T) or without ( − T) TIMP-1 treatment. Quantification of cell spreading is given as a measurement of cell surface area (perimeter), which was quantified using ImageJ software (mean + − S.E.M.; n = 20). (E) Representative pictures of spreading in P1 or shCD1 monolayers at 0–24 h time points after attachment. **P < 0.001; ***P < 0.0001.

shCD1 or shCD2, and P1 or P2 respectively. P1 and shCD1 cells were plated on laminin-coated coverslips, and the cell perimeter (cell spreading) was quantified over a 24 h time course. As illustrated in Figures 4(D) and 4(E), the cell spreading was significantly diminished in the absence of CD63 after 3 h, with a 48.9 % maximal decrease in the substrate contact area for the shCD1 cells. In addition, control P1 cells were completely spread on the matrix by 3 h, whereas cells lacking CD63 needed more than 6 h to complete spreading (Figures 4D and 4E). Furthermore, cells that had completed their spreading (24 h) on the laminin matrix displayed significant differences in cell surface area in the absence or presence of CD63 (Figures 4D and 4E). These results suggest that CD63 modulates the ability of hNSCs to fully spread  c The Authors Journal compilation  c 2014 Biochemical Society

on laminin, accelerating the completion of spreading. TIMP-1 treatment of P1 cells further increased the cell area in contact with the matrix by approximately 10 % after 3–24 h of attachment, whereas it did not increase the spreading of shCD1 cells at all (Figure 4D). These results suggest that CD63 is required for efficient and rapid spreading on matrix and participates actively during early cell spreading. In contrast with P1 cells, CD63-knockdown cells showed a collapse of cell morphology and inhibition of lamellipodia extension (Figures 4E and 5A). Combining this observation with the accelerated cell spreading of P1 cells, we hypothesized that TIMP-1–CD63 complexes may regulate FA rearrangement in hNSCs. Therefore we characterized cell

TIMP-1 promotes human neural stem cell migration

Figure 5

571

TIMP-1 increases the number of cell FAs and actin cytoskeletal reorganization

(A) Morphology of P1 and shCD1 cells plated on laminin-coated culture dishes and stimulated with ( + T) or without ( − T) 100 ng/ml TIMP-1 for 12–24 h. For immunofluorescence, cells were fixed with 1 % paraformaldehyde and stained for F-actin (phalloidin-TRITC, red) (B) and vinculin (for FAs, green) (C), and observed by confocal microscopy. Arrows indicated FAs. (D) The number of FAs per cell was quantified using MetaMorph software (mean + − S.E.M.; n = 46). Experiments were performed more than three times. ns, not significant. ***P < 0.0001 compared with the control.

FAs in P1 and shCD1 by staining with an anti-vinculin antibody (Figures 5C and 5D, and Supplementary Figure S1 at http://www.biochemj.org/bj/459/bj4590565add.htm). In the control P1 cells (Figure 5C, left-hand panel and Supplementary Figure S1) we observed less than 10 % of the cells with rare punctate signals surrounding the cell periphery. TIMP-1 treatment drastically changed the pattern of vinculin localization in P1 cells such that FAs were present in a polarized pattern of distribution in approximately 50 % of the cells. The number of FAs was quantified, revealing ∼3-fold increase upon TIMP-1 treatment in P1 cells (Figure 5D). In contrast, almost all shCD1 cells showed no signal surrounding the cell periphery, and TIMP-1 treatment of these cells had no effect on the number of positive cells or on the signal intensity (Figures 5C, right-hand panel and 5D). These findings suggest that TIMP-1–CD63 complexes modulate the number and density of adhesive structures on hNSCs. It is also important to note that these additional FAs were associated with a change in cell morphology and cytoskeletal organization. F-actin (filamentous actin) staining with phalloidin-TRITC revealed that, in control P1 cells, numerous straight F-actin stress fibres (typical of static cells) were observed across the cells. However, when cells were stimulated with TIMP-1, these fibres dissociated, resulting in the redistribution of F-actin to membrane ruffles at the cell surface. In addition, TIMP-1 treatment enhanced filopodia and lamellipodia formations with asymmetrical localizations at the leading edges of most cells, which is typical of motile cells (Figure 5B, left-hand panel, and Supplementary Figure S2 at http://www.biochemj.org/bj/459/bj4590565add.htm). Even in the absence of TIMP-1, shCD1 cells had very few stress fibres

distributed in the cytoplasm, and only a small amount of Factins localized to the periphery of these cells (Figure 5B, right-hand panel). Furthermore, TIMP-1 treatment did not cause any cytoskeletal changes in shCD1 cells (Figure 5B, right-hand panel). These results suggest that TIMP-1 causes cytoskeletal reorganization and induces rapid turnover of FAs through interaction with CD63, facilitating cell adhesion and subsequent cell motility on matrix.

CD63 is required for hNSC migration stimulated by TIMP-1

Cell migration is a multi-step process, requiring the dynamic reorganization of the actin cytoskeleton and the rapid turnover of FAs. The results demonstrating a role for CD63 in FA structures and turnover, cell morphology and cell cytoskeletal architecture implicate it to play a role in migration of hNSCs. To directly examine the role of CD63 in TIMP-1-mediated hNSC migration, we performed Boyden chamber assays and measured the migration of HB1.F3, P1, shCD1 and shCD2 cells. We found that CD63 down-regulation significantly reduced hNSC migration by approximately 56 % as compared with controls (186 + − 3.3 cells for HB1.F3, 213 + − 7.6 for P1, 78 + − 3.1 for shCD1 and 87 + − 3.4 for shCD2, P < 0.01; Figure 6A). Representative phasecontrast micrographs, illustrating migration of each cell line, are shown in Figure 6(B). In addition, parental HB1.F3 and P1 cells showed an approximate 2.5-fold increase in migration in response to TIMP-1, whereas the migration pattern of two shCD63 lines, shCD1 and shCD2, was not changed by TIMP-1 (Figure 6). These  c The Authors Journal compilation  c 2014 Biochemical Society

572

S. Y. Lee and others

Figure 6 Down-regulation of CD63 expression causes the loss of hNSC migration induced by TIMP-1 (A) HB1.F3 (F3), P1 and shCD63 (shCD1, shCD2) cells were subjected to a Boyden chamber assay. The numbers of cells that migrated through the membrane were counted after TIMP-1 treatment for 12 h. (B) Representative pictures of migrated cells for each cell line. Magnification, ×100. ns, not significant. ***P < 0.0001 compared with the control.

results indicate that CD63 is a very important mediator of TIMP1-induced migration of hNSCs. TIMP-1 activates the β1 integrin signal transduction pathway to promote hNSC migration

Integrins play an important role in cell migration. To investigate potential mechanisms by which the TIMP-1–CD63 complex modifies cell spreading and motility, we explored its role in the integrin pathway. We first analysed the effect of functional blocking of β1 integrin on hNSC migration using an anti-(β1 integrin) mAb (P5D2), which has been described previously [36] (Figure 7A). P5D2 antibody treatment completely blocked TIMP1-mediated enhancement of hNSC migration. In contrast, TIMP-1 was able to enhance cell migration of hNSCs in the presence of the control IgG1 antibody (Figure 7A). These results indicate that TIMP-1 regulates hNSC migration through an β1 integrin pathway. FAK is autophosphorylated at Tyr397 upon integrin activation [37]. This autophosphorylation causes a cascade of phosphorylation events that are important for integrin-mediated cell migration [38,39]. To assess the ability of TIMP-1 to modulate the phosphorylation of FAK protein, we treated hNSCs with TIMP-1 for 30 min, and performed immunoblot analysis using phospho-specific antibodies (pTyr397 ) (Figure 7B). Although TIMP-1 treatment caused a significant increase in phosphorylation of FAK in P1 cells (2.6 + − 0.2-fold increase as compared with the basal level), relatively little change at the  c The Authors Journal compilation  c 2014 Biochemical Society

Tyr397 site was observed in shCD1 cells (1.54 + − 0.06-fold increase as compared with the basal level). Moreover, high expression of FAK, as well as multiple phosphorylations at many sites, including at Tyr397 , were observed in P1 cells, even without TIMP1 treatment (Figure 7B). In contrast, reduced expression of FAK (54.7 + − 0.08 % for shCD1 − 3.3 % for untreated shCD1 and 49.5 + treated with TIMP-1 as compared with untreated P1) was observed in shCD1 cells (Figure 7B). These data show that activation of β1 integrin by TIMP-1–CD63 regulates the expression level and the phosphorylation status of FAK, which is a key mediator of integrin signalling. At the leading edge in a migrating cell, active β1 integrin– FAK forms a complex with PI3K to promote cytoskeletal rearrangement [20,36]. To determine whether TIMP-1 mediates migration of hNSCs through PI3K, P1 and shCD1 cells were treated with TIMP-1, and cell signalling was investigated in their cellular lysates. First, we examined the phosphorylation of Akt and mTOR, both PI3K effectors, in response to TIMP1 by immunoblot analysis. TIMP-1 treatment of HB1.F3 and P1 cells produced a rapid and significant phosphorylation of both Akt and mTOR (Figures 7C and 7D). In contrast, TIMP-1 failed to induce phosphorylation of Akt in shCD1 cells (Figure 7D, right-hand panel), in support of the finding that CD63 plays a major role in the activation of the integrin/PI3K pathway during TIMP-1-mediated hNSC migration. Consistent with this result, the selective PI3K inhibitor LY294002 and the CDK inhibitor roscovitine significantly attenuated the cell migration induced by TIMP-1 (Figures 7E and 7F). However, the MAPK (mitogenactivated protein kinase) inhibitor PD98059 only marginally reduced cell migration induced by TIMP-1 (Figure 7G). Taken together, these results suggest that CD63 is a key regulator of the β1 integrin/PI3K pathway and hNSC migration, and is critically required for mediating chemotaxis to sources of TIMP-1, such as gliomas.

DISCUSSION

In the present study, we have identified a novel function for brain tumour-derived TIMP-1 in the regulation of hNSC migration. In vitro assays indicate that TIMP-1 can promote hNSC motility through the interaction with CD63 and activation of β1 integrin signalling, suggesting that the effects of TIMP1 can be direct and MMP-independent. Until recently, the dominant concept of natural inhibitors of metalloproteinases, TIMPs, focused on their capacity to repress the activities of ECM remodelling enzymes, such as MMPs. TIMP-1 is already well-known for its metalloproteinase inhibition. Therefore many researchers, including our group, have hypothesized that TIMP1 overexpression would yield a reduction in the number of infiltrating tumour cells into surrounding tissues or tumour tropism of stem cells based on numerous reports on the importance of MMPs for metastasis in many tumour models [40]. Contrary to our expectation, however, we reveal here for the first time an unexpected migration-promoting feature of TIMP-1, with its stimulation of hNSC migration. Previous studies have reported that, even when metalloproteinases are required for metastasis in a particular tumour model, TIMP-1 does not always suppress metastasis [40–43]. These findings support the idea that TIMP-1 possesses a broad range of biological activities, some of which may be independent of its metalloproteinase-inhibitory function [44–47]. Several reports have demonstrated that TIMP-1 performs its biological activities through binding to CD63 on the surface of cells. Jung et al. [31] identified CD63 as a cell-surface-binding

TIMP-1 promotes human neural stem cell migration

Figure 7

573

CD63 mediates TIMP-1-induced activation of β1 integrin signalling

(A) HB1.F3 cells were pre-treated with 5 μg/ml functional blocking antibody against the β1 integrin subunit (P5D2) or control mouse IgG1 for 30 min, and subjected to a Boyden chamber assay for 24 h in the presence of antibodies. (B) Western blot analysis of active FAK proteins (pTyr397 -FAK) in TIMP-1-treated cells. Bottom panels, quantification of Western blotting results using NIH ImageJ software. (C) HB1.F3 cells were incubated with 100 ng/ml TIMP-1 for up to 12 h. At the time points indicated, cells were analysed by immunoblot analysis using specific antibodies against phospho-Akt (Ser473 ), total Akt, phospho-mTOR (Ser2448 ) and β-actin. (D) P1 and shCD1 cells were stimulated with 100 ng/ml TIMP-1 for 30 and 60 min timepoints. Phosphorylated Akt was analysed by immunoblotting. (E–G) HB1.F3 cells were tested in a cell migration assay in the presence of the PI3K inhibitor LY294002 (E), the CDK inhibitor roscovitine (F) or the MAPK inhibitor PD98059 (G). Relative cell migration was determined. Results are the means + − S.E.M. for three independent experiments. ns, not significant. *P < 0.05; ***P < 0.0001 compared with the control.

partner for TIMP-1, involved in regulation of cell survival and polarization through a tetraspanin–integrin signalling complex. In addition, TIMP-1 has been shown to inhibit growth and osteogenic differentiation of hMSCs through binding to CD63 on the surface of hMSCs [27]. Consistent with those reports, we present data in the present study which shows that CD63 plays an important role in TIMP-1-mediated hNSC migration. First, we showed that TIMP-1 interacts with CD63 on the cell surface of hNSCs. Then, we revealed that CD63 is required for efficient hNSC adhesion and spreading on substrate. This finding is underlined by observations that CD63-deficient hNSCs generated by the shRNA system exhibit strikingly delayed spreading (48.9 % decrease in cell contact area). In addition, functional knockdown

of CD63 significantly down-regulated β1 integrin signalling, and totally inhibited hNSC migration, indicating that CD63 is the exclusive structure that interacts with TIMP-1, and thereby affects downstream signalling for hNSC migration. The involvement of CD63 in downstream signalling by TIMP-1 may be a ubiquitous function of this adaptor protein, although its implication in different cell types remains to be demonstrated. In addition to CD63, the present study shows that β1 integrin may act as another docking protein for TIMP-1 on the hNSC surface, as immunoprecipitation with an anti-CD63 antibody coprecipitated β1 integrin in the presence of TIMP-1. Here, we showed that TIMP-1 potentiated the β1 integrin/PI3K activation of hNSCs, suggesting that TIMP-1 also activates the integrin  c The Authors Journal compilation  c 2014 Biochemical Society

574

S. Y. Lee and others

pathway. In addition, the significance of β1 integrin and its downstream signalling involving the FAK/PI3K pathway in hNSC migration was directly demonstrated by treatment with an β1 integrin functional blocking antibody, as well as pharmacological inhibitors of the PI3K pathway, each causing the dramatic inhibition of hNSC migration. These results were consistent with previous reports demonstrating that activation of the β1 integrin signalling pathway plays an important role in cell migration [36,48]. Downstream of β1 integrin, phosphorylation of FAK at various tyrosine residues regulates FA turnover by mechanisms that are not well understood [36,48]. In the present study, we observed that CD63 down-regulation is concomitant with reduced FAK phosphorylation, as well as reduced FAK protein expression. The decreased number of FA contacts observed in CD63knockdown cells is consistent with the hypophosphorylation of FAK and Akt proteins. Our results suggest that CD63–β1 integrin signalling affects hNSC migration and FA number through the alteration of FAK phosphorylation. Cell movement is a complex process involving the extension of the plasma membrane at the cell front, and the formation of nascent FAs at membrane protrusions. Intracellular signals from integrins induce the formation of a FA complex, and modulate the dynamics of actin filaments [49]. Vinculin, a component of FA complexes, can transduce signalling between integrins and the cytoskeleton at FAs. This interaction is important for control of cytoskeletal reorganization, cell spreading and lamellipodia formation [50,51]. In the present study, we found that TIMP1 treatment led to an increased number of vinculin punctae, as well as changes in its staining pattern in hNSCs, suggesting that there was a rearrangement of the cytoskeleton and FA formation following TIMP-1 treatment. Several groups have previously reported that TIMP-1 modulates the motilities of various cell types. For example, TIMP-1 inhibits the migration of endothelial cells [52] and smooth muscle cells [53], but stimulates liver metastasis of metastatic colorectal cancer cells [42]. However, all of these processes are mediated through MMP-dependent mechanisms, and not through membrane receptors. In particular, a liver cancer study showed that host-derived TIMP-1 promotes liver metastasis by preserving c-Met on the cell surface, an effect that may be a consequence of direct inhibition of ADAM-10 (a disintegrin and metalloproteinase 10) [42]. In addition, TIMP-1 binds to and inhibits activation of pro-MMP-9 [21–26]. Our study, however, is the first report that TIMP-1 modulates cell migration through a membrane receptor, CD63, and integrin signalling. To check the possibility that hNSC migration by TIMP-1 is mediated by a mechanism that depends on MMP inhibitory activity, we examined the expression of MMP candidates in our previous microarray data from three hNSC lines, HB1.F3, HB1.A4 and HB1.F5 cells. Our hNSC lines showed weak expression of MMP9. Moreover, even if hNSCs showed high MMP-9 expression and TIMP-1 inhibition of MMP-9 activity, we still could anticipate a reduction in cell migration because of reduced ECM digestion as a result of the inhibited MMP-9 activity. For these two reasons, we concluded that the observed hNSC migration by TIMP-1 may be independent of MMP-inhibitory activity. We note that because the HB1.F3 and HB1.A4 cells used in the present paper are immortalized hNSC lines, further research may be needed to investigate whether the same mechanism works in primary hNSCs. Some groups have reported that several CNS cell types produce TIMP-1 during CNS development and following CNS injuries [54–58], suggesting it plays important roles in CNS development and injuries. Moore et al. [56] have shown that astrocytic TIMP-1 is strongly up-regulated following CNS injury, and participates to  c The Authors Journal compilation  c 2014 Biochemical Society

enhance CNS myelination and repair. Another report showed that, in the CNS, TIMP-1 is strongly up-regulated in reactive astrocytes and cortical neurons following excitotoxic and inflammatory stimuli, and functions as a modulator of neuronal outgrowth and morphology in a paracrine and autrocrine manner through the inhibition of MMP-2 [57]. Taken together, these reports demonstrate that various CNS cell types secret high levels of TIMP-1 in damaged situations, such as injury, inflammation or malignant glioma (the present study and [54–61]). This upregulation of TIMP-1 in CNS pathological sites evoked to us the notion that TIMP-1 may serve as a signal for hNSC tropism to pathological sites as a secondary function, in addition to its direct functions as a neutrophic or protective factor, to finally regenerate the damaged CNS tissues. Taking into account the expression of factors involved in the differentiation and tropism of hNSCs during a disease process may allow the optimization of efficient therapeutic transplantation, and the development of tumour therapeutic strategies based on combining hNSCs with TIMP-1 in the future.

AUTHOR CONTRIBUTION Soo Youn Lee and Jung Mi Kim performed and analysed the experiments; Hyun Suk Kim, Hee Sun Shin, Jeong Yong Jeon and Rukhsana Kausar carried out vinculin and F-actin staining, immunoprecipitation, Western blotting and live cell staining respectively; Myung Ae Lee designed the study, supervised the work, generated the paper and secured funding for the work; Soo Young Cho and Young Seek Lee carried out bioinformatic analyses from microarray data and proteomics data; Seon Yong Jeong carried out design and construction of the CD63 shRNA vector.

FUNDING This work was supported by the National R&D Program for Cancer Control, Ministry of Health & Welfare, Republic of Korea [grant number 1120100], by the National Research Foundation of Korea, a grant funded by the Korean Government [grant number 20110030772 (to Y.S.L.)], and the Graduate School of Medical Sciences, The Graduate School, Ajou University, Republic of Korea.

REFERENCES 1 Heese, O., Disko, A., Zirkel, D., Westphal, M. and Lamszus, K. (2005) Neural stem cell migration toward gliomas in vitro . Neuro Oncol. 7, 476–484 CrossRef PubMed 2 Aboody, K. S., Brown, A., Rainov, N. G., Bower, K. A., Liu, S., Yang, W., Small, J. E., Herrlinger, U., Ourednik, V., Black, P. M. et al. (2000) Neural stem cells display extensive tropism for pathology in adult brain: evidence from intracranial gliomas. Proc. Natl. Acad. Sci. U.S.A. 97, 12846–12851 CrossRef PubMed 3 Gage, F. H. (2000) Mammalian neural stem cells. Science 287, 1433–1438 CrossRef PubMed 4 McKay, R. (1997) Stem cells in the central nervous system. Science 276, 66–71 CrossRef PubMed 5 Yandava, B. D., Billinghurst, L. L. and Snyder, E. Y. (1999) “Global” cell replacement is feasible via neural stem cell transplantation: evidence from the dysmyelinated shiverer mouse brain. Proc. Natl. Acad. Sci. U.S.A. 96, 7029–7034 CrossRef PubMed 6 Brown, A. B., Yang, W., Schmidt, N. O., Carroll, R., Leishear, K. K., Rainov, N. G., Black, P. M., Breakefield, X. O. and Aboody, K. S. (2003) Intravascular delivery of neural stem cell lines to target intracranial and extracranial tumors of neural and non-neural origin. Hum. Gene Ther. 14, 1777–1785 CrossRef PubMed 7 Benedetti, S., Pirola, B., Pollo, B., Magrassi, L., Bruzzone, M. G., Rigamonti, D., Galli, R., Selleri, S., Di Meco, F., De Fraja, C. et al. (2000) Gene therapy of experimental brain tumors using neural progenitor cells. Nat. Med. 6, 447–450 CrossRef PubMed 8 Gutova, M., Najbauer, J., Frank, R. T., Kendall, S. E., Gevorgyan, A., Metz, M. Z., Guevorkian, M., Edmiston, M., Zhao, D., Glackin, C. A. et al. (2008) Urokinase plasminogen activator and urokinase plasminogen activator receptor mediate human stem cell tropism to malignant solid tumors. Stem Cells 26, 1406–1413 CrossRef PubMed 9 Terzis, A. J., Niclou, S. P., Rajcevic, U., Danzeisen, C. and Bjerkvig, R. (2006) Cell therapies for glioblastoma. Expert Opin. Biol. Ther. 6, 739–749 CrossRef PubMed

TIMP-1 promotes human neural stem cell migration 10 Joo, K. M., Park, I. H., Shin, J. Y., Jin, J., Kang, B. G., Kim, M. H., Lee, S. J., Jo, M. Y., Kim, S. U. and Nam, D. H. (2009) Human neural stem cells can target and deliver therapeutic genes to breast cancer brain metastases. Mol. Ther. 17, 570–575 CrossRef PubMed 11 Aboody, K. S., Bush, R. A., Garcia, E., Metz, M. Z., Najbauer, J., Justus, K. A., Phelps, D. A., Remack, J. S., Yoon, K. J., Gillespie, S. et al. (2006) Development of a tumor-selective approach to treat metastatic cancer. PLoS ONE 1, e23 CrossRef PubMed 12 Aboody, K. S., Najbauer, J., Schmidt, N. O., Yang, W., Wu, J. K., Zhuge, Y., Przylecki, W., Carroll, R., Black, P. M. and Perides, G. (2006) Targeting of melanoma brain metastases using engineered neural stem/progenitor cells. Neuro Oncol. 8, 119–126 CrossRef PubMed 13 Danks, M. K., Yoon, K. J., Bush, R. A., Remack, J. S., Wierdl, M., Tsurkan, L., Kim, S. U., Garcia, E., Metz, M. Z., Najbauer, J. et al. (2007) Tumor-targeted enzyme/prodrug therapy mediates long-term disease-free survival of mice bearing disseminated neuroblastoma. Cancer Res. 67, 22–25 CrossRef PubMed 14 Shimato, S., Natsume, A., Takeuchi, H., Wakabayashi, T., Fujii, M., Ito, M., Ito, S., Park, I. H., Bang, J. H., Kim, S. U. and Yoshida, J. (2007) Human neural stem cells target and deliver therapeutic gene to experimental leptomeningeal medulloblastoma. Gene Ther. 14, 1132–1142 CrossRef PubMed 15 Kim, S. K., Kim, S. U., Park, I. H., Bang, J. H., Aboody, K. S., Wang, K. C., Cho, B. K., Kim, M., Menon, L. G., Black, P. M. and Carroll, R. S. (2006) Human neural stem cells target experimental intracranial medulloblastoma and deliver a therapeutic gene leading to tumor regression. Clin. Cancer Res. 12, 5550–5556 CrossRef PubMed 16 Erlandsson, A., Larsson, J. and Forsberg-Nilsson, K. (2004) Stem cell factor is a chemoattractant and a survival factor for CNS stem cells. Exp. Cell Res. 301, 201–210 CrossRef PubMed 17 Widera, D., Holtkamp, W., Entschladen, F., Niggemann, B., Zanker, K., Kaltschmidt, B. and Kaltschmidt, C. (2004) MCP-1 induces migration of adult neural stem cells. Eur. J. Cell Biol. 83, 381–387 CrossRef PubMed 18 Imitola, J., Raddassi, K., Park, K. I., Mueller, F. J., Nieto, M., Teng, Y. D., Frenkel, D., Li, J., Sidman, R. L., Walsh, C. A. et al. (2004) Directed migration of neural stem cells to sites of CNS injury by the stromal cell-derived factor 1α/CXC chemokine receptor 4 pathway. Proc. Natl. Acad. Sci. U.S.A. 101, 18117–18122 CrossRef PubMed 19 Sun, L., Lee, J. and Fine, H. A. (2004) Neuronally expressed stem cell factor induces neural stem cell migration to areas of brain injury. J. Clin. Invest. 113, 1364–1374 CrossRef PubMed 20 Kendall, S. E., Najbauer, J., Johnston, H. F., Metz, M. Z., Li, S., Bowers, M., Garcia, E., Kim, S. U., Barish, M. E., Aboody, K. S. and Glackin, C. A. (2008) Neural stem cell targeting of glioma is dependent on phosphoinositide 3-kinase signaling. Stem Cells 26, 1575–1586 CrossRef PubMed 21 Guedez, L., Stetler-Stevenson, W. G., Wolff, L., Wang, J., Fukushima, P., Mansoor, A. and Stetler-Stevenson, M. (1998) In vitro suppression of programmed cell death of B cells by tissue inhibitor of metalloproteinases-1. J. Clin. Invest. 102, 2002–2010 CrossRef PubMed 22 Airola, K., Karonen, T., Vaalamo, M., Lehti, K., Lohi, J., Kariniemi, A. L., Keski-Oja, J. and Saarialho-Kere, U. K. (1999) Expression of collagenases-1 and -3 and their inhibitors TIMP-1 and -3 correlates with the level of invasion in malignant melanomas. Br. J. Cancer 80, 733–743 CrossRef PubMed 23 Slee, E. A., Harte, M. T., Kluck, R. M., Wolf, B. B., Casiano, C. A., Newmeyer, D. D., Wang, H. G., Reed, J. C., Nicholson, D. W., Alnemri, E. S. et al. (1999) Ordering the cytochrome c-initiated caspase cascade: hierarchical activation of caspases-2, -3, -6, -7, -8, and -10 in a caspase-9-dependent manner. J. Cell Biol. 144, 281–292 CrossRef PubMed 24 Liu, X. W., Bernardo, M. M., Fridman, R. and Kim, H. R. (2003) Tissue inhibitor of metalloproteinase-1 protects human breast epithelial cells against intrinsic apoptotic cell death via the focal adhesion kinase/phosphatidylinositol 3-kinase and MAPK signaling pathway. J. Biol. Chem. 278, 40364–40372 CrossRef PubMed 25 Liu, X. W., Taube, M. E., Jung, K. K., Dong, Z., Lee, Y. J., Roshy, S., Sloane, B. F., Fridman, R. and Kim, H. R. (2005) Tissue inhibitor of metalloproteinase-1 protects human breast epithelial cells from extrinsic cell death: a potential oncogenic activity of tissue inhibitor of metalloproteinase-1. Cancer Res. 65, 898–906 PubMed 26 Cui, Q., Yip, H. K., Zhao, R. C., So, K. F. and Harvey, A. R. (2003) Intraocular elevation of cyclic AMP potentiates ciliary neurotrophic factor-induced regeneration of adult rat retinal ganglion cell axons. Mol. Cell. Neurosci. 22, 49–61 CrossRef PubMed 27 Egea, V., Zahler, S., Rieth, N., Neth, P., Popp, T., Kehe, K., Jochum, M. and Ries, C. (2012) Tissue inhibitor of metalloproteinase-1 (TIMP-1) regulates mesenchymal stem cells through let-7f microRNA and Wnt/beta-catenin signaling. Proc. Natl. Acad. Sci. U.S.A. 109, E309–E316 CrossRef PubMed 28 Kim, S. U. (2004) Human neural stem cells genetically modified for brain repair in neurological disorders. Neuropathology 24, 159–171 CrossRef PubMed 29 Kim, S. U., Nakagawa, E., Hatori, K., Nagai, A., Lee, M. A. and Bang, J. H. (2002) Production of immortalized human neural crest stem cells. Methods Mol. Biol. 198, 55–65 PubMed

575

30 Lee, Y. J., Jeong, S. Y., Karbowski, M., Smith, C. L. and Youle, R. J. (2004) Roles of the mammalian mitochondrial fission and fusion mediators Fis1, Drp1, and Opa1 in apoptosis. Mol. Biol. Cell 15, 5001–5011 CrossRef PubMed 31 Jung, K. K., Liu, X. W., Chirco, R., Fridman, R. and Kim, H. R. (2006) Identification of CD63 as a tissue inhibitor of metalloproteinase-1 interacting cell surface protein. EMBO J. 25, 3934–3942 CrossRef PubMed 32 Jeon, J. Y., An, J. H., Kim, S. U., Park, H. G. and Lee, M. A. (2008) Migration of human neural stem cells toward an intracranial glioma. Exp. Mol. Med. 40, 84–91 CrossRef PubMed 33 An, J. H., Lee, S. Y., Jeon, J. Y., Cho, K. G., Kim, S. U. and Lee, M. A. (2009) Identification of gliotropic factors that induce human stem cell migration to malignant tumor. J. Proteome Res. 8, 2873–2881 CrossRef PubMed 34 Yokomizo, T., Izumi, T., Chang, K., Takuwa, Y. and Shimizu, T. (1997) A G-protein-coupled receptor for leukotriene B4 that mediates chemotaxis. Nature 387, 620–624 CrossRef PubMed 35 Chirco, R., Liu, X. W., Jung, K. K. and Kim, H. R. (2006) Novel functions of TIMPs in cell signaling. Cancer Metastasis Rev. 25, 99–113 CrossRef PubMed 36 Oinuma, I., Katoh, H. and Negishi, M. (2006) Semaphorin 4D/Plexin-B1-mediated R-Ras GAP activity inhibits cell migration by regulating β(1) integrin activity. J. Cell Biol. 173, 601–613 CrossRef PubMed 37 Hildebrand, J. D., Schaller, M. D. and Parsons, J. T. (1993) Identification of sequences required for the efficient localization of the focal adhesion kinase, pp125FAK, to cellular focal adhesions. J. Cell Biol. 123, 993–1005 CrossRef PubMed 38 Qin, L. and Zhang, M. (2010) Maspin regulates endothelial cell adhesion and migration through an integrin signaling pathway. J. Biol. Chem. 285, 32360–32369 CrossRef PubMed 39 Tharmalingam, S., Daulat, A. M., Antflick, J. E., Ahmed, S. M., Nemeth, E. F., Angers, S., Conigrave, A. D. and Hampson, D. R. (2011) Calcium-sensing receptor modulates cell adhesion and migration via integrins. J. Biol. Chem. 286, 40922–40933 CrossRef PubMed 40 Coussens, L. M. and Werb, Z. (1996) Matrix metalloproteinases and the development of cancer. Chem. Biol. 3, 895–904 CrossRef PubMed 41 Duffy, M. J., McGowan, P. M. and Gallagher, W. M. (2008) Cancer invasion and metastasis: changing views. J. Pathol. 214, 283–293 CrossRef PubMed 42 Kopitz, C., Gerg, M., Bandapalli, O. R., Ister, D., Pennington, C. J., Hauser, S., Flechsig, C., Krell, H. W., Antolovic, D., Brew, K. et al. (2007) Tissue inhibitor of metalloproteinases-1 promotes liver metastasis by induction of hepatocyte growth factor signaling. Cancer Res. 67, 8615–8623 CrossRef PubMed 43 Soloway, P. D., Alexander, C. M., Werb, Z. and Jaenisch, R. (1996) Targeted mutagenesis of Timp-1 reveals that lung tumor invasion is influenced by Timp-1 genotype of the tumor but not by that of the host. Oncogene 13, 2307–2314 PubMed 44 Rhee, J. S., Diaz, R., Korets, L., Hodgson, J. G. and Coussens, L. M. (2004) TIMP-1 alters susceptibility to carcinogenesis. Cancer Res. 64, 952–961 CrossRef PubMed 45 Chesler, L., Golde, D. W., Bersch, N. and Johnson, M. D. (1995) Metalloproteinase inhibition and erythroid potentiation are independent activities of tissue inhibitor of metalloproteinases-1. Blood 86, 4506–4515 PubMed 46 Porter, J. F., Shen, S. and Denhardt, D. T. (2004) Tissue inhibitor of metalloproteinase-1 stimulates proliferation of human cancer cells by inhibiting a metalloproteinase. Br. J. Cancer 90, 463–470 CrossRef PubMed 47 Kong, Y., Poon, R., Nadesan, P., Di Muccio, T., Fodde, R., Khokha, R. and Alman, B. A. (2004) Matrix metalloproteinase activity modulates tumor size, cell motility, and cell invasiveness in murine aggressive fibromatosis. Cancer Res. 64, 5795–5803 CrossRef PubMed 48 Devalliere, J., Chatelais, M., Fitau, J., Gerard, N., Hulin, P., Velazquez, L., Turner, C. E. and Charreau, B. (2012) LNK (SH2B3) is a key regulator of integrin signaling in endothelial cells and targets α-parvin to control cell adhesion and migration. FASEB J. 26, 2592–2606 CrossRef PubMed 49 Schoenwaelder, S. M. and Burridge, K. (1999) Bidirectional signaling between the cytoskeleton and integrins. Curr. Opin. Cell Biol. 11, 274–286 CrossRef PubMed 50 Carragher, N. O., Levkau, B., Ross, R. and Raines, E. W. (1999) Degraded collagen fragments promote rapid disassembly of smooth muscle focal adhesions that correlates with cleavage of pp125(FAK), paxillin, and talin. J. Cell Biol. 147, 619–630 CrossRef PubMed 51 Cohen, D. M., Chen, H., Johnson, R. P., Choudhury, B. and Craig, S. W. (2005) Two distinct head-tail interfaces cooperate to suppress activation of vinculin by talin. J. Biol. Chem. 280, 17109–17117 CrossRef PubMed 52 Akahane, T., Akahane, M., Shah, A., Connor, C. M. and Thorgeirsson, U. P. (2004) TIMP-1 inhibits microvascular endothelial cell migration by MMP-dependent and MMP-independent mechanisms. Exp. Cell Res. 301, 158–167 CrossRef PubMed 53 George, S. J., Johnson, J. L., Angelini, G. D., Newby, A. C. and Baker, A. H. (1998) Adenovirus-mediated gene transfer of the human TIMP-1 gene inhibits smooth muscle cell migration and neointimal formation in human saphenous vein. Hum. Gene Ther. 9, 867–877 CrossRef PubMed  c The Authors Journal compilation  c 2014 Biochemical Society

576

S. Y. Lee and others

54 Toft-Hansen, H., Nuttall, R. K., Edwards, D. R. and Owens, T. (2004) Key metalloproteinases are expressed by specific cell types in experimental autoimmune encephalomyelitis. J. Immunol. 173, 5209–5218 PubMed 55 Crocker, S. J., Whitmire, J. K., Frausto, R. F., Chertboonmuang, P., Soloway, P. D., Whitton, J. L. and Campbell, I. L. (2006) Persistent macrophage/microglial activation and myelin disruption after experimental autoimmune encephalomyelitis in tissue inhibitor of metalloproteinase-1-deficient mice. Am. J. Pathol. 169, 2104–2116 CrossRef PubMed 56 Moore, C. S., Milner, R., Nishiyama, A., Frausto, R. F., Serwanski, D. R., Pagarigan, R. R., Whitton, J. L., Miller, R. H. and Crocker, S. J. (2011) Astrocytic tissue inhibitor of metalloproteinase-1 (TIMP-1) promotes oligodendrocyte differentiation and enhances CNS myelination. J. Neurosci. 31, 6247–6254 CrossRef PubMed 57 Ould-yahoui, A., Tremblay, E., Sbai, O., Ferhat, L., Bernard, A., Charrat, E., Gueye, Y., Lim, N. H., Brew, K. et al. (2009) A new role for TIMP-1 in modulating neurite outgrowth and morphology of cortical neurons. PLoS ONE 4, e8289 CrossRef PubMed Received 27 August 2013/14 March 2014; accepted 18 March 2014 Published as BJ Immediate Publication 18 March 2014, doi:10.1042/BJ20131119

 c The Authors Journal compilation  c 2014 Biochemical Society

58 Rivera, S., Ogier, C., Jourquin, J., Timsit, S., Szklarczyk, A. W., Miller, K., Gearing, A. J., Kaczmarek, L. and Khrestchatisky, M. (2002) Gelatinase B and TIMP-1 are regulated in a cell- and time-dependent manner in association with neuronal death and glial reactivity after global forebrain ischemia. Eur. J. Neurosci. 15, 19–32 CrossRef PubMed 59 Pagenstecher, A., Stalder, A. K., Kincaid, C. L., Shapiro, S. D. and Campbell, I. L. (1998) Differential expression of matrix metalloproteinase and tissue inhibitor of matrix metalloproteinase genes in the mouse central nervous system in normal and inflammatory states. Am. J. Pathol. 152, 729–741 PubMed 60 Ozen, O., Krebs, B., Hemmerlein, B., Pekrun, A., Kretzschmar, H. and Herms, J. (2004) Expression of matrix metalloproteinases and their inhibitors in medulloblastomas and their prognostic relevance. Clin. Cancer Res. 10, 4746–4753 CrossRef PubMed 61 Groft, L. L., Muzik, H., Rewcastle, N. B., Johnston, R. N., Knauper, V., Lafleur, M. A., Forsyth, P. A. and Edwards, D. R. (2001) Differential expression and localization of TIMP-1 and TIMP-4 in human gliomas. Br. J. Cancer 85, 55–63 CrossRef PubMed

Biochem. J. (2014) 459, 565–576 (Printed in Great Britain)

doi:10.1042/BJ20131119

SUPPLEMENTARY ONLINE DATA

TIMP-1 modulates chemotaxis of human neural stem cells through CD63 and integrin signalling Soo Youn LEE*†, Jung Mi KIM*†, Soo Young CHO‡§, Hyun Suk KIM*†, Hee Sun SHIN*†, Jeong Yong JEON*†, Rukhsana KAUSAR*†, Seon Yong JEONG, Young Seek LEE¶ and Myung Ae LEE*†1 *Department of Brain Science, Ajou University School of Medicine, Suwon, Korea †Neuroscience Graduate Program, Department of Biomedical Sciences, Graduate School of Ajou University, Suwon, Korea ‡Mammalian Genetics Unit, Medical Research Council Harwell, Harwell, Oxfordshire OX11 0RD, U.K. §Laboratory of Developmental Biology and Genomics, College of Veterinary Medicine, and Interdisciplinary Program for Bioinformatics, Program for Cancer Biology and BIO-MAX Institute, Seoul National University, Seoul, Korea Department of Medical Genetics, Ajou University School of Medicine, Suwon, Korea ¶Division of Molecular Life Science, Hanyang University, Ansan, Korea

Figure S1

Images of FAs in P1 cells stained for vinculin

P1 cells were plated on laminin-coated culture dishes and stimulated with ( + T) or without ( − T) 100 ng/ml TIMP-1for 12 h. For immunofluorescence, cells were fixed with 1 % paraformaldehyde and stained for vinculin (for FAs, green) and observed by confocal microscopy.

Figure S2

Confocal images of P1 cells stained for F-actin

P1 cells were plated on laminin-coated culture dishes and stimulated with ( + T) or without ( − T) 100 ng/ml TIMP-1 for 12 h. For immunofluorescence, cells were fixed with 1 % paraformaldehyde and stained for F-actin (phalloidin-TRITC, red) and observed by confocal microscopy.

Received 27 August 2013/14 March 2014; accepted 18 March 2014 Published as BJ Immediate Publication 18 March 2014, doi:10.1042/BJ20131119

1

To whom correspondence should be addressed (email [email protected]).  c The Authors Journal compilation  c 2014 Biochemical Society

Copyright of Biochemical Journal is the property of Portland Press Ltd. and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.